Accession ID: MIRT005629 [miRNA, hsa-miR-17-5p :: SMAD4, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-17LinkOut: [miRBase ]
Synonyms MIR91, MIRN17, MIRN91, hsa-mir-17, miR-17, miR17-3p, miRNA17, MIR17
Description Homo sapiens miR-17 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-17-5p
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-17-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SMAD4 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DPC4, JIP, MADH4, MYHRS
Description SMAD family member 4
Transcript NM_005359    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SMAD4 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SMAD4
(miRNA target sites are highlighted)
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             ::| : || |  ||||||| 
1355 - 1376 143.00 -6.35
              :|||  ||| ||  :|||:||| 
3607 - 3633 143.00 -10.50
            :||| | || | ||||:||| 
4353 - 4373 143.00 -11.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-17-5p :: SMAD4    [ Functional MTI ]
Validation Method Other
Article - Fontana, L. Pelosi, E. Greco, P. et al.
- Nat Cell Biol, 2007
We investigated the role of microRNAs (miRNA) 17-5p, 20a and 106a in monocytic differentiation and maturation. In unilineage monocytic culture generated by haematopoietic progenitor cells these miRNAs are downregulated, whereas the transcription factor acute myeloid leukaemia-1 (AML1; also known as Runt-related transcription factor 1, Runx1) is upregulated at protein but not mRNA level. As miRNAs 17-5p, 20a and 106a bind the AML1 mRNA 3'UTR, their decline may unblock AML1 translation. Accordingly, transfection with miRNA 17-5p-20a-106a suppresses AML1 protein expression, leading to M-CSF receptor (M-CSFR) downregulation, enhanced blast proliferation and inhibition of monocytic differentiation and maturation. Treatment with anti-miRNA 17-5p, 20a and 106a causes opposite effects. Knockdown of AML1 or M-CSFR by short interfering RNA (siRNA) mimics the action of the miRNA 17-5p-20a-106a, confirming that these miRNAs target AML1, which promotes M-CSFR transcription. In addition, AML1 binds the miRNA 17-5p-92 and 106a-92 cluster promoters and transcriptionally inhibits the expression of miRNA 17-5p-20a-106a. These studies indicate that monocytopoiesis is controlled by a circuitry involving sequentially miRNA 17-5p-20a-106a, AML1 and M-CSFR, whereby miRNA 17-5p-20a-106a function as a master gene complex interlinked with AML1 in a mutual negative feedback loop.
LinkOut: [PMID: 17589498]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-17-5p :: SMAD4    [ Functional MTI ]
Validation Method
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 3 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-17-5p :: SMAD4    [ Non-Functional MTI ]
Validation Method Luciferase reporter assay , Microarray
Conditions DLD1
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Interestingly, all miR-17a~92 mimics tested decreased Smad4 mRNA levels, but this downregulation was most profound with miR-18a (Fig. 4C). In the human Smad4 3′-UTR, TargetScan predicts binding sites for miR-17 and miR-19 as well as miR-18a. To determine whether any of these were bona fide target sites, we constructed six sets of psiCHECK2-based sensor plasmids as described above. DLD1 Dicer hypo cells were transfected with these constructs and also control or cognate mimics. The results in Fig. 4D show that of the three sequences tested, only the miR-18a homology region is a bona fide binding site. ...

- Dews, M. Fox, J. L. Hultine, S. Sundaram, et al., 2010, Cancer Res.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             ::| : || |  ||||||| 
2 - 23
Article - Dews, M. Fox, J. L. Hultine, S. Sundaram, et al.
- Cancer Res, 2010
c-Myc stimulates angiogenesis in tumors through mechanisms that remain incompletely understood. Recent work indicates that c-Myc upregulates the miR-17 approximately 92 microRNA cluster and downregulates the angiogenesis inhibitor thrombospondin-1, along with other members of the thrombospondin type 1 repeat superfamily. Here, we show that downregulation of the thrombospondin type 1 repeat protein clusterin in cells overexpressing c-Myc and miR-17 approximately 92 promotes angiogenesis and tumor growth. However, clusterin downregulation by miR-17 approximately 92 is indirect. It occurs as a result of reduced transforming growth factor-beta (TGFbeta) signaling caused by targeting of several regulatory components in this signaling pathway. Specifically, miR-17-5p and miR-20 reduce the expression of the type II TGFbeta receptor and miR-18 limits the expression of Smad4. Supporting these results, in human cancer cell lines, levels of the miR-17 approximately 92 primary transcript MIR17HG negatively correlate with those of many TGFbeta-induced genes that are not direct targets of miR-17 approximately 92 (e.g., clusterin and angiopoietin-like 4). Furthermore, enforced expression of miR-17 approximately 92 in MIR17HG(low) cell lines (e.g., glioblastoma) results in impaired gene activation by TGFbeta. Together, our results define a pathway in which c-Myc activation of miR-17 approximately 92 attenuates the TGFbeta signaling pathway to shut down clusterin expression, thereby stimulating angiogenesis and tumor cell growth.
