Accession ID: MIRT005553 [miRNA, hsa-miR-96-5p :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-96LinkOut: [miRBase ]
Synonyms DFNA50, MIRN96, hsa-mir-96, miR-96, miRNA96, MIR96
Description Homo sapiens miR-96 stem-loop
Comment This sequence is localised to chromosome 7 and was named mir-96-7 in reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-96-5p
Mature Sequence 9| UUUGGCACUAGCACAUUUUUGCU |31
Evidence Experimental
Experiments Cloned
Putative hsa-miR-96-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RASK2
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_0333    LinkOut: [ RefSeq ]
Other Transcripts NM_0049   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRAS
(miRNA target sites are highlighted)
>KRAS|NM_0333|3'UTR
   1 TAATCTGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTA
  81 AAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAAATACAATTTGTACTTTTTTCTTAAGGCATACTAGTA
 161 CAAGTGGTAATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAGCATTACCTAATTTTTTTCCTGCTCCATGCAG
 241 ACTGTTAGCTTTTACCTTAAATGCTTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCCCAGA
 321 GTTTTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATACCTAAGATTTCTGTCTTGGGGTTTTTGGTGCATG
 401 CAGTTGATTACTTCTTATTTTTCTTACCAATTGTGAATGTTGGTGTGAAACAAATTAATGAAGCTTTTGAATCATCCCTA
 481 TTCTGTGTTTTATCTAGTCACATAAATGGATTAATTACTAATTTCAGTTGAGACCTTCTAATTGGTTTTTACTGAAACAT
 561 TGAGGGAACACAAATTTATGGGCTTCCTGATGATGATTCTTCTAGGCATCATGTCCTATAGTTTGTCATCCCTGATGAAT
 641 GTAAAGTTACACTGTTCACAAAGGTTTTGTCTCCTTTCCACTGCTATTAGTCATGGTCACTCTCCCCAAAATATTATATT
 721 TTTTCTATAAAAAGAAAAAAATGGAAAAAAATTACAAGGCAATGGAAACTATTATAAGGCCATTTCCTTTTCACATTAGA
 801 TAAATTACTATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTATTATAGCAACCATT
 881 TTGGGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGATTTTAACAAGTATAAAAAATTCTCATAGGAAT
 961 TAAATGTAGTCTCCCTGTGTCAGACTGCTCTTTCATAGTATAACTTTAAATCTTTTCTTCAACTTGAGTCTTTGAAGATA
1041 GTTTTAATTCTGCTTGTGACATTAAAAGATTATTTGGGCCAGTTATAGCTTATTAGGTGTTGAAGAGACCAAGGTTGCAA
1121 GGCCAGGCCCTGTGTGAACCTTTGAGCTTTCATAGAGAGTTTCACAGCATGGACTGTGTCCCCACGGTCATCCAGTGTTG
1201 TCATGCATTGGTTAGTCAAAATGGGGAGGGACTAGGGCAGTTTGGATAGCTCAACAAGATACAATCTCACTCTGTGGTGG
1281 TCCTGCTGACAAATCAAGAGCATTGCTTTTGTTTCTTAAGAAAACAAACTCTTTTTTAAAAATTACTTTTAAATATTAAC
1361 TCAAAAGTTGAGATTTTGGGGTGGTGGTGTGCCAAGACATTAATTTTTTTTTTAAACAATGAAGTGAAAAAGTTTTACAA
1441 TCTCTAGGTTTGGCTAGTTCTCTTAACACTGGTTAAATTAACATTGCATAAACACTTTTCAAGTCTGATCCATATTTAAT
1521 AATGCTTTAAAATAAAAATAAAAACAATCCTTTTGATAAATTTAAAATGTTACTTATTTTAAAATAAATGAAGTGAGATG
1601 GCATGGTGAGGTGAAAGTATCACTGGACTAGGAAGAAGGTGACTTAGGTTCTAGATAGGTGTCTTTTAGGACTCTGATTT
1681 TGAGGACATCACTTACTATCCATTTCTTCATGTTAAAAGAAGTCATCTCAAACTCTTAGTTTTTTTTTTTTACAACTATG
1761 TAATTTATATTCCATTTACATAAGGATACACTTATTTGTCAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACAC
1841 CATCTTCAGTGCCAGTCTTGGGCAAAATTGTGCAAGAGGTGAAGTTTATATTTGAATATCCATTCTCGTTTTAGGACTCT
1921 TCTTCCATATTAGTGTCATCTTGCCTCCCTACCTTCCACATGCCCCATGACTTGATGCAGTTTTAATACTTGTAATTCCC
2001 CTAACCATAAGATTTACTGCTGCTGTGGATATCTCCATGAAGTTTTCCCACTGAGTCACATCAGAAATGCCCTACATCTT
2081 ATTTCCTCAGGGCTCAAGAGAATCTGACAGATACCATAAAGGGATTTGACCTAATCACTAATTTTCAGGTGGTGGCTGAT
2161 GCTTTGAACATCTCTTTGCTGCCCAATCCATTAGCGACAGTAGGATTTTTCAAACCTGGTATGAATAGACAGAACCCTAT
2241 CCAGTGGAAGGAGAATTTAATAAAGATAGTGCTGAAAGAATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACA
2321 GTAATACATTCCATTGTTTTAGTAACCAGAAATCTTCATGCAATGAAAAATACTTTAATTCATGAAGCTTACTTTTTTTT
2401 TTTGGTGTCAGAGTCTCGCTCTTGTCACCCAGGCTGGAATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCC
2481 AGGTTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTG
