Accession ID: MIRT005595 [miRNA, hsa-miR-181b-5p :: CYLD, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181b-1LinkOut: [miRBase ]
Synonyms MIRN181B1, MIR181B1
Description Homo sapiens miR-181b-1 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181b-5p
Mature Sequence 36| AACAUUCAUUGCUGUCGGUGGGU |58
Evidence Experimental
Experiments Cloned
Putative hsa-miR-181b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CYLD LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDMT, CYLD1, CYLDI, EAC, FLJ20180, FLJ31664, FLJ78684, KIAA0849, MFT, MFT1, SBS, TEM, USPL2
Description cylindromatosis (turban tumor syndrome)
Transcript NM_0010423    LinkOut: [ RefSeq ]
Other Transcripts NM_0010424 , NM_0152   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CYLD LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CYLD
(miRNA target sites are highlighted)
>CYLD|NM_0010423|3'UTR
   1 TAACTGGGGTCATCGGGAAAGGCAAAGAAACTGAAGGCAGAGTCCTAACGTTGCATCTTATTCGAGCTGGCAGTTCTGTT
  81 CACGTCCATTGCCGGCAATGGATGTCTTTGTGGTGATGATCCTTCAGAAAAGGATGCCTCTGTTTAAAAACAAATTGCTT
 161 TTGTGTCCCTGAAGTATTTAATAAGAAGCATTTTGCACTCTAGAAAGTATGTTTGTGTTGGTTTTTTAAGAAGTCTAAAT
 241 GAAGTTATTAATACCTGAAGCTTTAAGTTAAGTGCATTGATCATATGATATTTTTGGAAGCATACAATTTTAATTGTGGA
 321 AGTTTAAAGCCTCTTTTAGTCCATTGAGAATGTAAATAAATGTGTCTTCTTTATGGACCAAGGATATGAAATCATTTTTC
 401 TTTTGTAGCTAACGGTTGCCTTGAGGAAGAAATAATTTGGTTTTATTAAGAGTCTACTCTCAATCCAGTTATTAGAGATG
 481 TACTGAGTTTGATTTGTTAATCCTTTCTATATACTGCTGATCTTGCATGTCTACAATCTGCTCAGTTTTTCTGTGTTTCT
 561 GCAATAGTGGTCAGAAAAATACTTAAATTCCCTTAATGGTGTTGTTTTCTATTTGTTCTGGTTTTGAGATAAATGAGTGA
 641 TTCTGTCCCCAAATGTCCATTTTTGAAGTGATTTTCCTGGAGGATTAGGGTATTTAGCAGTTGAAGCTCTTCATTCATAG
 721 TAGTTACTGTCAGCTAACAGGTTTTTTAAGGCTTTTAACTATTAATATTTTATGGAATGGGGCAAAGTAAATTGATGAAA
 801 GAATTGGAGTGATAATAGTCCTTTACAAACATACAGTCCATAAGAAAATGAATTTGGCATATAGAATTATTACAATTTCC
 881 TGGGAGAGATGGATATTTAAACCTCTATTATTTTAGACAAGACTGTCTAGAACTTAAGTTTGATCTGTCAGCCAGTACTC
 961 CCATTAAATTCAGTGTAGTTTCACTTGATAGAATCAGATATGTTATCGAAATGTTAGCAGCAGCTTCATCCTCCTTCTGA
1041 TTAAAGTAAGTAGAAATGGGATGTTTTGTTTAATAACAGCCATAGTGTGTGTTTAGACCACAGCGGATGTTGTAGACCAG
1121 GACCATAGATGATACATGTCAGTGCTGTGGAATGTGCATTCTCTGAGTGTTGTTTTGTGGTATCATTGTCTTTCCTGAAT
1201 GACTTTCTAACTGTGCAGAAAGGCAGAAAAGTCATCATATGTATATGTCATATGACTTTATAAAATATTTAATGTGACAA
1281 AAAGTGGAAAGAATCTTTACAAACCCTGCAATTACTTTTTTAAAGGCACTTTTACTCTTTGGTTTTATCATTCCATTTTG
1361 CTAATATTTACTAGCTTTATAAATTACAGTAAGGTACAAAAACTCATCTTGTAATATTTTCATTTTTGAAGTGAAAAAGT