LinkOut: [PMID: 20940405]
Experimental Support 4 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-17-5p :: SMAD4    [ Non-Functional MTI ]
Validation Method
miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             ::| : || |  ||||||| 
2 - 23
Article - Memczak, S. Jens, M. Elefsinioti, A. Torti, et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000398417.2 | 3UTR | AUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000398417.2 | 3UTR | AUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000398417.2 | 3UTR | AUUUUUAAGAUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000398417.2 | 3UTR | AUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000398417.2 | 3UTR | AUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000398417.2 | 3UTR | AUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

MiRNA-Target Expression Profile(TCGA):

MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1153 hsa-miR-17-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000256 ZNFX1 zinc finger, NFX1-type containing 1 3 5
MIRT000257 CCL1 chemokine (C-C motif) ligand 1 3 2
MIRT000258 GPR137B G protein-coupled receptor 137B 3 3
MIRT000259 NABP1 nucleic acid binding protein 1 3 5
MIRT000261 NPAT nuclear protein, ataxia-telangiectasia locus 3 3
MIRT000263 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 2 1
MIRT000482 JAK1 Janus kinase 1 4 3
MIRT000499 PTEN phosphatase and tensin homolog 5 12
MIRT000600 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 5 10
MIRT000977 PTPRO protein tyrosine phosphatase, receptor type, O 3 2
MIRT001158 PKD2 polycystic kidney disease 2 (autosomal dominant) 4 1
MIRT001206 BCL2L11 BCL2-like 11 (apoptosis facilitator) 5 13
MIRT002935 E2F1 E2F transcription factor 1 5 7
MIRT003013 MAP3K12 mitogen-activated protein kinase kinase kinase 12 2 3
MIRT003014 BCL2 B-cell CLL/lymphoma 2 4 4
MIRT003015 MEF2D myocyte enhancer factor 2D 2 3
MIRT003741 RUNX1 runt-related transcription factor 1 4 1
MIRT003898 APP amyloid beta (A4) precursor protein 4 3
MIRT004271 VEGFA vascular endothelial growth factor A 2 3
MIRT004359 MAPK9 mitogen-activated protein kinase 9 4 5
MIRT004525 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 3 2
MIRT004529 FBXO31 F-box protein 31 5 3
MIRT004588 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 5 4
MIRT004591 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 6 6
MIRT004681 TNFSF12 tumor necrosis factor (ligand) superfamily, member 12 1 1
MIRT004710 MUC17 mucin 17, cell surface associated 3 1
MIRT004935 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 5 4
MIRT005287 CCND1 cyclin D1 5 10
MIRT005288 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 3
MIRT005408 NCOA3 nuclear receptor coactivator 3 5 5
MIRT005626 THBS1 thrombospondin 1 3 2
MIRT005629 SMAD4 SMAD family member 4 4 6
MIRT005708 ICAM1 intercellular adhesion molecule 1 1 1
MIRT005711 SELE selectin E 1 1
MIRT005848 CCND2 cyclin D2 2 2
MIRT005849 E2F3 E2F transcription factor 3 2 2
MIRT005850 RB1 retinoblastoma 1 2 2
MIRT005851 RBL1 retinoblastoma-like 1 (p107) 2 2
MIRT005852 RBL2 retinoblastoma-like 2 (p130) 4 2
MIRT005853 WEE1 WEE1 homolog (S. pombe) 2 4
MIRT006611 Tgfbr2 transforming growth factor, beta receptor II 3 1
MIRT006689 RND3 Rho family GTPase 3 3 1
MIRT006796 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 3 1
MIRT007321 TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) 1 1
MIRT031361 S1PR1 sphingosine-1-phosphate receptor 1 1 1
MIRT031362 TCEAL1 transcription elongation factor A (SII)-like 1 5 4
MIRT031363 PRKD1 protein kinase D1 1 2
MIRT031364 GAB1 GRB2-associated binding protein 1 2 3
MIRT031365 VIM vimentin 1 1
MIRT031366 IL8 interleukin 8 1 1
MIRT031367 TSG101 tumor susceptibility gene 101 2 4
MIRT031368 TNFSF13 tumor necrosis factor (ligand) superfamily, member 13 1 1
MIRT031369 HSPB2 heat shock 27kDa protein 2 1 1
MIRT031370 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 1 1
MIRT031371 HBP1 HMG-box transcription factor 1 2 3
MIRT035530 SIRPA signal-regulatory protein alpha 1 1
MIRT050791 MOB1B MOB kinase activator 1B 1 1
MIRT050792 FBXO28 F-box protein 28 1 1
MIRT050793 TJP1 tight junction protein 1 1 1
MIRT050794 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT050795 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT050796 UBE4A ubiquitination factor E4A 1 1
MIRT050797 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT050798 RPS27A ribosomal protein S27a 1 7
MIRT050799 HIST1H4C histone cluster 1, H4c 1 1
MIRT050800 GDAP1 ganglioside induced differentiation associated protein 1 1 1
MIRT050801 TMEM165 transmembrane protein 165 1 1
MIRT050802 SOX4 SRY (sex determining region Y)-box 4 1 6
MIRT050803 TRIM11 tripartite motif containing 11 1 1
MIRT050804 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT050805 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT050806 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT050807 PPP1R15A protein phosphatase 1, regulatory subunit 15A 1 1
MIRT050808 USP38 ubiquitin specific peptidase 38 1 1