2561 TATTTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATTCACCCACCTTG
2641 GCCTCATAAACCTGTTTTGCAGAACTCATTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAA
2721 GGCACTGGGTATATGGTATCCCCAAACAAGAGACATAATCCCGGTCCTTAGGTAGTGCTAGTGTGGTCTGTAATATCTTA
2801 CTAAGGCCTTTGGTATACGACCCAGAGATAACACGATGCGTATTTTAGTTTTGCAAAGAAGGGGTTTGGTCTCTGTGCCA
2881 GCTCTATAATTGTTTTGCTACGATTCCACTGAAACTCTTCGATCAAGCTACTTTATGTAAATCACTTCATTGTTTTAAAG
2961 GAATAAACTTGATTATATTGTTTTTTTATTTGGCATAACTGTGATTCTTTTAGGACAATTACTGTACACATTAAGGTGTA
3041 TGTCAGATATTCATATTGACCCAAATGTGTAATATTCCAGTTTTCTCTGCATAAGTAATTAAAATATACTTAAAAATTAA
3121 TAGTTTTATCTGGGTACAAATAAACAGGTGCCTGAACTAGTTCACAGACAAGGAAACTTCTATGTAAAAATCACTATGAT
3201 TTCTGAATTGCTATGTGAAACTACAGATCTTTGGAACACTGTTTAGGTAGGGTGTTAAGACTTACACAGTACCTCGTTTC
3281 TACACAGAGAAAGAAATGGCCATACTTCAGGAACTGCAGTGCTTATGAGGGGATATTTAGGCCTCTTGAATTTTTGATGT
3361 AGATGGGCATTTTTTTAAGGTAGTGGTTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGTAG
3441 AGATTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAAGACAAAAATCCTTGTTGAAGTT
3521 TTTTTAAAAAAAGCTAAATTACATAGACTTAGGCATTAACATGTTTGTGGAAGAATATAGCAGACGTATATTGTATCATT
3601 TGAGTGAATGTTCCCAAGTAGGCATTCTAGGCTCTATTTAACTGAGTCACACTGCATAGGAATTTAGAACCTAACTTTTA
3681 TAGGTTATCAAAACTGTTGTCACCATTGCACAATTTTGTCCTAATATATACATAGAAACTTTGTGGGGCATGTTAAGTTA
3761 CAGTTTGCACAAGTTCATCTCATTTGTATTCCATTGATTTTTTTTTTCTTCTAAACATTTTTTCTTCAAACAGTATATAA
3841 CTTTTTTTAGGGGATTTTTTTTTAGACAGCAAAAACTATCTGAAGATTTCCATTTGTCAAAAAGTAATGATTTCTTGATA
3921 ATTGTGTAGTAATGTTTTTTAGAACCCAGCAGTTACCTTAAAGCTGAATTTATATTTAGTAACTTCTGTGTTAATACTGG
4001 ATAGCATGAATTCTGCATTGAGAAACTGAATAGCTGTCATAAAATGAAACTTTCTTTCTAAAGAAAGATACTCACATGAG
4081 TTCTTGAAGAATAGTCATAACTAGATTAAGATCTGTGTTTTAGTTTAATAGTTTGAAGTGCCTGTTTGGGATAATGATAG
4161 GTAATTTAGATGAATTTAGGGGAAAAAAAAGTTATCTGCAGATATGTTGAGGGCCCATCTCTCCCCCCACACCCCCACAG
4241 AGCTAACTGGGTTACAGTGTTTTATCCGAAAGTTTCCAATTCCACTGTCTTGTGTTTTCATGTTGAAAATACTTTTGCAT
4321 TTTTCCTTTGAGTGCCAATTTCTTACTAGTACTATTTCTTAATGTAACATGTTTACCTGGAATGTATTTTAACTATTTTT
4401 GTATAGTGTAAACTGAAACATGCACATTTTGTACATTGTGCTTTCTTTTGTGGGACATATGCAGTGTGATCCAGTTGTTT
4481 TCCATCATTTGGTTGCGCTGACCTAGGAATGTTGGTCATATCAAACATTAAAAATGACCACTCTTTTAATTGAAATTAAC
4561 TTTTAAATGTTTATAGGAGTATGTGCTGTGAAGTGATCTAAAATTTGTAATATTTTTGTCATGAACTGTACTACTCCTAA
4641 TTATTGTAATGTAATAAAAATAGTTACAGTGACAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucguUUUUA-CACGAUCACGGUUu 5'
              ::::| ||| | ||||||| 
Target 5' ttttGGGGTGGTGGT-GTGCCAAg 3'
1374 - 1396 150.00 -14.30
2
miRNA  3' ucguuuuuACACGA---UCACGGUUu 5'
                  | | ||   |||||||| 
Target 5' tttgcattTTTCCTTTGAGTGCCAAt 3'
4314 - 4339 147.00 -11.80
3
miRNA  3' ucGUUUUUACACGA-UCACGGUUu 5'
            |||| || | :| |||||| | 
Target 5' agCAAATATTTATTGAGTGCCTAc 3'
2676 - 2699 137.00 -12.25
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-96-5p :: KRAS    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-96-5p :: KRAS    [ Functional MTI ]
Validation Method Immunoblot , Immunohistochemistry , Northern blot , Quantitative proteomic approach , Western blot , Reporter assay;Western blot;qRT-PCR;Other
Conditions MIA PaCa-2 , PANC-1 , BxPC-3 , HeLa
Disease pancreatic cancer;
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... As a result, pre-miR-96–transfected cells showed a marked reduction (≈56%) of luciferase activity (Fig. 2B). Then, the same assay was performed for another reporter plasmid containing mutated KRAS 3'-UTR in miR-96 binding sites (Fig. 2A, KRAS_MUT). As expected, the inhibition of luciferase activity by pre-miR-96 was almost abolished in the KRAS_MUT mutant, suggesting that the conserved region was fully responsible for miR-96 function (Fig. 2B).// ...

