Accession ID: MIRT005550 [miRNA, hsa-miR-185-5p :: SIX1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-185LinkOut: [miRBase ]
Synonyms MIRN185, miR-185, MIR185
Description Homo sapiens miR-185 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-185-5p
Mature Sequence 15| UGGAGAGAAAGGCAGUUCCUGA |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-185-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SIX1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BOS3, DFNA23, TIP39
Description SIX homeobox 1
Transcript NM_005982    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SIX1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SIX1
(miRNA target sites are highlighted)
>SIX1|NM_005982|3'UTR
   1 GTGGGGAGGGACTGGGGCCTCGAAGGGATTCCTGGAGCAGCAACCACTGCAGCGACTAGGGACACTTGTAAATAGAAATC
  81 AGGAACATTTTTGCAGCTTGTTTCTGGAGTTGTTTGCGCATAAAGGAATGGTGGACTTTCACAAATATCTTTTTAAAAAT
 161 CAAAACCAACAGCGATCTCAAGCTTAATCTCCTCTTCTCTCCAACTCTTTCCACTTTTGCATTTTCCTTCCCAATGCAGA
 241 GATCAGGGAAAAAAAAAAAAAAAAACCCAAACAAACAAAAGCACCCAGGCACCCAGTCTGAGTTCTGGGCAACTGATACG
 321 CCTGTTTCAGCAGCCTTTCTTTTTTTTCAATGAATGGGAATTGCAAATCAACTGGATTTTCATTATTTCCTTTTAATTTA
 401 TATATGGAGAAATGTGAAGAGGGAAAGGAAATGGAAAGAGAAAGAGAAAGGGAGATAAAAATAGTGAAAATAAGAGCCTC
 481 CAGGCTCAGAAGAACTGATTACATTCTTAAGGTGAACAGGAAAAATACAATCTATAACTTTCTTTGATGAGGAAAAATTA
 561 AGTTTACATTTTTCATATTTAGTGTTAAACAATTTAATGTAGATTAAAATAAAAGACCAGTATTAGGAGGAAAAAACAAG
 641 TGCCTAAATGTCTTAATGCTCTCTATGTGAGACAGAAATAGACGTGACCATTAGTAATGCAACTATTTTTGTCAAATTTA
 721 GTGGGATTTTTTGGTTGTTGTTTGTTTTCTTGGGTTTTTTTTTTTTAAATGACAAACTCTAAAAATGTACCAATGTGAAA
 801 AAACACTTTCCTGAATGCCATTACTCATGCCCTCAAAGCTTTCATATCTGTAGCCTACTCCTGTAAAGGGTTTCTCCTGT
 881 TTCTAGTTTCTAGTTTGCAAAGGTATGCCAACGAATCTGGCAACCTGGTATTTGTTACTAAAACAGCATGTGTTTTCAGG
 961 TTTCTTTTCTATTGTACCTAAAGCAGTCTAAATTAAAACTTAGTAGAACACCAGGAGTATGATTCTGTTTCTGAAAGGTG
1041 AGTGGTGTATTGCTGTCATTGGGCCCTATTTTTTTTTTTAAATATATTTTTCTTTCTTACTTAATGGTGGCTGTGAATTG
1121 CAGGGTACTTTGAAGGCCATCATCTGAACCAAGAGTAGTAACTAGATTAATTATATGACAGAAAGAGTGAATTTAGCCTT
1201 GGGGTATTTATTAACTTCTATTATTTAGATATGCAATTTTGTTTACCACTATCTCTTCACAGCATTCATATGTTAACTAA
1281 GCTCTTTTGTGTTAACAAGTTTATGACAAGACTGTGAAAGTAAAAATAATTTATCTGCTTGAAGACAAAAAAGGGAAGGA
1361 GAACAAGGATAGAAACATTGTGAATTAATTTGTACAAATAGAAAGCAGACCAGCAGGACAGGAGCTCTTTTGCAGTGCTG
1441 CCGGATGGTGTCTAGAAAAATCCCAGTAATCATGTAGGCTCCATATTATTTTTGCCTGGGGCAAAATGATGTATCTTCTG
1521 TATTTAGCTTTTAAAATTAGTGAAACAAATGGCATTATTTATTAAAATTCTACTCAGGATAACA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguccUUGACGGAAAGAGAGGu 5'
               | || |: |||||||| 
Target 5' gcttaATCTCCTCTTCTCTCCa 3'
182 - 203 157.00 -17.00
2
miRNA  3' aguccuugacgGAAAGAGAGGu 5'
                     || |||||:| 
Target 5' tttgtttaccaCTATCTCTTCa 3'
1238 - 1259 131.00 -11.90
3
miRNA  3' aguccuUGACGGAA------AGAGAGGu 5'
                ||| |: |      |:||||| 