MIRT050809 RAB23 RAB23, member RAS oncogene family 1 1
MIRT050810 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT050811 ZSWIM3 zinc finger, SWIM-type containing 3 1 1
MIRT050812 ADARB1 adenosine deaminase, RNA-specific, B1 1 1
MIRT050813 MEN1 multiple endocrine neoplasia I 1 1
MIRT050814 FAM8A1 family with sequence similarity 8, member A1 1 1
MIRT050815 NPAS2 neuronal PAS domain protein 2 1 1
MIRT050816 ATP6 ATP synthase F0 subunit 6 1 1
MIRT050817 STK11 serine/threonine kinase 11 1 1
MIRT050818 ACOT2 acyl-CoA thioesterase 2 1 1
MIRT050819 ATF3 activating transcription factor 3 1 1
MIRT050820 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT050821 RTTN rotatin 1 1
MIRT050822 ZNF689 zinc finger protein 689 1 1
MIRT050823 HTT huntingtin 1 1
MIRT050824 IMMT inner membrane protein, mitochondrial 1 1
MIRT050825 TBC1D15 TBC1 domain family, member 15 1 1
MIRT050826 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT050827 HIST1H2AM histone cluster 1, H2am 1 1
MIRT050828 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT050829 HIST3H2A histone cluster 3, H2a 1 1
MIRT050830 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 1 1
MIRT050831 AZIN1 antizyme inhibitor 1 1 1
MIRT050832 RPS15A ribosomal protein S15a 1 1
MIRT050833 COA1 cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae) 1 1
MIRT050834 CPE carboxypeptidase E 1 1
MIRT050835 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT050836 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT050837 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT050838 ND2 MTND2 1 1
MIRT050839 PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha 1 1
MIRT050840 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT050841 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050842 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT050843 KAT2A K(lysine) acetyltransferase 2A 1 1
MIRT050844 POGK pogo transposable element with KRAB domain 1 1
MIRT050845 OPTN optineurin 1 1
MIRT050846 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT050847 SYNDIG1 synapse differentiation inducing 1 1 1
MIRT050848 UBE2S ubiquitin-conjugating enzyme E2S 1 1
MIRT050849 RYR2 ryanodine receptor 2 (cardiac) 1 1
MIRT050850 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT050851 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT050852 MGEA5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT050853 PELI1 pellino E3 ubiquitin protein ligase 1 1 1
MIRT050854 CETN2 centrin, EF-hand protein, 2 1 1
MIRT050855 AGO1 eukaryotic translation initiation factor 2C, 1 1 2
MIRT050856 RPL37 ribosomal protein L37 1 1
MIRT050857 REEP5 receptor accessory protein 5 1 2
MIRT050858 MRPS6 mitochondrial ribosomal protein S6 1 1
MIRT050859 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT050860 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1 1
MIRT050861 MUC21 mucin 21, cell surface associated 1 1
MIRT050862 KDM4A lysine (K)-specific demethylase 4A 1 1
MIRT050863 HIST2H4B histone cluster 2, H4b 1 1
MIRT050864 COX2 cytochrome c oxidase subunit II 1 1
MIRT050865 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT050866 CBL Cbl proto-oncogene, E3 ubiquitin protein ligase 1 1
MIRT050867 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 1
MIRT050868 NOC2L nucleolar complex associated 2 homolog (S. cerevisiae) 1 1
MIRT050869 CANX calnexin 1 1
MIRT050870 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 3
MIRT050871 EARS2 glutamyl-tRNA synthetase 2, mitochondrial 1 1
MIRT050872 RPL7 ribosomal protein L7 1 1
MIRT050873 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT050874 UBE2C ubiquitin-conjugating enzyme E2C 4 2
MIRT050875 RMDN1 family with sequence similarity 82, member B 1 1
MIRT050876 SLC25A37 solute carrier family 25 (mitochondrial iron transporter), member 37 1 1
MIRT050877 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 6
MIRT050878 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT050879 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT050880 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT050881 HDAC10 histone deacetylase 10 1 1
MIRT050882 RBM5 RNA binding motif protein 5 1 1
MIRT050883 UBE3C ubiquitin protein ligase E3C 1 1
MIRT050884 DEPDC1 DEP domain containing 1 1 1
MIRT050885 TRUB1 TruB pseudouridine (psi) synthase homolog 1 (E. coli) 1 1
MIRT050886 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 1 1
MIRT050887 MDK midkine (neurite growth-promoting factor 2) 1 1
MIRT050888 ZBED3 zinc finger, BED-type containing 3 1 1
MIRT050889 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT050890 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT050891 KIF5C kinesin family member 5C 1 1
MIRT050892 WDR82 WD repeat domain 82 1 1
MIRT050893 COX7B cytochrome c oxidase subunit VIIb 1 1
MIRT050894 SH3GLB2 SH3-domain GRB2-like endophilin B2 1 1
MIRT050895 TAF9B TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa 1 1
MIRT050896 NAPEPLD N-acyl phosphatidylethanolamine phospholipase D 1 1
