Accession ID: MIRT005551 [miRNA, hsa-miR-214-3p :: POU4F2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-214LinkOut: [miRBase ]
Synonyms MIRN214, miRNA214, mir-214, MIR214
Description Homo sapiens miR-214 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-214-3p
Mature Sequence 71| ACAGCAGGCACAGACAGGCAGU |92
Evidence Experimental
Experiments Cloned
Putative hsa-miR-214-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol POU4F2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BRN3.2, BRN3B, Brn-3b
Description POU class 4 homeobox 2
Transcript NM_0045    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on POU4F2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of POU4F2
(miRNA target sites are highlighted)
>POU4F2|NM_0045|3'UTR
   1 TAGAAGACTCTTGGCCTCTCCAGAGACGCCCCTTTCCTCGTCCGCTCTTTTCTCTCCTCTCTTCTGCCTCTTTTCACTTT
  81 TGGCGACTAGAAACAATTCCAGTAAATGTGAATCTCGACAAATCGAGGACTGAAGAGGGAGCGAACGAGCGAACAACTGA
 161 GCCCAAGCCGGTGAGAATGTGAAACAGTTTCTCAAAGGAAAGAATAACAAAAGATGGTATTTGTCTGTTGTAGCAAAGTT
 241 GTCCCTTTGAACCCCACCTCGGCTTCTTCAGAGGAAGTGTGGAGATGGCTGTTTGCAGGAAGGCAGACGAGACAGTGTTT
 321 AAAAAGTCCACAAGAATGATCAAGTAAGATTTGTTTTTATTCTTACAGACATCACCCGTGTTCAAGTTTAAAAGTACACT
 401 TTGCAACTATTTTTCAGAAATAGAAATTGATTCAGGACTAAAACTTTAAACTAGAGTTGATGCTTAATGTGATAGAGACA
 481 TCTCTAAAGTATTTTGAATTTTAAAAAAAGATGGCAGATTTTCTGCATTTACACTGTATATTATATATATATTTTTATTG
 561 TGGTTCTTACCCCCTTTTCCTTCTCTGAAGTGTTAATGCTTAAGAAAAGAGTTGCGCCTGCTGTGTTCACTGATCTTGAA
 641 AGCTATTATTAGATTATTGCAGAACAACCCTCTGTAAATTATTAATTTATCTCTCTAGCAACTTAATTTTGTGCACATTC
 721 TAATTAATTAAACTTCTTCCGTCTAAAAAAAGTGGGGGAAATGTATAGCTAGTAACGTTCAAAAAATTTTGTTTGATGAG
 801 TTTACCGAATTTTTACAGCTTTCCTCCTATACTGTGTTCCTTTTGACCCATTTGTATATTCTCACTTGAATGAAGATTGT
 881 TTTTTTCTTTGTTTTTACTGGTAGTGTTCTGATTTGTGAGTCGACACTCAGTAATGGATGTCTTAATCGTGTAGACCTGA
 961 TTCACTGTCTGAAGTATTGTTTACTTCGTTACATATTTAATGGGGATTCCCACATTGTCCCCATGACACATGAGCGCTCT
1041 CACTTACCCTTACACACACACACACACACACACACACCTCTAACAGAAGGGAAGAAGCAGTTGGAAGCATGACCGATGCA
1121 CCATTTTCTAGTTTTAGGTGCATTTGCCACTTGGTGTTTGCCCTTCAGATTTTAGATTTCACCAAGGTATTTCAGTCTTC
1201 CAGTTTTCAATTGCTTTGTTGGCTACATGTTAATATTTATAGGAATACTTCAGTTTTTCCTTTTGGAGGTTTGTTTGTAG
1281 AAAAACTAATTTGAACTATAAGAAAGACAGTGCACTGCTTGTAAATTCACATTGTTTGGAAAAATTCTTTTGGAACAAAA
1361 AATTAGGTACATGATAACTGGTACCTTATCTACTGTAAATATTTCATTAAAAATGATGCACACATAGATATATTCTTACA
1441 AATTTTGCTGTATTGCTGTTCTCTTTGAGGCTCTCCAAAGTCTTGAGTTCTGTATATGGCCTGGTTTCTTGTTTTTATTA
1521 ATAGATGGTTTATTTACTATGGTAATGTATTAATTTATTTTTGGTGTTGTTCGATTGTCTTTCATTGAAGAGATAATTTT
1601 AATGTTTTATTGGCAACGTATGCTGCTTTTTCATTAAAATATGCTATTAAAATTAAATGGCTTTTA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-214-3p :: POU4F2    [ Functional MTI ]
Validation Method Flow , GFP reporter assay , Northern blot , qRT-PCR , Western blot , Other
Conditions RGC-5 , MCF-7 , ND-7
Location of target site 3'UTR
Original Description (Extracted from the article) ... As shown in Fig. 3A, GFP levels are reduced in RGC-5 cells only upon the co-transfection of mir-23 and mir-214. In contrast, the GFP::3b-3'UTR construct is down-regulated by mir-23, mir-214 or a combination of both in the ND7 neuroblastoma cell line.// ...