1441 ACATATATTTTGCACAAGGTTTTATACTGCTAAGTGCTTGGTTGGGGTGGTGAGATGATGATTAGATCAGGGGTGAGGCT
1521 GAGAGACTCTGGGTTTAGGGCTAGCCCTGCCTCCATCTCCCTTGGGTAAAATGAAGGGTGTGGGGTAAAAGATGCATAAG
1601 GCCTTTTCTAGCTCTGACAGCCTAGAAGTCCAATCACCCTGTAATAAATATGTGTTGAATGAAGAAATGGGTGAATGAGC
1681 TTGTCAATGTGATTTTAAAAAATTGACTACCTGGAGGAATGATTAGGAATCTAAATGAAGCCAGCCCTCGGTATCTGCAG
1761 GTTTCTCATCCATGGATTCAACCAACTGCAAATGGAAAATACGATTTTTTTTAAAAAAAGGATGGTTACATCCGTATTGA
1841 ACATGTACAGACTTTTTTCTTGTCATTATTCTCTGAACAATACAAGAACTCTTTATGTAGCATTTACATTTATTAGGTAT
1921 TATAAGTAATCTAGAGATTATTTAATTAAAATATACAGGAGGATGTGTGTCAGTTATATGCAAATTCTGTACCATTTTGT
2001 ATCAGGGAATTGAGCATCTTCAGATGTTGGTATCTGCAGGGATCCTGGAACCAAACCCCTGCAGATACTAAGGGCTGACG
2081 ATCTAGGTAAGACTGGATTTAACAGTTGGAAAAAAAAAAAAAAAAGGAGAGAGAAGACAGTTCCTTTCCTGTAGAAATTA
2161 AAACAAAATACAAATTGAGGAAGCTCTGCTACCCAGGCTGTCATGGTAGAGAACTTGAAGAAGACCTGTTTGGATGGACA
2241 CCTGGTTTCAAAAGTCAGGTGTGGAGACTGTTAAATGGGAGGGCCTCATCCATAAATGATTTCTGGCAACGTCTTCTTCA
2321 GGTGGAGCTTGACGTCTTTTTAATGTTACTTGGGGAGGGAGTGCTCATTAAGGGATGCCAGGGCCAGCTCTGGTGGTTCC
2401 TGGGGAGGCTGCGTCCTTCCCTGCTTCTGCATGTCATGAGGCAGCAGGAAGGTTTCCCCTGCACCTGTCTGTCCTGGCTC
2481 CCTCTGGGTAGCCCCCTACTGTTCTGTGCTTCAGCACAGCCTGGTTTGTCAAGAGGCACATAGTTGGGGCTGGGCTGCAT
2561 GGCACAGGGGCTTATGTGCCTGCTGGTTATTTAATTTTCAGCCTTAAGTTTTCTTTAATATTTTCCTGTTGGCTATTTAA
2641 AGGTTTTGGTTATCTTTTATTCCTTATCTACAATCAAGATGACAATGTAATTGAATTATCTTATTTATAACACGGTTCGT
2721 GATTCATGATTCATGATTACAAGTAGAAAATATGTCATGTTCCTCACCTCCAAATAAATATGTGTGTGTCTGTGTGTGTG
2801 TATATATGTATGTGGCGGAGAGGGAGAGAGTGGGGAAGGAGAGCAGTGTTATCATACATAGAGAGGCTAAATGTGTCCCA
2881 TCCCTCACTGTCAGCTTTATAAAGGAGTTTGACTCCATCCACAGAAGAATGTTTTATAAGACTAGGAAAACACGTTGAAA
2961 ACTAGGATAAACAGCAACAAAAATCAACTAAATATGTTGTTACTGTTGCTAAGGATTTTCTCCTTAGAATAATTTAGGAT
3041 TTTTAAAAATTTCTGTTTGCCAAATGCTGTAGATAAATGGCCAGATTCTTCCTATCCCTAGGATTCCTTTATTATTTTTT
3121 TTCACAGATTTTGAGAACAAGGGGGAGAGATAGTATGGAAGATTAAGATTCCATTAATCTTATAGAACTGTGTTGTCACC
3201 CAAATTCCTGCTTGTTTGAACATGGCATCTTCATAGATTCAGGATTCACTACCCTCTATAGCTGGATCTTGAAAATTATC
3281 TGGCCAGATAATTTTGCATCTGCTTGGATGATTGTAGACTGAGATGTGAGTGGAGGATAAAGTATTAGACTTTTGCTGAG
3361 TAACTGCCAACCAAGAAGTATTTATCGGACACTTACTAGGTGCCTAGGATTGTATCAGAGGGAATATGAAATGTGTCCCT
3441 GCCCTACCTAGTTTTAACGACAGAATATCTATTAAAGGCTACTTAGCTGAAGGGTAAGGGTGACAGGTCTAGGGGAAGCT
3521 TTGGGAGGTGGTGTGCTGTGACAGAAAAAGTGGCAGAGTAGGGACGAGAGACCTGCATTCTAGCCCTGTTTCTGTCACTT
3601 GCTCTGTACACTTAGACAACAGCTTGACCTCTTGAGCTTTAGTTTCCTCCTCTGCATAATGAGAGGGTTAGACTACTGAA