MIRT050897 ATRX alpha thalassemia/mental retardation syndrome X-linked 1 1
MIRT050898 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT050899 FTH1 ferritin, heavy polypeptide 1 1 1
MIRT050900 PLXNA1 plexin A1 1 2
MIRT050901 OFD1 oral-facial-digital syndrome 1 1 1
MIRT050902 PER1 period homolog 1 (Drosophila) 1 1
MIRT050903 ARL9 ADP-ribosylation factor-like 9 1 1
MIRT050904 ARHGAP5 Rho GTPase activating protein 5 1 1
MIRT050905 SIPA1L3 signal-induced proliferation-associated 1 like 3 1 1
MIRT050906 QARS glutaminyl-tRNA synthetase 1 1
MIRT050907 ELP2 elongator acetyltransferase complex subunit 2 1 1
MIRT050908 SURF4 surfeit 4 1 1
MIRT050909 RPL21 ribosomal protein L21 1 1
MIRT050910 CTSA cathepsin A 1 1
MIRT050911 EPB41L5 erythrocyte membrane protein band 4.1 like 5 1 1
MIRT050912 ABI2 abl-interactor 2 1 2
MIRT050913 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 1 1
MIRT050914 TMEM9 transmembrane protein 9 1 1
MIRT050915 MED12 mediator complex subunit 12 1 1
MIRT050916 NAGK N-acetylglucosamine kinase 1 4
MIRT050917 TSC2 tuberous sclerosis 2 1 1
MIRT050918 GPM6A glycoprotein M6A 1 1
MIRT050919 SEPT2 septin 2 1 4
MIRT050920 TEFM transcription elongation factor, mitochondrial 1 1
MIRT050921 FASN fatty acid synthase 1 1
MIRT050922 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT050923 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT050924 DCUN1D4 DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) 1 1
MIRT050925 PRICKLE1 prickle homolog 1 (Drosophila) 1 1
MIRT050926 SEPT11 septin 11 1 1
MIRT050927 CHST14 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 1 1
MIRT050928 TRIM44 tripartite motif containing 44 1 1
MIRT050929 SON SON DNA binding protein 1 1
MIRT050930 SMIM15 chromosome 5 open reading frame 43 1 1
MIRT050931 LAPTM4A lysosomal protein transmembrane 4 alpha 1 8
MIRT050932 CHTF8 CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) 1 1
MIRT050933 SMAD3 SMAD family member 3 1 1
MIRT050934 NONO non-POU domain containing, octamer-binding 1 1
MIRT050935 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT050936 NOTCH2 notch 2 1 1
MIRT050937 SDHA succinate dehydrogenase complex, subunit A, flavoprotein (Fp) 1 1
MIRT050938 XIAP X-linked inhibitor of apoptosis 1 2
MIRT050939 DNMBP dynamin binding protein 1 1
MIRT050940 TRAP1 TNF receptor-associated protein 1 1 1
MIRT050941 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT050942 MED13 mediator complex subunit 13 1 1
MIRT050943 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT050944 BACE1 beta-site APP-cleaving enzyme 1 1 1
MIRT050945 POGZ pogo transposable element with ZNF domain 1 1
MIRT050946 GDF11 growth differentiation factor 11 1 2
MIRT050947 GPI glucose-6-phosphate isomerase 1 1
MIRT050948 MNT MAX binding protein 1 1
MIRT050949 VPRBP Vpr (HIV-1) binding protein 1 1
MIRT050950 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT050951 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT050952 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT050953 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT050954 FOPNL FGFR1OP N-terminal like 1 1
MIRT050955 TUBB4B tubulin, beta 4B class IVb 1 1
MIRT050956 DPYSL2 dihydropyrimidinase-like 2 1 2
MIRT050957 NBR1 neighbor of BRCA1 gene 1 1 1
MIRT050958 KIAA1919 KIAA1919 1 1
MIRT050959 ZNF507 zinc finger protein 507 1 1
MIRT050960 BLVRA biliverdin reductase A 1 1
MIRT050961 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT050962 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT050963 CLPTM1 cleft lip and palate associated transmembrane protein 1 1 1
MIRT050964 ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7 1 2
MIRT050965 HIST2H3A histone cluster 2, H3a 1 1
MIRT050966 FANCA Fanconi anemia, complementation group A 1 1
MIRT050967 MORF4L2 mortality factor 4 like 2 1 1
MIRT050968 RLF rearranged L-myc fusion 1 1
MIRT050969 RAB5B RAB5B, member RAS oncogene family 1 6
MIRT050970 TOB1 transducer of ERBB2, 1 1 1
MIRT050971 EFHC1 EF-hand domain (C-terminal) containing 1 1 1
MIRT050972 MTMR3 myotubularin related protein 3 1 2
MIRT050973 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 3
MIRT050974 GANAB glucosidase, alpha; neutral AB 1 1
MIRT050975 SLC16A2 solute carrier family 16, member 2 (thyroid hormone transporter) 1 1
MIRT050976 RTN3 reticulon 3 1 1
MIRT050977 ERCC2 excision repair cross-complementing rodent repair deficiency, complementation group 2 1 1
MIRT050978 ATXN7 ataxin 7 1 1
MIRT050979 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT050980 GLO1 glyoxalase I 1 3
MIRT050981 LPIN1 lipin 1 1 1
MIRT050982 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT050983 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT050984 ANKRD27 ankyrin repeat domain 27 (VPS9 domain) 1 1
MIRT050985 TNPO3 transportin 3 1 1
MIRT050986 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT050987 PTTG1 pituitary tumor-transforming 1 1 1
MIRT050988 ARPC2 actin related protein 2/3 complex, subunit 2, 34kDa 1 1
MIRT050989 HN1 hematological and neurological expressed 1 1 1
