Accession ID: MIRT005578 [miRNA, hsa-miR-630 :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-630LinkOut: [miRBase ]
Synonyms MIRN630, hsa-mir-630, MIR630
Description Homo sapiens miR-630 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-630
Mature Sequence 61| AGUAUUCUGUACCAGGGAAGGU |82
Evidence Experimental
Experiments RT-PCR
Putative hsa-miR-630 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-630 :: BCL2    [ Functional MTI ]
Validation Method Immunoblot , Luciferase reporter assay , qRT-PCR , Other
Conditions JHU-029
Location of target site 3'UTR
Tools used in this research microRNA.org
Original Description (Extracted from the article) ... Our study establishes a new functional link between p-DNp63a and the deregulated miRNAome during CIS-induced tumor cell death, suggesting novel mechanisms (transcriptional regulation and DICER1-dependent pri-miRNA maturation) through which p-DNp63a could potentially act as a regulator of death or survival for HNSCC cells during chemotherapy ...

- Huang, Y. Chuang, A. Hao, H. Talbot, C. et al., 2011, Cell death and differentiation.

Article - Huang, Y. Chuang, A. Hao, H. Talbot, C. et al.
- Cell death and differentiation, 2011
Head and neck squamous cell carcinoma (HNSCC) cells exposed to cisplatin (CIS) displayed a dramatic ATM-dependent phosphorylation of DeltaNp63alpha that leads to the transcriptional regulation of downstream mRNAs. Here, we report that phospho (p)-DeltaNp63alpha transcriptionally deregulates miRNA expression after CIS treatment. Several p-DeltaNp63alpha-dependent microRNA species (miRNAs) were deregulated in HNSCC cells upon CIS exposure, including miR-181a, miR-519a, and miR-374a (downregulated) and miR-630 (upregulated). Deregulation of miRNA expression led to subsequent modulation of mRNA expression of several targets (TP53-S46, HIPK2, ATM, CDKN1A and 1B, CASP3, PARP1 and 2, DDIT1 and 4, BCL2 and BCL2L2, TP73, YES1, and YAP1) that are involved in the apoptotic process. Our data support the notion that miRNAs are critical downstream targets of p-DeltaNp63alpha and mediate key pathways implicated in the response of cancer cells to chemotherapeutic drugs.Cell Death and Differentiation advance online publication, 28 January 2011; doi:10.1038/cdd.2010.188.
LinkOut: [PMID: 21274007]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
68 hsa-miR-630 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005578 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT005579 BCL2L2 BCL2-like 2 3 1
MIRT005580 YAP1 Yes-associated protein 1 3 1
MIRT007241 SNAI2 snail homolog 2 (Drosophila) 1 2
MIRT053232 IGF1R insulin-like growth factor 1 receptor 3 2
MIRT053732 TOB2 transducer of ERBB2, 2 1 1
MIRT053733 GJC1 gap junction protein, gamma 1, 45kDa 1 1
MIRT053734 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 1 1
MIRT053735 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 1
MIRT054107 BTLA B and T lymphocyte associated 1 1
MIRT055807 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT103865 FOXK1 forkhead box K1 1 1
MIRT197869 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT441978 ZNF70 zinc finger protein 70 1 1
MIRT449305 PARP3 poly (ADP-ribose) polymerase family, member 3 1 1
MIRT449346 GEMIN6 gem (nuclear organelle) associated protein 6 1 1
MIRT465731 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT472898 MTDH metadherin 1 4
MIRT477518 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT481462 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 2
MIRT485659 CTHRC1 collagen triple helix repeat containing 1 1 4
MIRT495345 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B) 1 1
MIRT496333 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT497828 GPR26 G protein-coupled receptor 26 1 1
MIRT501380 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 5
MIRT502720 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT525280 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT531037 ZNF502 zinc finger protein 502 1 1
MIRT533001 ZFHX3 zinc finger homeobox 3 1 1
MIRT538218 CYR61 cysteine-rich, angiogenic inducer, 61 1 1
MIRT542892 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT547558 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT549005 CCDC6 coiled-coil domain containing 6 1 1
MIRT549866 ZNF260 zinc finger protein 260 1 1
MIRT553111 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT555325 PPP2CA protein phosphatase 2, catalytic subunit, alpha isozyme 1 2
MIRT556785 KLF13 Kruppel-like factor 13 1 1
MIRT567340 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT569062 USP45 ubiquitin specific peptidase 45 1 1
MIRT617149 CD226 CD226 molecule 1 1
MIRT618559 VLDLR very low density lipoprotein receptor 1 1
MIRT622929 PAK7 p21 protein (Cdc42/Rac)-activated kinase 7 1 1
MIRT625213 TNFAIP8 tumor necrosis factor, alpha-induced protein 8 1 1
MIRT628032 LSAMP limbic system-associated membrane protein 1 1
MIRT638188 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT644264 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT648175 TMEM192 transmembrane protein 192 1 1
MIRT650175 LILRA2 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 1 1
MIRT650964 STARD3NL STARD3 N-terminal like 1 1
MIRT654854 PPM1F protein phosphatase, Mg2+/Mn2+ dependent, 1F 1 1
MIRT656807 KLHL28 kelch-like 28 (Drosophila) 1 1
MIRT660424 ATXN1 ataxin 1 1 1
MIRT669138 CD200 CD200 molecule 1 1
MIRT688695 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 1
MIRT699126 SMNDC1 survival motor neuron domain containing 1 1 1
MIRT701181 PACRGL PARK2 co-regulated-like 1 1
MIRT709202 APOL6 apolipoprotein L, 6 1 1
MIRT709869 A1CF APOBEC1 complementation factor 1 1
MIRT712694 CERS4 ceramide synthase 4 1 1
MIRT712812 KCNMB3 potassium large conductance calcium-activated channel, subfamily M beta member 3 1 1
MIRT712886 DCTN4 dynactin 4 (p62) 1 1
MIRT713165 LRRC2 leucine rich repeat containing 2 1 1
MIRT716464 MRO maestro 1 1
MIRT716803 TMEM196 transmembrane protein 196 1 1
MIRT718629 DIP2A DIP2 disco-interacting protein 2 homolog A (Drosophila) 1 1
MIRT719648 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 1 1
MIRT722474 SELE selectin E 1 1
MIRT722922 TLR4 toll-like receptor 4 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*