Accession ID: MIRT005533 [miRNA, hsa-miR-29b-3p :: FGA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29b-1LinkOut: [miRBase ]
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Mature Sequence 51| UAGCACCAUUUGAAAUCAGUGUU |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: FGA    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HuH7 , HEK-293T
Location of target site 3'UTR
Original Description (Extracted from the article) ... We observed significant 24%, 30% and 30% decreases in fibrinogen production when HuH7 cells were transfected with 30 nM of hsa-miR-29c, hsa-miR-29a and hsa-miR- 29b respectively, compared to cells transfected with a negative control precursor molecule (Figure 2A). A similar effect was also observed at lower concentrations (3.3 nM and 10 nM). These results confirm that transfection of hsa-miR-29 family members can reduce fibrinogen production.//Compared to the control condition transfected with hsa-miR-144, a decrease of all five fibrinogen transcripts was observed when HuH7 cells were transfected with hsa-miR-29a, hsa-miR-29b or hsa-miR-29c (Figure 2B). The FGB mRNA level is on average reduced by 56% compared to the non-transfected control, while FGA and FGG transcript levels show reductions of 51% and 42% respectively. ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
226 hsa-miR-29b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000095 TGFB3 transforming growth factor, beta 3 2 1
MIRT000096 HDAC4 histone deacetylase 4 2 2
MIRT000097 CTNNBIP1 catenin, beta interacting protein 1 3 3
MIRT000098 COL5A3 collagen, type V, alpha 3 2 2
MIRT000099 COL4A2 collagen, type IV, alpha 2 2 2
MIRT000100 COL1A1 collagen, type I, alpha 1 5 7
MIRT000101 ACVR2A activin A receptor, type IIA 1 1
MIRT000445 SP1 Sp1 transcription factor 5 6
MIRT000684 CDK6 cyclin-dependent kinase 6 5 4
MIRT000930 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT002310 SFPQ splicing factor proline/glutamine-rich 3 1
MIRT002316 DNAJB11 DnaJ (Hsp40) homolog, subfamily B, member 11 3 1
MIRT003026 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 6
MIRT003029 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 8
MIRT003287 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 6 15
MIRT003290 BCL2 B-cell CLL/lymphoma 2 4 3
MIRT003661 DNMT1 DNA (cytosine-5-)-methyltransferase 1 4 2
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 4 5
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet methylcytosine dioxygenase 1 4 2
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 (membrane-inserted) 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 (membrane-inserted) 4 2
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen, type III, alpha 1 5 4
MIRT005568 COL4A1 collagen, type IV, alpha 1 6 6
MIRT005570 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 5 8
MIRT005614 BBC3 BCL2 binding component 3 1 1
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 4 2
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor, beta 2 2 2
MIRT006059 TGFB1 transforming growth factor, beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 4 2
MIRT006251 NASP nuclear autoantigenic sperm protein (histone-binding) 2 1
MIRT006486 PPP1R13B protein phosphatase 1, regulatory subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 2
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras-like 2 4 2
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon, gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 2 2
MIRT007254 FOS FBJ murine osteosarcoma viral oncogene homolog 2 2
MIRT027237 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 2 2
MIRT027238 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 2 2
MIRT027239 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 2
MIRT048359 SCAF8 SR-related CTD-associated factor 8 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 low density lipoprotein receptor-related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1, binding protein 3 1 1
MIRT048365 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 cat eye syndrome chromosome region, candidate 2 1 1
MIRT048372 TPD52L2 tumor protein D52-like 2 1 1