MIRT050990 SLC25A28 solute carrier family 25 (mitochondrial iron transporter), member 28 1 1
MIRT050991 TRRAP transformation/transcription domain-associated protein 1 1
MIRT050992 ELMO2 engulfment and cell motility 2 1 1
MIRT050993 PCNX pecanex homolog (Drosophila) 1 1
MIRT050994 TMEM19 transmembrane protein 19 1 1
MIRT050995 PBXIP1 pre-B-cell leukemia homeobox interacting protein 1 1 1
MIRT050996 CCT6A chaperonin containing TCP1, subunit 6A (zeta 1) 1 1
MIRT050997 HDHD1 haloacid dehalogenase-like hydrolase domain containing 1 1 1
MIRT050998 PLS1 plastin 1 1 2
MIRT050999 RNF145 ring finger protein 145 1 1
MIRT051000 AK1 adenylate kinase 1 1 1
MIRT051001 TCEA2 transcription elongation factor A (SII), 2 1 1
MIRT051002 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT051003 PDPK1 3-phosphoinositide dependent protein kinase-1 1 2
MIRT051004 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 1 2
MIRT051005 RTCA RNA 3'-terminal phosphate cyclase 1 1
MIRT051006 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT051007 LAS1L LAS1-like (S. cerevisiae) 1 1
MIRT051008 RPSA ribosomal protein SA 1 1
MIRT051009 TMSB10 thymosin beta 10 1 1
MIRT051010 ERLIN1 ER lipid raft associated 1 1 1
MIRT051011 EHMT2 euchromatic histone-lysine N-methyltransferase 2 1 1
MIRT051012 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT051013 ARHGAP10 Rho GTPase activating protein 10 1 1
MIRT051014 PDLIM5 PDZ and LIM domain 5 1 1
MIRT051015 CCDC47 coiled-coil domain containing 47 1 1
MIRT051016 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 1 1
MIRT051017 MTF1 metal-regulatory transcription factor 1 1 2
MIRT051018 C15orf41 chromosome 15 open reading frame 41 1 2
MIRT051019 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 4
MIRT051020 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 1
MIRT051021 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT051022 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 2
MIRT051023 FXR2 fragile X mental retardation, autosomal homolog 2 1 1
MIRT051024 SUOX sulfite oxidase 1 1
MIRT051025 STIL SCL/TAL1 interrupting locus 1 1
MIRT051026 WAC WW domain containing adaptor with coiled-coil 1 4
MIRT051027 FER fer (fps/fes related) tyrosine kinase 1 1
MIRT051028 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 2
MIRT051029 BTN3A1 butyrophilin, subfamily 3, member A1 1 2
MIRT051030 TRIM8 tripartite motif containing 8 1 2
MIRT051031 RUNDC1 RUN domain containing 1 1 2
MIRT051032 ZFYVE26 zinc finger, FYVE domain containing 26 1 3
MIRT051033 RNF146 ring finger protein 146 1 1
MIRT051034 PPP1CA protein phosphatase 1, catalytic subunit, alpha isozyme 1 1
MIRT051035 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT051036 ZIK1 zinc finger protein interacting with K protein 1 homolog (mouse) 1 1
MIRT051037 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT051038 MAP3K8 mitogen-activated protein kinase kinase kinase 8 1 1
MIRT051039 ZNF598 zinc finger protein 598 1 1
MIRT051040 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT051041 KIF1A kinesin family member 1A 1 1
MIRT051042 MAP3K9 mitogen-activated protein kinase kinase kinase 9 1 1
MIRT051043 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT051044 RALGAPA1 Ral GTPase activating protein, alpha subunit 1 (catalytic) 1 1
MIRT051045 ZBTB5 zinc finger and BTB domain containing 5 1 3
MIRT051046 PCGF5 polycomb group ring finger 5 1 1
MIRT051047 GNAS GNAS complex locus 1 2
MIRT051048 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT051049 RBM12B RNA binding motif protein 12B 1 3
MIRT051050 TXLNA taxilin alpha 1 2
MIRT051051 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT051052 KCTD7 potassium channel tetramerisation domain containing 7 1 1
MIRT051053 HEXIM1 hexamethylene bis-acetamide inducible 1 1 1
MIRT051054 DAPK3 death-associated protein kinase 3 1 1
MIRT051055 PLEKHM1 pleckstrin homology domain containing, family M (with RUN domain) member 1 1 1
MIRT052967 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 1 1
MIRT052986 Jak2 Janus kinase 2 2 1
MIRT052987 Stat5a signal transducer and activator of transcription 5A 2 1
MIRT052988 Bcl2 B cell leukemia/lymphoma 2 2 1
MIRT053060 TP53INP1 tumor protein p53 inducible nuclear protein 1 4 3
MIRT053108 ITGB8 integrin, beta 8 2 1
MIRT053202 BMP2 bone morphogenetic protein 2 4 2
MIRT053770 SOCS6 suppressor of cytokine signaling 6 3 1
MIRT054222 LIMK1 LIM domain kinase 1 2 1
MIRT054344 KAT2B K(lysine) acetyltransferase 2B 3 1
MIRT054403 TIMP3 TIMP metallopeptidase inhibitor 3 3 1
MIRT054458 ZBTB4 zinc finger and BTB domain containing 4 2 5
MIRT054644 PDLIM7 PDZ and LIM domain 7 (enigma) 3 1
MIRT054882 MAPK14 mitogen-activated protein kinase 14 1 1
MIRT054903 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 5 3
MIRT054927 NPAS3 neuronal PAS domain protein 3 4 1
MIRT055019 TPRG1L tumor protein p63 regulated 1-like 1 2
MIRT055381 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 3
MIRT055648 WDR37 WD repeat domain 37 1 1
MIRT056475 PFKP phosphofructokinase, platelet 1 5