3681 TTGTATGGGAAAAAAATACAAATTCCTGGGTCCTAGGCCATGCCTGCTGAATCCGACTGTTCAGGAAGAGGCCTAGGAAA
3761 TCTGTGAGGGAATCCCCAGGGGAATCTCGTGACCAGCCAGGTGTGAAATCTGCTAACTGGAAGATCTCAAAGCTTCCTTC
3841 ACTTTTTGTGATTTTGTGGTCATGTAACGTTACTGTATTATTCTACGTAAATGTGGGTACTTGGATGTTTATCATACTGT
3921 TTCTCTGTGTTTACATACTAATTTGTGTAAGAAATGCATTTTAGTCTGTGTACCTCAACCTGCTGTTTGTTTCCTAGAGG
4001 TGTTAGTAGTCTTTAAATACAAGTAAGACTTAAGAGGATATTTGATGTTATTTACCTGGATATTTTCTTCCCCTTTTATT
4081 TATTTAGAGGAAATTGAGATTCTAGGAGCCAAAAAAATGAAAACAAAATTCTAAGGCAAAGTTAAAGAAAAAAATTACAT
4161 TATTTCTTACCATTTGCTACTTTATAATGAAAATTTAAAAATTATATGGGAAGATTTTTCTCTGGGATAACAAATCCTTG
4241 TCATAAAGTAAGAGGTCTTTTTAAAGTAGGTAGGCTATAAGGCCTGTAATTTAAAATAATACTCCTTTCTCTAGGGTTTG
4321 GTGCAATTCTCCATTAATGAAGATAACATTTGAATTCCCCAAAGCAGGTGAGGAGTCGGGGAGGAGAAAGCGATGTTAAA
4401 ATGAAAACTCACTGCAAAAGAGGAGGCAGAGGAAGAAGGAATGTAAACCCCTTAAAGCAGATGTGTGTGGGGCCTTATGA
4481 AGACCAGGATTCTGCGGGTGTCAGGGGATTGCCCCTCTTGACAGAGACTAGGGTTTTAGACTGAGGCTTCCTGCAGGGTG
4561 TTCGCATTGCCCTTCTCCGTTCCCCTTCAGACCTTTCTGGGGAGAAGAGGTGGGAGGAGGGGAGAAAGACTGTTCATCTT
4641 ATTCTGAATCCTGGAGCAGCTGAAGGTTTTCTCTTGAGTCAGGATGCAGTGGTAATGCATTAACCAGCAAGTGTGGCCAA
4721 GGATAATGAAAAAGTGGGAAAGGAAGGTCCTCCTCCTCCCTGATTGTAGCATCCAGCAGTCTCTGTAGCCAGGTTACTCA
4801 AGAACCACATTTGATTTCCTGGCCCTTTGCCTTGGCAGTGATGGCATTTTTATTTCACTGTGTTTTAAAGTCTTCATTTA
4881 TTTTTATAACATGGGTTAGGGAGAAGGGCCACAAATGGAGGGATTGTCCTTTCAAGCACCACAGCTTCAGATAAAATTAG
4961 TACTTTCAAATATTGTCCACTTTAACTTAAAAAATTCTAGAGGGATTATATTGGAGACTCAACTGCCCTTGGTTTTAGTT
5041 TATAAAATGGCCTAGTACTGTGGAATTTTAATTTTAGAAAGTCTTAGCATCAGATCATAAACATTCATTAAAAGAACTCA
5121 CATCCCATCTGAAACTTCCCAGGGGAGTTGGGATTCTTAGTAGATTGGTAGAAAGGGGCTCATTTTCTACTGCATTTCCC
5201 ATTTTTGGTATCTTGTTCAGCATGTTTTATTTTTATTTCTTGTCTGCAGAACATCCTATATTTATGAGAACATTCTTTAA
5281 GAAGACCACCACATAGAATACCCCTTCCTATCAGCTCGCTCTGATTTAGCCTTAATTTTGTTAAATTTTTTAGAGATGAA
5361 TGAAGTGCTGCTGTGGAAAGAAATGTACATATACTATTTCTGTATCATTAAAATTACATTTTTATGGTTCAAAAAAAAAA
5441 AAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181b-5p :: CYLD    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Other
Conditions MCF10A , HCT116 , HT29 , PC3 , A549 , HeLa , Hep 3B , PANC1
Location of target site 3'UTR
Tools used in this research Unspecified
Original Description (Extracted from the article) ... miR-181b-1 regulates directly CYLD expression during transformation// miR-21 and miR-181b-1,respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain the transformed state ...