Target 5' tagcctACTCCTGTAAAGGGTTTCTCCt 3'
851 - 878 126.00 -14.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-185-5p :: SIX1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Quantitative proteomic approach , Western blot , Other
Conditions HEK-293 , SKOV3 , MCF7 , MDA-MB-231 , SKBR3
Disease cancer//breast cancer//ovarian cancer//hepatocellular carcinoma//rhabdomyosarcoma//Wilms' tumor;
Location of target site 3'UTR
Tools used in this research miRanda , miTarget , TargetScan , mirTarget2 , PITA , RNA22 , RNAhybrid
Original Description (Extracted from the article) ... Our results reveal that miRNA-185 translationally represses Six1 by binding to its 3'-untranslated region//Our results show that miR-185 triplicated binding sequence elicited a more robust translational repression of luciferase activity when compared with the full 3'-UTR of Six1, which contains a single miR-185 binding site, suggesting that this sequence is a bona fide miR-185 binding site (Figure 1e)// ...

- Imam, J. S. Buddavarapu, K. Lee-Chang, J. et al., 2010, Oncogene.

Article - Imam, J. S. Buddavarapu, K. Lee-Chang, J. et al.
- Oncogene, 2010
Homeobox genes encode transcription factors that are essential for normal development and are often dysregulated in cancers. The molecular mechanisms that cause their misregulation in cancers are largely unknown. In this study, we investigate the mechanism by which the Six1 homeobox protein, which has a crucial role during development, is frequently deregulated in several poor outcome, aggressive, metastatic adult human cancers, including breast cancer, ovarian cancer, hepatocellular carcinoma and pediatric malignancies such as rhabdomyosarcoma and Wilms' tumor. Our results reveal that miRNA-185 translationally represses Six1 by binding to its 3'-untranslated region. Analyses of ovarian cancers, pediatric renal tumors and multiple breast cancer cell lines showed decreased miR-185 expression, paralleling an increase in Six1 levels. Further investigation revealed that miR-185 impedes anchorage-independent growth and cell migration, in addition to suppressing tumor growth in vivo, implicating it to be a potent tumor suppressor. Our results indicate that miR-185 mediates its tumor suppressor function by regulating cell-cycle proteins and Six1 transcriptional targets c-myc and cyclin A1. Furthermore, we show that miR-185 sensitizes Six1-overexpressing resistant cancer cells to apoptosis in general and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated apoptosis in particular. Together, our findings suggest that the altered expression of the novel tumor suppressor miR-185 may be one of the central events that leads to dysregulation of oncogenic protein Six1 in human cancers.Oncogene advance online publication, 5 July 2010; doi:10.1038/onc.2010.233.
