Accession ID: MIRT005550 [miRNA, hsa-miR-185-5p :: SIX1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-185LinkOut: [miRBase ]
Synonyms MIRN185, miR-185, MIR185
Description Homo sapiens miR-185 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-185-5p
Mature Sequence 15| UGGAGAGAAAGGCAGUUCCUGA |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-185-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SIX1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BOS3, DFNA23, TIP39
Description SIX homeobox 1
Transcript NM_0059    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SIX1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SIX1
(miRNA target sites are highlighted)
>SIX1|NM_0059|3'UTR
   1 TAAGTGGGGAGGGACTGGGGCCTCGAAGGGATTCCTGGAGCAGCAACCACTGCAGCGACTAGGGACACTTGTAAATAGAA
  81 ATCAGGAACATTTTTGCAGCTTGTTTCTGGAGTTGTTTGCGCATAAAGGAATGGTGGACTTTCACAAATATCTTTTTAAA
 161 AATCAAAACCAACAGCGATCTCAAGCTTAATCTCCTCTTCTCTCCAACTCTTTCCACTTTTGCATTTTCCTTCCCAATGC
 241 AGAGATCAGGGAAAAAAAAAAAAAAAAACCCAAACAAACAAAAGCACCCAGGCACCCAGTCTGAGTTCTGGGCAACTGAT
 321 ACGCCTGTTTCAGCAGCCTTTCTTTTTTTTCAATGAATGGGAATTGCAAATCAACTGGATTTTCATTATTTCCTTTTAAT
 401 TTATATATGGAGAAATGTGAAGAGGGAAAGGAAATGGAAAGAGAAAGAGAAAGGGAGATAAAAATAGTGAAAATAAGAGC
 481 CTCCAGGCTCAGAAGAACTGATTACATTCTTAAGGTGAACAGGAAAAATACAATCTATAACTTTCTTTGATGAGGAAAAA
 561 TTAAGTTTACATTTTTCATATTTAGTGTTAAACAATTTAATGTAGATTAAAATAAAAGACCAGTATTAGGAGGAAAAAAC
 641 AAGTGCCTAAATGTCTTAATGCTCTCTATGTGAGACAGAAATAGACGTGACCATTAGTAATGCAACTATTTTTGTCAAAT
 721 TTAGTGGGATTTTTTGGTTGTTGTTTGTTTTCTTGGGTTTTTTTTTTTTAAATGACAAACTCTAAAAATGTACCAATGTG
 801 AAAAAACACTTTCCTGAATGCCATTACTCATGCCCTCAAAGCTTTCATATCTGTAGCCTACTCCTGTAAAGGGTTTCTCC
 881 TGTTTCTAGTTTCTAGTTTGCAAAGGTATGCCAACGAATCTGGCAACCTGGTATTTGTTACTAAAACAGCATGTGTTTTC
 961 AGGTTTCTTTTCTATTGTACCTAAAGCAGTCTAAATTAAAACTTAGTAGAACACCAGGAGTATGATTCTGTTTCTGAAAG
1041 GTGAGTGGTGTATTGCTGTCATTGGGCCCTATTTTTTTTTTTAAATATATTTTTCTTTCTTACTTAATGGTGGCTGTGAA
1121 TTGCAGGGTACTTTGAAGGCCATCATCTGAACCAAGAGTAGTAACTAGATTAATTATATGACAGAAAGAGTGAATTTAGC
1201 CTTGGGGTATTTATTAACTTCTATTATTTAGATATGCAATTTTGTTTACCACTATCTCTTCACAGCATTCATATGTTAAC
1281 TAAGCTCTTTTGTGTTAACAAGTTTATGACAAGACTGTGAAAGTAAAAATAATTTATCTGCTTGAAGACAAAAAAGGGAA
1361 GGAGAACAAGGATAGAAACATTGTGAATTAATTTGTACAAATAGAAAGCAGACCAGCAGGACAGGAGCTCTTTTGCAGTG
1441 CTGCCGGATGGTGTCTAGAAAAATCCCAGTAATCATGTAGGCTCCATATTATTTTTGCCTGGGGCAAAATGATGTATCTT
1521 CTGTATTTAGCTTTTAAAATTAGTGAAACAAATGGCATTATTTATTAAAATTCTACTCAGGATAACA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguccUUGACGGAAAGAGAGGu 5'
               | || |: |||||||| 
Target 5' gcttaATCTCCTCTTCTCTCCa 3'
185 - 206 157.00 -17.00
2
miRNA  3' aguccuugacgGAAAGAGAGGu 5'
                     || |||||:| 
Target 5' tttgtttaccaCTATCTCTTCa 3'
1241 - 1262 131.00 -11.90
3
miRNA  3' aguccuUGACGGAA------AGAGAGGu 5'
                ||| |: |      |:||||| 