- Yu, S. Lu, Z. Liu, C. Meng, Y. Ma, Y. Zhao, et al., 2010, Cancer Res.

Article - Yu, S. Lu, Z. Liu, C. Meng, Y. Ma, Y. Zhao, et al.
- Cancer Res, 2010
Therapeutic applications of microRNA (miRNA) in KRAS-driven pancreatic cancers might be valuable, but few studies have explored this area. Here, we report that miR-96 directly targets the KRAS oncogene and functions as a tumor-suppressing miRNA in pancreatic cancer cells. Ectopic expression of miR-96 through a synthetic miRNA precursor inhibited KRAS, dampened Akt signaling, and triggered apoptosis in cells. In human clinical specimens, miR-96 was downregulated or deleted where an association with KRAS elevations was observed. In vitro and in vivo assays established that miR-96 decreased cancer cell invasion and migration and slowed tumor growth in a manner associated with KRAS downregulation. Our findings identify miR-96 as a potent regulator of KRAS, which may provide a novel therapeutic strategy for treatment of pancreatic cancer and other KRAS-driven cancers. Cancer Res; 70(14); 6015-25. (c)2010 AACR.
LinkOut: [PMID: 20610624]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
107 hsa-miR-96-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001087 FOXO1 forkhead box O1 4 2
MIRT001989 MITF microphthalmia-associated transcription factor 2 1
MIRT001991 ADCY6 adenylate cyclase 6 3 2
MIRT002447 HTR1B 5-hydroxytryptamine (serotonin) receptor 1B 2 1
MIRT003144 Mitf microphthalmia-associated transcription factor 3 1
MIRT003414 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 5 1
MIRT004352 PRMT5 protein arginine methyltransferase 5 2 1
MIRT005450 FOXO3 forkhead box O3 4 1
MIRT005553 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 5 2
MIRT006779 REV1 REV1 homolog (S. cerevisiae) 3 1
MIRT006780 RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 3 1
MIRT027869 CELSR2 cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) 1 1
MIRT027870 ODF2 outer dense fiber of sperm tails 2 1 1
MIRT027871 IRS1 insulin receptor substrate 1 1 1
MIRT027872 MYRIP myosin VIIA and Rab interacting protein 1 1
MIRT027873 RYK RYK receptor-like tyrosine kinase 1 1
MIRT027874 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT027875 CDON Cdon homolog (mouse) 1 1
MIRT027876 MGST1 microsomal glutathione S-transferase 1 1 1
MIRT027877 SRXN1 sulfiredoxin 1 homolog (S. cerevisiae) 1 1
MIRT027878 SUPT4H1 suppressor of Ty 4 homolog 1 (S. cerevisiae) 1 1
MIRT027879 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 1
MIRT027880 ZC3H15 zinc finger CCCH-type containing 15 1 1
MIRT027881 ZYX zyxin 1 1
MIRT027882 ZMIZ1 zinc finger, MIZ-type containing 1 1 1
MIRT027883 JAZF1 JAZF zinc finger 1 1 1
MIRT027884 TRIM4 tripartite motif-containing 4 1 1
MIRT027885 B4GALT3 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 1 1
MIRT027886 POMP proteasome maturation protein 1 1
MIRT027887 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 1
MIRT027888 RELA v-rel reticuloendotheliosis viral oncogene homolog A (avian) 1 1
MIRT027889 SLAIN1 SLAIN motif family, member 1 1 1
MIRT027890 RPS29 ribosomal protein S29 1 1
MIRT027891 PON2 paraoxonase 2 1 1
MIRT027892 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT027893 SLC25A46 solute carrier family 25, member 46 1 1
MIRT027894 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT027895 BAG4 BCL2-associated athanogene 4 1 1
MIRT027896 TSPAN14 tetraspanin 14 1 1
MIRT027897 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT027898 REEP3 receptor accessory protein 3 1 1