LinkOut: [PMID: 20603620]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
290 hsa-miR-185-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004036 RHOA ras homolog family member A 4 1
MIRT004037 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 1
MIRT004698 CCNE1 cyclin E1 3 1
MIRT004700 CDK6 cyclin-dependent kinase 6 4 2
MIRT004701 AKT1 v-akt murine thymoma viral oncogene homolog 1 3 1
MIRT004702 HMGA2 high mobility group AT-hook 2 3 1
MIRT004703 CORO2B coronin, actin binding protein, 2B 3 1
MIRT005550 SIX1 SIX homeobox 1 4 1
MIRT005963 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 1 1
MIRT006696 DNMT1 DNA (cytosine-5-)-methyltransferase 1 5 3
MIRT006962 EPAS1 endothelial PAS domain protein 1 2 1
MIRT035517 AR androgen receptor 1 1
MIRT035549 SCARB1 scavenger receptor class B, member 1 1 1
MIRT045312 MATR3 matrin 3 1 1
MIRT045313 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 1
MIRT045314 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT045315 SREBF1 sterol regulatory element binding transcription factor 1 4 2
MIRT045316 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT045317 MSANTD1 Myb/SANT-like DNA-binding domain containing 1 1 1
MIRT045318 WDR77 WD repeat domain 77 1 1
MIRT045319 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT045320 ARL9 ADP-ribosylation factor-like 9 1 1
MIRT045321 AADACL3 arylacetamide deacetylase-like 3 1 1
MIRT045322 FASTK Fas-activated serine/threonine kinase 1 1
MIRT045323 COPB1 coatomer protein complex, subunit beta 1 1 1
MIRT045324 STK35 serine/threonine kinase 35 1 1
MIRT045325 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT045326 CAMKK2 calcium/calmodulin-dependent protein kinase kinase 2, beta 1 1
MIRT045327 FRMPD4 FERM and PDZ domain containing 4 1 1
MIRT045328 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT045329 CYFIP1 cytoplasmic FMR1 interacting protein 1 1 1
MIRT045330 GLUL glutamate-ammonia ligase 1 1
MIRT045331 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT045332 DENND2A DENN/MADD domain containing 2A 1 1
MIRT045333 GLB1L3 galactosidase, beta 1-like 3 1 1
MIRT045334 CANX calnexin 1 1
MIRT045335 GSTA4 glutathione S-transferase alpha 4 1 1
MIRT045336 ANKHD1 ankyrin repeat and KH domain containing 1 1 1
MIRT045337 MPV17 MpV17 mitochondrial inner membrane protein 1 1
MIRT045338 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT045339 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT045340 TUBB tubulin, beta class I 1 1
MIRT045341 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT045342 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT045343 KIAA0368 KIAA0368 1 1
MIRT045344 SMG7 smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT045345 UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 1 1
MIRT045346 AHCYL2 adenosylhomocysteinase-like 2 1 2
MIRT045347 TMEM160 transmembrane protein 160 1 1
MIRT045348 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT045349 ATP5G2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) 1 1
MIRT045350 LDHB lactate dehydrogenase B 1 1
MIRT045351 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT045352 KITLG KIT ligand 1 1
MIRT045353 MED17 mediator complex subunit 17 1 1
MIRT045354 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT045355 LENG8 leukocyte receptor cluster (LRC) member 8 1 1
MIRT045356 CACHD1 cache domain containing 1 1 1
MIRT045357 DAZAP1 DAZ associated protein 1 1 1
MIRT045358 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT045359 GLUD1 glutamate dehydrogenase 1 1 1
MIRT045360 LUZP1 leucine zipper protein 1 1 1
MIRT045361 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT045362 RAE1 RAE1 RNA export 1 homolog (S. pombe) 1 1
MIRT045363 SMG6 smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT045364 ACTN4 actinin, alpha 4 1 1
MIRT045365 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT045366 UHMK1 U2AF homology motif (UHM) kinase 1 1 1
MIRT045367 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 2
MIRT045368 GOLGA2P5 golgin A2 pseudogene 5 1 1
MIRT045369 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 1 1
MIRT045370 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT045371 WNT5B wingless-type MMTV integration site family, member 5B 1 1