Target 5' tagcctACTCCTGTAAAGGGTTTCTCCt 3'
854 - 881 126.00 -14.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-185-5p :: SIX1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Quantitative proteomic approach , Western blot , Other
Conditions HEK-293 , SKOV3 , MCF7 , MDA-MB-231 , SKBR3
Disease cancer//breast cancer//ovarian cancer//hepatocellular carcinoma//rhabdomyosarcoma//Wilms' tumor;
Location of target site 3'UTR
Tools used in this research miRanda , miTarget , TargetScan , mirTarget2 , PITA , RNA22 , RNAhybrid
Original Description (Extracted from the article) ... Our results reveal that miRNA-185 translationally represses Six1 by binding to its 3'-untranslated region//Our results show that miR-185 triplicated binding sequence elicited a more robust translational repression of luciferase activity when compared with the full 3'-UTR of Six1, which contains a single miR-185 binding site, suggesting that this sequence is a bona fide miR-185 binding site (Figure 1e)// ...

- Imam, J. S. Buddavarapu, K. Lee-Chang, J. et al., 2010, Oncogene.

Article - Imam, J. S. Buddavarapu, K. Lee-Chang, J. et al.
- Oncogene, 2010
Homeobox genes encode transcription factors that are essential for normal development and are often dysregulated in cancers. The molecular mechanisms that cause their misregulation in cancers are largely unknown. In this study, we investigate the mechanism by which the Six1 homeobox protein, which has a crucial role during development, is frequently deregulated in several poor outcome, aggressive, metastatic adult human cancers, including breast cancer, ovarian cancer, hepatocellular carcinoma and pediatric malignancies such as rhabdomyosarcoma and Wilms' tumor. Our results reveal that miRNA-185 translationally represses Six1 by binding to its 3'-untranslated region. Analyses of ovarian cancers, pediatric renal tumors and multiple breast cancer cell lines showed decreased miR-185 expression, paralleling an increase in Six1 levels. Further investigation revealed that miR-185 impedes anchorage-independent growth and cell migration, in addition to suppressing tumor growth in vivo, implicating it to be a potent tumor suppressor. Our results indicate that miR-185 mediates its tumor suppressor function by regulating cell-cycle proteins and Six1 transcriptional targets c-myc and cyclin A1. Furthermore, we show that miR-185 sensitizes Six1-overexpressing resistant cancer cells to apoptosis in general and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated apoptosis in particular. Together, our findings suggest that the altered expression of the novel tumor suppressor miR-185 may be one of the central events that leads to dysregulation of oncogenic protein Six1 in human cancers.Oncogene advance online publication, 5 July 2010; doi:10.1038/onc.2010.233.