MIRT048373 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT048374 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT048375 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT048377 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP neuronal regeneration related protein homolog (rat) 1 1
MIRT048383 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT053293 TDG thymine-DNA glycosylase 4 3
MIRT053581 CCND2 cyclin D2 4 2
MIRT053738 COL4A5 collagen, type IV, alpha 5 1 1
MIRT053739 COL7A1 collagen, type VII, alpha 1 1 1
MIRT053740 COL15A1 collagen, type XV, alpha 1 1 1
MIRT053741 COL2A1 collagen, type II, alpha 1 1 1
MIRT053742 COL4A6 collagen, type IV, alpha 6 1 1
MIRT053743 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT053744 SOX12 SRY (sex determining region Y)-box 12 1 1
MIRT053745 MAP2K6 mitogen-activated protein kinase kinase 6 1 1
MIRT053746 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT053747 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 2 2
MIRT053748 NOTCH2 notch 2 1 1
MIRT053749 PPARD peroxisome proliferator-activated receptor delta 1 1
MIRT054045 SNAI3 snail homolog 3 (Drosophila) 2 1
MIRT054192 AKT2 v-akt murine thymoma viral oncogene homolog 2 3 1
MIRT054574 PER1 period homolog 1 (Drosophila) 3 1
MIRT061662 BTG2 BTG family, member 2 1 2
MIRT067385 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 2
MIRT079942 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 1
MIRT080798 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 2
MIRT081893 KCTD15 potassium channel tetramerisation domain containing 15 1 4
MIRT082515 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT085293 CCNT2 cyclin T2 1 3
MIRT102856 INSIG1 insulin induced gene 1 1 1
MIRT207249 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT207755 VHL von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase 1 2
MIRT210969 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211650 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT213230 REST RE1-silencing transcription factor 1 5
MIRT225103 GOLGA7 golgin A7 1 1
MIRT250481 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT264266 FAM102B family with sequence similarity 102, member B 1 1
MIRT267090 ZFP91 zinc finger protein 91 homolog (mouse) 1 1
MIRT303363 MXD1 MAX dimerization protein 1 2 1
MIRT316344 ULBP2 UL16 binding protein 2 1 1
MIRT401476 AIM1 absent in melanoma 1 2 1
MIRT437369 LAMC2 laminin, gamma 2 3 1
MIRT437372 ITGA6 integrin, alpha 6 3 2
MIRT437552 COL5A2 collagen, type V, alpha 2 1 1
MIRT437553 COL10A1 collagen, type X, alpha 1 1 1
MIRT437554 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 1 1
MIRT437555 FBN1 fibrillin 1 1 1
MIRT437556 LOX lysyl oxidase 2 2
MIRT437557 PDGFRB platelet-derived growth factor receptor, beta polypeptide 2 2
MIRT437710 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437713 TUBB2A tubulin, beta 2A class IIa 2 1
MIRT437716 EMP1 epithelial membrane protein 1 2 1
MIRT437719 SNX24 sorting nexin 24 2 1
MIRT437722 AMFR autocrine motility factor receptor, E3 ubiquitin protein ligase 2 1
MIRT437725 RIOK3 RIO kinase 3 (yeast) 2 1
MIRT437728 WDR26 WD repeat domain 26 3 2
MIRT437731 DSC2 desmocollin 2 2 1
MIRT437870 IL32 interleukin 32 1 1
MIRT438911 GATA3 GATA binding protein 3 2 1
MIRT438912 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 2 1
MIRT438913 PDGFC platelet derived growth factor C 2 1
MIRT438914 PDGFB platelet-derived growth factor beta polypeptide 2 1
MIRT438915 PDGFA platelet-derived growth factor alpha polypeptide 2 1
MIRT438916 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 2 1
MIRT438917 LOXL4 lysyl oxidase-like 4 2 1
MIRT438918 LOXL2 lysyl oxidase-like 2 2 1
MIRT438919 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 2 1
MIRT438920 ANGPTL4 angiopoietin-like 4 2 1
MIRT454812 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 1 1
MIRT456827 MORF4L2 mortality factor 4 like 2 1 4
MIRT462151 RPL22 ribosomal protein L22 1 1
MIRT465314 TRAM2 translocation associated membrane protein 2 1 1
MIRT467808 SLC2A14 solute carrier family 2 (facilitated glucose transporter), member 14 1 1
MIRT467829 SLC29A2 solute carrier family 29 (nucleoside transporters), member 2 1 1
MIRT467971 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 2
MIRT468225 SGK1 serum/glucocorticoid regulated kinase 1 1 1