- Iliopoulos, D. Jaeger, S. A. Hirsch, H. A. et al., 2010, Mol Cell.

Article - Iliopoulos, D. Jaeger, S. A. Hirsch, H. A. et al.
- Mol Cell, 2010
A transient inflammatory signal can initiate an epigenetic switch from nontransformed to cancer cells via a positive feedback loop involving NF-kappaB, Lin28, let-7, and IL-6. We identify differentially regulated microRNAs important for this switch and putative transcription factor binding sites in their promoters. STAT3, a transcription factor activated by IL-6, directly activates miR-21 and miR-181b-1. Remarkably, transient expression of either microRNA induces the epigenetic switch. MiR-21 and miR-181b-1, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kappaB activity required to maintain the transformed state. These STAT3-mediated regulatory circuits are required for the transformed state in diverse cell lines and tumor growth in xenografts, and their transcriptional signatures are observed in colon adenocarcinomas. Thus, STAT3 is not only a downstream target of IL-6 but, with miR-21, miR-181b-1, PTEN, and CYLD, is part of the positive feedback loop that underlies the epigenetic switch that links inflammation to cancer.
LinkOut: [PMID: 20797623]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
102 hsa-miR-181b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000237 AICDA activation-induced cytidine deaminase 1 1
MIRT000238 NLK nemo-like kinase 2 1
MIRT000239 GATA6 GATA binding protein 6 2 1
MIRT000240 CDX2 caudal type homeobox 2 2 1
MIRT000637 TIMP3 TIMP metallopeptidase inhibitor 3 4 2
MIRT000697 PLAG1 pleiomorphic adenoma gene 1 4 1
MIRT003035 GRIA2 glutamate receptor, ionotropic, AMPA 2 3 1
MIRT003036 VSNL1 visinin-like 1 3 1
MIRT003500 BCL2 B-cell CLL/lymphoma 2 4 2
MIRT004328 KAT2B K(lysine) acetyltransferase 2B 3 1
MIRT005106 TCL1A T-cell leukemia/lymphoma 1A 5 2
MIRT005545 MAP3K10 mitogen-activated protein kinase kinase kinase 10 3 1
MIRT005595 CYLD cylindromatosis (turban tumor syndrome) 3 1
MIRT006167 RNF2 ring finger protein 2 4 1
MIRT006232 TMED7 transmembrane emp24 protein transport domain containing 7 3 1
MIRT006272 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 1 1
MIRT006371 CBX7 chromobox homolog 7 1 1
MIRT006951 XIAP X-linked inhibitor of apoptosis 1 1
MIRT006952 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT007239 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT025035 Aicda activation-induced cytidine deaminase 1 1
MIRT025036 ESR1 estrogen receptor 1 1 1
MIRT025037 TAF6L TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT035553 E2F1 E2F transcription factor 1 3 2
MIRT047224 NRD1 nardilysin (N-arginine dibasic convertase) 1 1
MIRT047225 C20orf173 chromosome 20 open reading frame 173 1 1
MIRT047226 FAM5B family with sequence similarity 5, member B 1 1
MIRT047227 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT047228 KRI1 KRI1 homolog (S. cerevisiae) 1 1
MIRT047229 RBMX RNA binding motif protein, X-linked 1 1
MIRT047230 DNAJB11 DnaJ (Hsp40) homolog, subfamily B, member 11 1 1
MIRT047231 PTEN phosphatase and tensin homolog 1 1
MIRT047232 EIF5A eukaryotic translation initiation factor 5A 1 1
MIRT047233 KLHL7 kelch-like 7 (Drosophila) 1 1
MIRT047234 NDC1 transmembrane protein 48 1 1
MIRT047235 TMEM189 transmembrane protein 189 1 1
MIRT047236 KPNB1 karyopherin (importin) beta 1 1 1
MIRT047237 CAT catalase 1 1