MIRT045372 MARS methionyl-tRNA synthetase 1 1
MIRT045373 AKT1S1 AKT1 substrate 1 (proline-rich) 1 1
MIRT045374 MLF1IP MLF1 interacting protein 1 1
MIRT045375 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT045376 CTTN cortactin 1 1
MIRT045377 SET SET nuclear oncogene 1 1
MIRT045378 IBTK inhibitor of Bruton agammaglobulinemia tyrosine kinase 1 1
MIRT045379 XPO6 exportin 6 1 1
MIRT045380 GPR108 G protein-coupled receptor 108 1 1
MIRT045381 TRRAP transformation/transcription domain-associated protein 1 1
MIRT045382 ARL16 ADP-ribosylation factor-like 16 1 1
MIRT045383 C16orf70 chromosome 16 open reading frame 70 1 1
MIRT045384 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT045385 EMC10 ER membrane protein complex subunit 10 1 1
MIRT045386 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 1 1
MIRT053599 ATR ataxia telangiectasia and Rad3 related 3 1
MIRT053767 ARC activity-regulated cytoskeleton-associated protein 3 1
MIRT053781 EZH2 enhancer of zeste homolog 2 (Drosophila) 2 1
MIRT059811 EFNA1 ephrin-A1 1 1
MIRT061632 BTG2 BTG family, member 2 1 1
MIRT066794 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT084941 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 3
MIRT109289 TXLNG taxilin gamma 1 1
MIRT142400 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT174676 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT194240 FAM103A1 family with sequence similarity 103, member A1 1 3
MIRT199776 MRPL34 mitochondrial ribosomal protein L34 1 1
MIRT245466 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT246628 TMEM109 transmembrane protein 109 1 1
MIRT253002 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT275736 TFDP1 transcription factor Dp-1 1 1
MIRT284753 NFATC3 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 3 1
MIRT295292 BTBD3 BTB (POZ) domain containing 3 1 3
MIRT331063 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 1 2
MIRT337451 CCND2 cyclin D2 1 2
MIRT360955 VEGFA vascular endothelial growth factor A 2 1
MIRT373663 POU2F1 POU class 2 homeobox 1 1 1
MIRT383932 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT396643 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT437479 MZB1 marginal zone B and B1 cell-specific protein 3 1
MIRT437480 MCM10 minichromosome maintenance complex component 10 3 1
MIRT437481 CAMK4 calcium/calmodulin-dependent protein kinase IV 3 1
MIRT437482 HMGA1 high mobility group AT-hook 1 3 1
MIRT437483 IGF1R insulin-like growth factor 1 receptor 3 1
MIRT437484 DUSP4 dual specificity phosphatase 4 3 1
MIRT438068 SREBF2 sterol regulatory element binding transcription factor 2 4 2
MIRT438332 ALOX12 arachidonate 12-lipoxygenase 2 1
MIRT438335 CASP14 caspase 14, apoptosis-related cysteine peptidase 2 1
MIRT438336 AQP3 aquaporin 3 (Gill blood group) 2 1
MIRT438732 EPHB2 EPH receptor B2 3 1
MIRT446131 ST6GAL2 ST6 beta-galactosamide alpha-2,6-sialyltranferase 2 1 1
MIRT446526 OAS2 2'-5'-oligoadenylate synthetase 2, 69/71kDa 1 1
MIRT448759 HDX highly divergent homeobox 1 1
MIRT451000 EPS15L1 epidermal growth factor receptor pathway substrate 15-like 1 1 1
MIRT451018 MYH14 myosin, heavy chain 14, non-muscle 1 4
MIRT451249 ZNF444 zinc finger protein 444 1 1
MIRT451454 HSD11B1L hydroxysteroid (11-beta) dehydrogenase 1-like 1 1
MIRT451869 SOD2 superoxide dismutase 2, mitochondrial 1 4
MIRT451925 TMPRSS5 transmembrane protease, serine 5 1 1
MIRT452147 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT452355 DLX6 distal-less homeobox 6 1 4
MIRT453743 CSNK1E casein kinase 1, epsilon 1 1
MIRT454387 NRG4 neuregulin 4 1 1
MIRT454508 ZFYVE27 zinc finger, FYVE domain containing 27 1 1
MIRT455075 ARHGAP39 Rho GTPase activating protein 39 1 1
MIRT455507 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT455625 PABPC1L2B poly(A) binding protein, cytoplasmic 1-like 2B 1 5
MIRT455636 PABPC1L2A poly(A) binding protein, cytoplasmic 1-like 2A 1 5
MIRT456056 SLC25A28 solute carrier family 25 (mitochondrial iron transporter), member 28 1 1
MIRT456079 AFF2 AF4/FMR2 family, member 2 1 3
MIRT457274 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT457770 ZC3H12B zinc finger CCCH-type containing 12B 1 2
MIRT457954 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 2