MIRT056810 REEP3 receptor accessory protein 3 1 2
MIRT057383 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 2
MIRT057821 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT058911 FAM46C family with sequence similarity 46, member C 1 1
MIRT059185 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT060074 TMEM138 transmembrane protein 138 1 1
MIRT060497 PPP6R3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT060675 KLHL20 kelch-like 20 (Drosophila) 1 1
MIRT061180 MED17 mediator complex subunit 17 1 2
MIRT061788 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 5
MIRT063053 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT063433 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT064794 ZBTB18 zinc finger protein 238 1 2
MIRT065363 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT065669 ACVR1B activin A receptor, type IB 1 3
MIRT067227 FOXJ2 forkhead box J2 1 1
MIRT068491 NHLRC3 NHL repeat containing 3 1 1
MIRT069697 FOXJ3 forkhead box J3 1 2
MIRT070838 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 2
MIRT070992 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT071321 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT071900 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT072246 B2M beta-2-microglobulin 1 5
MIRT072566 USP3 ubiquitin specific peptidase 3 1 1
MIRT073116 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT073373 ABHD2 abhydrolase domain containing 2 1 1
MIRT073406 SEMA4B sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B 1 1
MIRT074788 CYLD cylindromatosis (turban tumor syndrome) 1 1
MIRT074888 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT075774 KIAA0513 KIAA0513 1 3
MIRT076176 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 3
MIRT077063 KRT10 keratin 10 1 4
MIRT077830 MINK1 misshapen-like kinase 1 1 2
MIRT078810 UNK unkempt homolog (Drosophila) 1 1
MIRT079341 CCDC137 coiled-coil domain containing 137 1 2
MIRT079410 FOXK2 forkhead box K2 1 3
MIRT079771 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT080176 PRKACB protein kinase, cAMP-dependent, catalytic, beta 1 1
MIRT080847 RAB12 RAB12, member RAS oncogene family 1 1
MIRT081115 LDLR low density lipoprotein receptor 4 6
MIRT081197 MIDN midnolin 1 6
MIRT081980 GRAMD1A GRAM domain containing 1A 1 1
MIRT082289 FNBP1L formin binding protein 1-like 1 3
MIRT083738 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT083959 RAB22A RAB22A, member RAS oncogene family 1 3
MIRT084343 RRM2 ribonucleotide reductase M2 1 2
MIRT085172 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 2
MIRT085374 SPOPL speckle-type POZ protein-like 1 1
MIRT085866 TANC1 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 1 1
MIRT087601 ATG16L1 autophagy related 16-like 1 (S. cerevisiae) 1 1
MIRT088032 UBXN2A UBX domain protein 2A 1 2
MIRT088336 MAPRE3 microtubule-associated protein, RP/EB family, member 3 1 4
MIRT090632 U2SURP U2 snRNP-associated SURP domain containing 1 4
MIRT092684 C3ORF38 chromosome 3 open reading frame 38 1 4
MIRT093799 KLF3 Kruppel-like factor 3 (basic) 1 1
MIRT093940 SLAIN2 SLAIN motif family, member 2 1 1
MIRT095197 SMAD5 SMAD family member 5 1 1
MIRT095718 ANKH ankylosis, progressive homolog (mouse) 1 4
MIRT095994 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT096307 SQSTM1 sequestosome 1 1 1
MIRT097127 FCHO2 FCH domain only 2 1 2
MIRT097602 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 1 1
MIRT097648 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT099305 QKI QKI, KH domain containing, RNA binding 1 2
MIRT099354 C6ORF120 chromosome 6 open reading frame 120 1 1
MIRT100276 MICB MHC class I polypeptide-related sequence B 1 1
MIRT100452 ZBTB9 zinc finger and BTB domain containing 9 1 1
MIRT100944 CENPQ centromere protein Q 1 2
MIRT102293 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 5
MIRT103188 SP4 Sp4 transcription factor 1 3
MIRT104160 PHTF2 putative homeodomain transcription factor 2 1 3
MIRT104391 ANKIB1 ankyrin repeat and IBR domain containing 1 1 1
MIRT108650 ZBTB33 zinc finger and BTB domain containing 33 1 3
MIRT110265 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT112088 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 3
MIRT115778 CAPN15 small optic lobes homolog (Drosophila) 1 1
MIRT121799 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT122362 RGMB RGM domain family, member B 1 2
MIRT124124 GINS4 GINS complex subunit 4 (Sld5 homolog) 1 2
MIRT126305 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT126343 ZRANB1 zinc finger, RAN-binding domain containing 1 1 1
MIRT126547 MASTL microtubule associated serine/threonine kinase-like 1 2
MIRT127160 VPS26A vacuolar protein sorting 26 homolog A (S. pombe) 1 1
MIRT129130 ARCN1 archain 1 1 1
MIRT130067 TXNIP thioredoxin interacting protein 1 3
MIRT132393 PPP1R12B protein phosphatase 1, regulatory subunit 12B 1 1
MIRT133312 ORAI1 ORAI calcium release-activated calcium modulator 1 1 1
MIRT134274 DNM1L dynamin 1-like 1 1
MIRT135705 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase, type II, gamma 1 1