MIRT469448 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT469723 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT469841 R3HDM4 R3H domain containing 4 1 1
MIRT472643 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae) 1 1
MIRT474209 LEPRE1 leucine proline-enriched proteoglycan (leprecan) 1 1 1
MIRT474576 KLHDC3 kelch domain containing 3 1 1
MIRT475837 HDGF hepatoma-derived growth factor 1 2
MIRT476721 FRK fyn-related kinase 1 2
MIRT477473 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT478668 CTC1 CTS telomere maintenance complex component 1 1 7
MIRT478710 CSRNP2 cysteine-serine-rich nuclear protein 2 1 1
MIRT478985 COMMD2 COMM domain containing 2 1 1
MIRT479826 CCNA2 cyclin A2 1 4
MIRT479901 CCDC117 coiled-coil domain containing 117 1 1
MIRT480066 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT482012 AMER1 family with sequence similarity 123B 1 4
MIRT489024 C1QTNF6 C1q and tumor necrosis factor related protein 6 1 1
MIRT492513 RAET1L retinoic acid early transcript 1L 1 1
MIRT493825 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT495936 SLC7A5P2 solute carrier family 7 (amino acid transporter light chain, L system), member 5 pseudogene 2 1 1
MIRT496358 PPY pancreatic polypeptide 1 1
MIRT496662 TMEM237 transmembrane protein 237 1 1
MIRT497644 GLDN gliomedin 1 1
MIRT501878 MORF4L1 mortality factor 4 like 1 1 4
MIRT502932 CDC42SE1 CDC42 small effector 1 1 2
MIRT506750 LDOC1L leucine zipper, down-regulated in cancer 1-like 1 3
MIRT507168 GAS2L3 growth arrest-specific 2 like 3 1 1
MIRT514918 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 3
MIRT523962 DYNLT1 dynein, light chain, Tctex-type 1 1 2
MIRT527675 CASP8 caspase 8, apoptosis-related cysteine peptidase 1 1
MIRT536936 HECW1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 1 1
MIRT537359 FJX1 four jointed box 1 (Drosophila) 1 1
MIRT537687 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 1 1
MIRT538124 DDX6 DEAD (Asp-Glu-Ala-Asp) box helicase 6 1 1
MIRT538813 C21orf91 chromosome 21 open reading frame 91 1 1
MIRT546938 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT547104 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT547823 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT548237 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT550036 WWTR1 WW domain containing transcription regulator 1 1 1
MIRT552619 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT556562 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT558857 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT565485 SPRTN SprT-like N-terminal domain 1 1
MIRT568205 CBX6 chromobox homolog 6 1 1
MIRT576774 Tmem127 transmembrane protein 127 1 1
MIRT576958 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT610003 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT616511 COX7A2L cytochrome c oxidase subunit VIIa polypeptide 2 like 1 1
MIRT640887 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT641350 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT642978 TESPA1 thymocyte expressed, positive selection associated 1 1 1
MIRT643634 YY2 YY2 transcription factor 1 1
MIRT644386 ZNF286A zinc finger protein 286A 1 1
MIRT650749 YAE1D1 Yae1 domain containing 1 1 1
MIRT661585 EPHX2 epoxide hydrolase 2, cytoplasmic 1 1
MIRT664287 RNMTL1 RNA methyltransferase like 1 1 1
MIRT689393 ZNF850 zinc finger protein 850 1 1
MIRT693815 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT694532 TRIM72 tripartite motif containing 72 1 1
MIRT694628 ZFPM1 zinc finger protein, multitype 1 1 1
MIRT695135 PRY2 PTPN13-like, Y-linked 2 1 1
MIRT695152 PRY PTPN13-like, Y-linked 1 1
MIRT703640 FBRS fibrosin 1 1
MIRT704551 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT704967 CBX2 chromobox homolog 2 1 1
MIRT705497 ASXL2 additional sex combs like 2 (Drosophila) 1 1
MIRT707993 OTUD4 OTU domain containing 4 1 1
MIRT708741 FAM71F2 family with sequence similarity 71, member F2 1 1
MIRT710621 COLEC10 collectin sub-family member 10 (C-type lectin) 1 1
MIRT713056 IFRD1 interferon-related developmental regulator 1 1 1
MIRT715515 MAPKBP1 mitogen-activated protein kinase binding protein 1 1 1
MIRT720770 FAM193A family with sequence similarity 193, member A 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*