MIRT458715 VPS39 vacuolar protein sorting 39 homolog (S. cerevisiae) 1 1
MIRT458951 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT459792 POTED POTE ankyrin domain family, member D 1 5
MIRT459925 HHIP hedgehog interacting protein 1 5
MIRT460077 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 1 1
MIRT460997 SYT7 synaptotagmin VII 1 1
MIRT461231 TM9SF1 transmembrane 9 superfamily member 1 1 1
MIRT462094 TMEM214 transmembrane protein 214 1 1
MIRT463998 WDTC1 WD and tetratricopeptide repeats 1 1 1
MIRT465420 TP53 tumor protein p53 1 1
MIRT465768 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT466601 TBC1D13 TBC1 domain family, member 13 1 1
MIRT466817 STX6 syntaxin 6 1 3
MIRT467327 SPATA2 spermatogenesis associated 2 1 1
MIRT467818 SLC29A2 solute carrier family 29 (nucleoside transporters), member 2 1 1
MIRT468791 SBK1 SH3-binding domain kinase 1 1 5
MIRT470148 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT470709 POGK pogo transposable element with KRAB domain 1 2
MIRT472711 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT473043 MRAS muscle RAS oncogene homolog 1 1
MIRT473232 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT474640 KLF16 Kruppel-like factor 16 1 1
MIRT475162 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT475264 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 1
MIRT476137 GPR137C G protein-coupled receptor 137C 1 4
MIRT476575 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 2
MIRT476953 FAM83G family with sequence similarity 83, member G 1 1
MIRT477044 FAM210A family with sequence similarity 210, member A 1 1
MIRT477385 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT477451 ELOVL1 ELOVL fatty acid elongase 1 1 1
MIRT478047 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 5
MIRT478087 DLGAP4 discs, large (Drosophila) homolog-associated protein 4 1 1
MIRT478889 CREB3L2 cAMP responsive element binding protein 3-like 2 1 2
MIRT479835 CCDC86 coiled-coil domain containing 86 1 1
MIRT480746 BNC2 basonuclin 2 1 4
MIRT481059 BASP1 brain abundant, membrane attached signal protein 1 1 1
MIRT481994 AMOTL2 angiomotin like 2 1 1
MIRT482307 AGO2 eukaryotic translation initiation factor 2C, 2 1 7
MIRT482655 FAM195B family with sequence similarity 195, member B 1 2
MIRT482833 GLI4 GLI family zinc finger 4 1 1
MIRT482950 ZNF561 zinc finger protein 561 1 3
MIRT483339 CHRDL1 chordin-like 1 1 4
MIRT483443 ARHGEF6 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 1 3
MIRT483537 TAGLN2 transgelin 2 1 1
MIRT483570 SYT2 synaptotagmin II 1 1
MIRT483588 SLC26A9 solute carrier family 26, member 9 1 1
MIRT483778 CASKIN1 CASK interacting protein 1 1 2
MIRT483815 CYP2W1 cytochrome P450, family 2, subfamily W, polypeptide 1 1 3
MIRT483967 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT484022 KIAA2018 KIAA2018 1 2
MIRT484071 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 2
MIRT484364 GATA6 GATA binding protein 6 1 6
MIRT484582 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 1 1
MIRT485769 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 1
MIRT486159 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT486294 KBTBD3 kelch repeat and BTB (POZ) domain containing 3 1 1
MIRT486382 TIGD5 tigger transposable element derived 5 1 1
MIRT486865 DPF1 D4, zinc and double PHD fingers family 1 1 1
MIRT486900 TSPYL4 TSPY-like 4 1 1
MIRT487243 KHSRP KH-type splicing regulatory protein 1 1
MIRT487515 GXYLT2 glucoside xylosyltransferase 2 1 1
MIRT487650 METTL22 methyltransferase like 22 1 1
MIRT487700 CDK14 cyclin-dependent kinase 14 1 1
MIRT487725 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT487960 IQSEC2 IQ motif and Sec7 domain 2 1 1
MIRT488015 GDF5OS growth differentiation factor 5 opposite strand 1 1
MIRT488658 ELAVL3 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) 1 1
MIRT488923 GFRAL GDNF family receptor alpha like 1 1
MIRT489479 SLITRK5 SLIT and NTRK-like family, member 5 1 1
MIRT489535 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 7
MIRT490078 PRRT2 proline-rich transmembrane protein 2 1 1
MIRT490561 TEX261 testis expressed 261 1 2
MIRT490834 ADD2 adducin 2 (beta) 1 1