MIRT047238 DTD2 chromosome 14 open reading frame 126 1 1
MIRT047239 USP10 ubiquitin specific peptidase 10 1 1
MIRT047240 LMCD1 LIM and cysteine-rich domains 1 1 1
MIRT047241 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT047242 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047243 THOC3 THO complex 3 1 1
MIRT047244 ZFHX3 zinc finger homeobox 3 1 1
MIRT047245 MED14 mediator complex subunit 14 1 1
MIRT047246 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT047247 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT047248 RPL18A ribosomal protein L18a 1 1
MIRT047249 RPS7 ribosomal protein S7 1 1
MIRT047250 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT047251 RNF187 ring finger protein 187 1 1
MIRT047252 ZNF526 zinc finger protein 526 1 1
MIRT047253 HIST1H1E histone cluster 1, H1e 1 1
MIRT047254 EP300 E1A binding protein p300 1 1
MIRT047255 INO80B INO80 complex subunit B 1 1
MIRT047256 C5orf34 chromosome 5 open reading frame 34 1 1
MIRT047257 IFNGR1 interferon gamma receptor 1 1 1
MIRT047258 ZXDC ZXD family zinc finger C 1 1
MIRT047259 MEPCE methylphosphate capping enzyme 1 1
MIRT047260 NRBP1 nuclear receptor binding protein 1 1 1
MIRT047261 ZNF503 zinc finger protein 503 1 1
MIRT047262 UBB ubiquitin B 1 1
MIRT047263 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT047264 NR2F1 nuclear receptor subfamily 2, group F, member 1 1 1
MIRT047265 RAP1GAP2 RAP1 GTPase activating protein 2 1 1
MIRT047266 ARHGAP35 glucocorticoid receptor DNA binding factor 1 1 1
MIRT047267 XPO6 exportin 6 1 1
MIRT047268 ZNF747 zinc finger protein 747 1 1
MIRT047269 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT047270 SCAP SREBF chaperone 1 1
MIRT047271 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT047272 TRRAP transformation/transcription domain-associated protein 1 1
MIRT047273 GANAB glucosidase, alpha; neutral AB 1 1
MIRT047274 C17orf100 chromosome 17 open reading frame 100 1 1
MIRT047275 RPS12 ribosomal protein S12 1 1
MIRT047276 FBL fibrillarin 1 1
MIRT047277 FUS fused in sarcoma 1 1
MIRT047278 NEK3 NIMA (never in mitosis gene a)-related kinase 3 1 1
MIRT047279 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT047280 RTFDC1 chromosome 20 open reading frame 43 1 1
MIRT047281 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT047282 DIDO1 death inducer-obliterator 1 1 1
MIRT047283 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT047284 HIST2H4B histone cluster 2, H4b 1 1
MIRT047285 SEC24C SEC24 family, member C (S. cerevisiae) 1 1
MIRT047286 BPTF bromodomain PHD finger transcription factor 1 1
MIRT047287 DDHD1 DDHD domain containing 1 1 1
MIRT047288 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT047289 USP24 ubiquitin specific peptidase 24 1 1
MIRT047290 EIF4E2 eukaryotic translation initiation factor 4E family member 2 1 1
MIRT047291 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT047292 MYO1C myosin IC 1 1
MIRT047293 RPS8 ribosomal protein S8 1 1
MIRT047294 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT047295 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047296 PWP2 PWP2 periodic tryptophan protein homolog (yeast) 1 1
MIRT047297 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT047298 ATP6 ATP synthase F0 subunit 6 1 1
MIRT047299 ASB13 ankyrin repeat and SOCS box-containing 13 1 1
MIRT047300 KIAA1524 KIAA1524 1 1
MIRT047301 C2orf69 chromosome 2 open reading frame 69 1 1