LinkOut: [PMID: 20603620]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
88 hsa-miR-185-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004036 RHOA ras homolog gene family, member A 4 1
MIRT004037 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 1
MIRT004698 CCNE1 cyclin E1 3 1
MIRT004700 CDK6 cyclin-dependent kinase 6 4 2
MIRT004701 AKT1 v-akt murine thymoma viral oncogene homolog 1 3 1
MIRT004702 HMGA2 high mobility group AT-hook 2 3 1
MIRT004703 CORO2B coronin, actin binding protein, 2B 3 1
MIRT005550 SIX1 SIX homeobox 1 4 1
MIRT005963 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 1 1
MIRT006696 DNMT1 DNA (cytosine-5-)-methyltransferase 1 4 1
MIRT006962 EPAS1 endothelial PAS domain protein 1 2 1
MIRT035517 AR androgen receptor 1 1
MIRT035549 SCARB1 scavenger receptor class B, member 1 1 1
MIRT045312 MATR3 matrin 3 1 1
MIRT045313 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 1
MIRT045314 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT045315 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT045316 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT045317 MSANTD1 chromosome 4 open reading frame 44 1 1
MIRT045318 WDR77 WD repeat domain 77 1 1
MIRT045319 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT045320 ARL9 ADP-ribosylation factor-like 9 1 1
MIRT045321 AADACL3 arylacetamide deacetylase-like 3 1 1
MIRT045322 FASTK Fas-activated serine/threonine kinase 1 1
MIRT045323 COPB1 coatomer protein complex, subunit beta 1 1 1
MIRT045324 STK35 serine/threonine kinase 35 1 1
MIRT045325 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT045326 CAMKK2 calcium/calmodulin-dependent protein kinase kinase 2, beta 1 1
MIRT045327 FRMPD4 FERM and PDZ domain containing 4 1 1
MIRT045328 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT045329 CYFIP1 cytoplasmic FMR1 interacting protein 1 1 1
MIRT045330 GLUL glutamate-ammonia ligase 1 1
MIRT045331 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT045332 DENND2A DENN/MADD domain containing 2A 1 1
MIRT045333 GLB1L3 galactosidase, beta 1-like 3 1 1
MIRT045334 CANX calnexin 1 1
MIRT045335 GSTA4 glutathione S-transferase alpha 4 1 1
MIRT045336 ANKHD1 ankyrin repeat and KH domain containing 1 1 1
MIRT045337 MPV17 MpV17 mitochondrial inner membrane protein 1 1
MIRT045338 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT045339 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT045340 TUBB tubulin, beta 1 1
MIRT045341 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT045342 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT045343 KIAA0368 KIAA0368 1 1
MIRT045344 SMG7 Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT045345 UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 1 1
MIRT045346 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT045347 TMEM160 transmembrane protein 160 1 1
MIRT045348 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT045349 ATP5G2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) 1 1
MIRT045350 LDHB lactate dehydrogenase B 1 1
MIRT045351 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT045352 KITLG KIT ligand 1 1
MIRT045353 MED17 mediator complex subunit 17 1 1
MIRT045354 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT045355 LENG8 leukocyte receptor cluster (LRC) member 8 1 1
MIRT045356 CACHD1 cache domain containing 1 1 1
MIRT045357 DAZAP1 DAZ associated protein 1 1 1
MIRT045358 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT045359 GLUD1 glutamate dehydrogenase 1 1 1
MIRT045360 LUZP1 leucine zipper protein 1 1 1
MIRT045361 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT045362 RAE1 RAE1 RNA export 1 homolog (S. pombe) 1 1
MIRT045363 SMG6 Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT045364 ACTN4 actinin, alpha 4 1 1
MIRT045365 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT045366 UHMK1 U2AF homology motif (UHM) kinase 1 1 1
MIRT045367 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT045368 GOLGA2P5 golgin A2 family, member B 1 1
MIRT045369 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 1 1
MIRT045370 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT045371 WNT5B wingless-type MMTV integration site family, member 5B 1 1
MIRT045372 MARS methionyl-tRNA synthetase 1 1
MIRT045373 AKT1S1 AKT1 substrate 1 (proline-rich) 1 1
MIRT045374 MLF1IP MLF1 interacting protein 1 1
MIRT045375 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT045376 CTTN cortactin 1 1
MIRT045377 SET SET nuclear oncogene 1 1
MIRT045378 IBTK inhibitor of Bruton agammaglobulinemia tyrosine kinase 1 1
MIRT045379 XPO6 exportin 6 1 1
MIRT045380 GPR108 G protein-coupled receptor 108 1 1
MIRT045381 TRRAP transformation/transcription domain-associated protein 1 1
MIRT045382 ARL16 ADP-ribosylation factor-like 16 1 1
MIRT045383 C16orf70 chromosome 16 open reading frame 70 1 1
MIRT045384 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT045385 EMC10 chromosome 19 open reading frame 63 1 1
MIRT045386 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 1 1