MIRT491146 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT491169 LRP3 low density lipoprotein receptor-related protein 3 1 1
MIRT491582 USB1 U6 snRNA biogenesis 1 1 1
MIRT491774 ZNF385A zinc finger protein 385A 1 1
MIRT492488 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT492504 RANBP10 RAN binding protein 10 1 2
MIRT492796 PDE4A phosphodiesterase 4A, cAMP-specific 1 2
MIRT493241 MEX3A mex-3 homolog A (C. elegans) 1 1
MIRT494038 DUSP7 dual specificity phosphatase 7 1 4
MIRT494179 CNOT6L CCR4-NOT transcription complex, subunit 6-like 1 1
MIRT494222 CHST11 carbohydrate (chondroitin 4) sulfotransferase 11 1 1
MIRT494393 CADM1 cell adhesion molecule 1 1 1
MIRT498247 EDAR ectodysplasin A receptor 1 1
MIRT498918 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT498941 IKBKG inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma 1 1
MIRT499181 RBPJL recombination signal binding protein for immunoglobulin kappa J region-like 1 1
MIRT499534 ZNF606 zinc finger protein 606 1 1
MIRT499548 C15orf43 chromosome 15 open reading frame 43 1 1
MIRT499564 CCDC88A coiled-coil domain containing 88A 1 1
MIRT499603 ANKRD45 ankyrin repeat domain 45 1 1
MIRT502238 HOXC6 homeobox C6 1 1
MIRT503550 TIGIT T cell immunoreceptor with Ig and ITIM domains 1 1
MIRT510889 RAB5B RAB5B, member RAS oncogene family 1 3
MIRT513277 KIF6 kinesin family member 6 1 1
MIRT514503 SHISA9 shisa homolog 9 (Xenopus laevis) 1 2
MIRT516475 RAB32 RAB32, member RAS oncogene family 1 3
MIRT524643 C4orf32 chromosome 4 open reading frame 32 1 1
MIRT526543 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 1
MIRT533675 TMEM86A transmembrane protein 86A 1 1
MIRT542779 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT543805 COCH coagulation factor C homolog, cochlin (Limulus polyphemus) 1 1
MIRT548378 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 2
MIRT550354 INCENP inner centromere protein antigens 135/155kDa 1 2
MIRT550998 SUOX sulfite oxidase 1 1
MIRT561735 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT565611 SLC31A1 solute carrier family 31 (copper transporters), member 1 1 1
MIRT567093 KAT7 K(lysine) acetyltransferase 7 1 1
MIRT567163 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT567823 DCUN1D3 DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) 1 1
MIRT568868 LY6H lymphocyte antigen 6 complex, locus H 1 1
MIRT569587 PRELP proline/arginine-rich end leucine-rich repeat protein 1 1
MIRT569793 CSF1 colony stimulating factor 1 (macrophage) 1 1
MIRT569983 TMEM184A transmembrane protein 184A 1 1
MIRT570031 FAM228A family with sequence similarity 228, member A 1 1
MIRT570361 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 1
MIRT570404 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 1
MIRT570437 TMEM189 transmembrane protein 189 1 1
MIRT570675 GFPT1 glutamine--fructose-6-phosphate transaminase 1 1 1
MIRT571419 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT573011 RPP25 ribonuclease P/MRP 25kDa subunit 1 1
MIRT573930 CNTNAP2 contactin associated protein-like 2 1 1
MIRT574645 LPCAT3 lysophosphatidylcholine acyltransferase 3 1 1
MIRT575736 Hhip Hedgehog-interacting protein 1 1
MIRT575842 Ago2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT608002 BTBD9 BTB (POZ) domain containing 9 1 1
MIRT612097 CD180 CD180 molecule 1 1
MIRT650620 UMPS uridine monophosphate synthetase 1 1
MIRT655033 PKNOX2 PBX/knotted 1 homeobox 2 1 1
MIRT658375 FAM53C family with sequence similarity 53, member C 1 2
MIRT688816 CAPZB capping protein (actin filament) muscle Z-line, beta 1 1
MIRT689000 ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 1 1
MIRT697541 ZBTB44 zinc finger and BTB domain containing 44 1 1
MIRT698814 STK38 serine/threonine kinase 38 1 1
MIRT700808 PHLDA2 pleckstrin homology-like domain, family A, member 2 1 1
MIRT706056 PKD1 polycystic kidney disease 1 (autosomal dominant) 1 1
MIRT709313 SLC38A1 solute carrier family 38, member 1 1 1
MIRT712152 TAOK1 TAO kinase 1 1 1
MIRT712605 BHLHA15 basic helix-loop-helix family, member a15 1 1
MIRT713707 HIST3H2BB histone cluster 3, H2bb 1 1
MIRT716026 C11orf74 chromosome 11 open reading frame 74 1 1
MIRT716349 C10orf105 chromosome 10 open reading frame 105 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*