- Calissano, M. Latchman, D. S., 2010, Mol Cell Neurosci.

Article - Calissano, M. Latchman, D. S.
- Mol Cell Neurosci, 2010
We have previously shown that the Brn-3b transcription factor is subjected to post-transcriptional gene regulation by specific microRNAs (mir-23 and mir-214) in the ND7 and SHSY-5Y neuronal cell lines (Calissano et al., 2007). As Brn-3b plays an essential role in the survival of retinal ganglion cells in the rat (Erkman et al., 1996; Gan et al., 1996; Gan et al., 1999; Erkman et al., 2000), we wanted to investigate whether mir-23 and mir-214 are expressed and target Brn-3b mRNA in a retinal ganglion cell line (RGC-5) thus potentially killing the cells expressing it. Here we show that, possibly due to its pro-survival role, Brn-3b is protected from degradation by microRNAs in RGC-5 cells in contrast to its fate in other cell types. This seems to be accomplished by i) the lack of expression of one of the two microRNAs targeting its 3'UTR and by ii) the requirement of at least two distinct microRNAs to mediate its down-regulation in retinal ganglion cells. We speculate that this mechanism could have a widespread role in the regulation of mRNAs encoding for essential proteins.
LinkOut: [PMID: 20609388]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
29 hsa-miR-214-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000148 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 2
MIRT000799 PTEN phosphatase and tensin homolog 5 5
MIRT004738 DAPK1 death-associated protein kinase 1 3 1
MIRT005426 MAP2K3 mitogen-activated protein kinase kinase 3 5 1
MIRT005427 MAPK8 mitogen-activated protein kinase 8 5 1
MIRT005551 POU4F2 POU class 4 homeobox 2 4 1
MIRT005765 PLXNB1 plexin B1 5 2
MIRT005811 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 3 1
MIRT006028 ING4 inhibitor of growth family, member 4 2 1
MIRT006375 XBP1 X-box binding protein 1 3 1
MIRT006644 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT006731 TWIST1 twist homolog 1 (Drosophila) 3 1
MIRT006816 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 4 2
MIRT006881 TP53 tumor protein p53 1 2
MIRT007031 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT007201 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) 1 1
MIRT007294 BCL2L2 BCL2-like 2 3 1
MIRT024958 FLOT1 flotillin 1 2 1
MIRT024959 MAP2K5 mitogen-activated protein kinase kinase 5 2 1
MIRT024960 HSPD1 heat shock 60kDa protein 1 (chaperonin) 2 1
MIRT024961 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 2 1
MIRT024962 CPNE7 copine VII 2 1
MIRT024963 RASA1 RAS p21 protein activator (GTPase activating protein) 1 2 1
MIRT024964 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 2 1
MIRT024965 ARL2 ADP-ribosylation factor-like 2 2 1
MIRT024966 AP3B1 adaptor-related protein complex 3, beta 1 subunit 2 1
MIRT024967 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT035545 PSMD10 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 1 1
MIRT035546 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1