MIRT135792 GNS glucosamine (N-acetyl)-6-sulfatase 1 4
MIRT138109 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT138345 FRMD6 FERM domain containing 6 1 1
MIRT138791 SUSD6 KIAA0247 1 1
MIRT140625 PLEKHO2 pleckstrin homology domain containing, family O member 2 1 1
MIRT140790 SMAD6 SMAD family member 6 1 1
MIRT141125 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141697 RCCD1 RCC1 domain containing 1 1 1
MIRT142094 CCP110 centriolar coiled coil protein 110kDa 1 1
MIRT142375 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT144206 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT144977 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT145596 LASP1 LIM and SH3 protein 1 1 2
MIRT147117 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT147272 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 6
MIRT147918 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT148865 ANKRD12 ankyrin repeat domain 12 1 1
MIRT151689 CHAF1A chromatin assembly factor 1, subunit A (p150) 1 1
MIRT151798 BLOC1S3 biogenesis of lysosomal organelles complex-1, subunit 3 1 1
MIRT151852 ARHGAP35 Rho GTPase activating protein 35 1 1
MIRT151931 TBC1D17 TBC1 domain family, member 17 1 1
MIRT152366 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT152672 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT153326 MAVS mitochondrial antiviral signaling protein 1 2
MIRT153452 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT153968 PRNP prion protein 1 2
MIRT155230 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT155332 IFNAR1 interferon (alpha, beta and omega) receptor 1 1 1
MIRT155884 SIK1 salt-inducible kinase 1 1 1
MIRT156401 RAPGEF4 Rap guanine nucleotide exchange factor (GEF) 4 1 1
MIRT156639 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT157144 FAM117B family with sequence similarity 117, member B 1 1
MIRT158287 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT158572 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT159102 NRBP1 nuclear receptor binding protein 1 1 2
MIRT159398 FEZ2 fasciculation and elongation protein zeta 2 (zygin II) 1 1
MIRT160003 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT164522 MSMO1 methylsterol monooxygenase 1 1 2
MIRT164658 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT164719 ADD1 adducin 1 (alpha) 1 1
MIRT166061 FAF2 Fas associated factor family member 2 1 1
MIRT167837 HECA headcase homolog (Drosophila) 1 1
MIRT168215 BTN3A2 butyrophilin, subfamily 3, member A2 1 1
MIRT169662 AGFG2 ArfGAP with FG repeats 2 1 1
MIRT170563 CASP2 caspase 2, apoptosis-related cysteine peptidase 1 1
MIRT170848 TAX1BP1 Tax1 (human T-cell leukemia virus type I) binding protein 1 1 3
MIRT172196 OXR1 oxidation resistance 1 1 1
MIRT173111 E2F5 E2F transcription factor 5, p130-binding 1 1
MIRT173687 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT175378 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT175591 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT175643 PHF6 PHD finger protein 6 1 1
MIRT176078 CHIC1 cysteine-rich hydrophobic domain 1 1 1
MIRT178060 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT182516 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT187471 PCBP2 poly(rC) binding protein 2 1 2
MIRT188182 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT194848 UBFD1 ubiquitin family domain containing 1 1 1
MIRT199105 ZNF532 zinc finger protein 532 1 1
MIRT199282 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 1
MIRT200923 ZNF264 zinc finger protein 264 1 3
MIRT201018 ZNF805 zinc finger protein 805 1 1
MIRT205045 CREB1 cAMP responsive element binding protein 1 2 2
MIRT205280 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT206191 RAB10 RAB10, member RAS oncogene family 1 2
MIRT208974 SKIL SKI-like oncogene 1 5
MIRT213202 REST RE1-silencing transcription factor 1 1
MIRT213320 KIAA0232 KIAA0232 1 1
MIRT216422 SERF1A small EDRK-rich factor 1A (telomeric) 1 1
MIRT216447 SERF1B small EDRK-rich factor 1B (centromeric) 1 1
MIRT216660 F2R coagulation factor II (thrombin) receptor 1 1
MIRT220117 CAV1 caveolin 1, caveolae protein, 22kDa 1 1
MIRT222672 EIF4H eukaryotic translation initiation factor 4H 1 3
MIRT222907 CROT carnitine O-octanoyltransferase 1 1
MIRT224884 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT227325 TRIM32 tripartite motif containing 32 1 1
MIRT230962 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT238171 ANKRD33B ankyrin repeat domain 33B 1 5
MIRT241293 ZC3H12C zinc finger CCCH-type containing 12C 1 4
MIRT242195 TTC9 tetratricopeptide repeat domain 9 1 2
MIRT242654 SALL3 sal-like 3 (Drosophila) 1 2
MIRT243777 AFF1 AF4/FMR2 family, member 1 1 1
MIRT244587 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT246958 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT247078 CEP57 centrosomal protein 57kDa 1 1
MIRT248849 SESN2 sestrin 2 1 1
MIRT250443 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT254247 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT257278 FOXC1 forkhead box C1 1 1