MIRT027899 TWISTNB TWIST neighbor 1 1
MIRT027900 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT027901 XIAP X-linked inhibitor of apoptosis 1 1
MIRT027902 NKIRAS2 NFKB inhibitor interacting Ras-like 2 1 1
MIRT027903 DDIT3 DNA-damage-inducible transcript 3 1 1
MIRT027904 RLF rearranged L-myc fusion 1 1
MIRT027905 MTHFD2L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like 1 1
MIRT027906 SYNGR2 synaptogyrin 2 1 1
MIRT027907 ADSS adenylosuccinate synthase 1 1
MIRT027908 PHF19 PHD finger protein 19 1 1
MIRT027909 SGK3 serum/glucocorticoid regulated kinase family, member 3 1 1
MIRT027910 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT027911 UBE2N ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) 1 1
MIRT027912 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT027913 FBXO21 F-box protein 21 1 1
MIRT027914 ARHGEF2 Rho/Rac guanine nucleotide exchange factor (GEF) 2 1 1
MIRT027915 SPIN4 spindlin family, member 4 1 1
MIRT027916 CGGBP1 CGG triplet repeat binding protein 1 1 1
MIRT027917 PPP1R12A protein phosphatase 1, regulatory (inhibitor) subunit 12A 1 1
MIRT027918 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT027919 TAOK1 TAO kinase 1 1 1
MIRT027920 EFNB2 ephrin-B2 1 1
MIRT027921 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT027922 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 1 1
MIRT027923 NHLRC3 NHL repeat containing 3 1 1
MIRT027924 SNX16 sorting nexin 16 1 1
MIRT027925 EVI5 ecotropic viral integration site 5 1 1
MIRT027926 PRDM16 PR domain containing 16 1 1
MIRT027927 HOXA9 homeobox A9 1 1
MIRT027928 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT027929 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT027930 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT027931 FAM171A1 family with sequence similarity 171, member A1 1 1
MIRT027932 MED1 mediator complex subunit 1 1 1
MIRT027933 CNNM3 cyclin M3 1 1
MIRT027934 PROK2 prokineticin 2 1 1
MIRT027935 ATXN1 ataxin 1 1 1
MIRT027936 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT027937 PRKCE protein kinase C, epsilon 1 1
MIRT027938 SLC39A1 solute carrier family 39 (zinc transporter), member 1 1 1
MIRT035550 SCARB1 scavenger receptor class B, member 1 1 1
MIRT048714 FAM105B family with sequence similarity 105, member B 1 1
MIRT048715 SNX7 sorting nexin 7 1 1
MIRT048716 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT048717 PAPD5 PAP associated domain containing 5 1 1
MIRT048718 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT048719 THAP9 THAP domain containing 9 1 1
MIRT048720 MOXD1 monooxygenase, DBH-like 1 1 1
MIRT048721 ITPR3 inositol 1,4,5-triphosphate receptor, type 3 1 1
MIRT048722 ALKBH5 alkB, alkylation repair homolog 5 (E. coli) 1 1
MIRT048723 ADNP2 ADNP homeobox 2 1 1
MIRT048724 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT048725 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT048726 FLII flightless I homolog (Drosophila) 1 1
MIRT048727 PMS2 PMS2 postmeiotic segregation increased 2 (S. cerevisiae) 1 1
MIRT048728 TMPO thymopoietin 1 1
MIRT048729 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT048730 SMIM12 chromosome 1 open reading frame 212 1 1
MIRT048731 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 1 1
MIRT048732 DEK DEK oncogene 1 1
MIRT048733 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 1 1
MIRT048734 YTHDC2 YTH domain containing 2 1 1
MIRT048735 ACTN4 actinin, alpha 4 1 1
MIRT048736 TERF2 telomeric repeat binding factor 2 1 1
MIRT048737 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT048738 PAQR4 progestin and adipoQ receptor family member IV 1 1