MIRT266047 FJX1 four jointed box 1 (Drosophila) 1 2
MIRT266852 SLC25A44 solute carrier family 25, member 44 1 1
MIRT280206 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT280990 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT283171 C16ORF52 chromosome 16 open reading frame 52 1 1
MIRT286941 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT289570 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT291930 TPM4 tropomyosin 4 1 1
MIRT293644 PVR poliovirus receptor 1 2
MIRT296867 REV1 REV1, polymerase (DNA directed) 1 1
MIRT299336 CYBRD1 cytochrome b reductase 1 1 1
MIRT302433 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT322519 HMBOX1 homeobox containing 1 1 1
MIRT325509 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT363921 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT368881 BCL2L2 BCL2-like 2 1 1
MIRT397683 ATXN7L3B ataxin 7-like 3B 1 1
MIRT400045 ADRBK2 adrenergic, beta, receptor kinase 2 1 1
MIRT437865 TGFB1 transforming growth factor, beta 1 1 1
MIRT437882 CLU clusterin 2 1
MIRT437884 ADAR adenosine deaminase, RNA-specific 2 3
MIRT437932 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 3 3
MIRT438055 ETV1 ets variant 1 4 1
MIRT438161 EPAS1 endothelial PAS domain protein 1 1 1
MIRT438761 TBC1D2 TBC1 domain family, member 2 3 1
MIRT438788 FAS Fas (TNF receptor superfamily, member 6) 1 1
MIRT438795 TP53 tumor protein p53 1 1
MIRT438810 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT441881 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT442203 CCDC132 coiled-coil domain containing 132 1 1
MIRT442552 SLCO5A1 solute carrier organic anion transporter family, member 5A1 1 1
MIRT442767 NRIP3 nuclear receptor interacting protein 3 1 1
MIRT442805 CEP170 centrosomal protein 170kDa 1 2
MIRT443259 A1CF APOBEC1 complementation factor 1 1
MIRT443713 LLPH LLP homolog, long-term synaptic facilitation (Aplysia) 1 1
MIRT444312 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT444438 EMC1 ER membrane protein complex subunit 1 1 1
MIRT448314 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT448367 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 3
MIRT448646 NPNT nephronectin 1 1
MIRT448675 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT448729 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT449174 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT450190 TMEM9B TMEM9 domain family, member B 1 1
MIRT450914 CADM2 cell adhesion molecule 2 1 1
MIRT450952 ATAD2 ATPase family, AAA domain containing 2 1 1
MIRT458294 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT462127 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 1
MIRT465234 TRIP10 thyroid hormone receptor interactor 10 1 1
MIRT465540 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT465838 TMEM64 transmembrane protein 64 1 2
MIRT466456 TFAM transcription factor A, mitochondrial 1 4
MIRT467496 SMIM13 chromosome 6 open reading frame 228 1 3
MIRT467899 SLC22A23 solute carrier family 22, member 23 1 1
MIRT468162 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT468186 SGMS1 sphingomyelin synthase 1 1 1
MIRT469860 PXK PX domain containing serine/threonine kinase 1 4
MIRT470054 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT471011 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT472169 NIN ninein (GSK3B interacting protein) 1 2
MIRT472285 NFIB nuclear factor I/B 1 2
MIRT472342 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 2
MIRT473169 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT473811 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 2
MIRT473908 M6PR mannose-6-phosphate receptor (cation dependent) 1 5
MIRT474422 KLHL28 kelch-like 28 (Drosophila) 1 5
MIRT474600 KLF6 Kruppel-like factor 6 1 1
MIRT475409 ICMT isoprenylcysteine carboxyl methyltransferase 1 2
MIRT475478 HSPA8 heat shock 70kDa protein 8 1 3
MIRT476125 GPR157 G protein-coupled receptor 157 1 3
MIRT476909 FBXL5 F-box and leucine-rich repeat protein 5 1 7
MIRT477117 FAM160B1 family with sequence similarity 160, member B1 1 3
MIRT477198 F3 coagulation factor III (thromboplastin, tissue factor) 1 4
MIRT477287 ERGIC2 ERGIC and golgi 2 1 1
MIRT478720 CSNK1A1 casein kinase 1, alpha 1 1 2
MIRT479041 COIL coilin 1 5
MIRT479066 CNOT6L CCR4-NOT transcription complex, subunit 6-like 1 4
MIRT479269 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT480568 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT480677 BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) 1 1
MIRT480954 BBX bobby sox homolog (Drosophila) 1 4
MIRT481348 ATL3 atlastin GTPase 3 1 2
MIRT481605 ARHGAP1 Rho GTPase activating protein 1 1 4
MIRT481888 ANKRD50 ankyrin repeat domain 50 1 1
MIRT482137 AKAP11 A kinase (PRKA) anchor protein 11 1 6
MIRT484866 ZNF70 zinc finger protein 70 1 2
MIRT484887 ZNF652 zinc finger protein 652 1 1
MIRT485100 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 2
MIRT485194 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 2
MIRT485335 MYO1D myosin ID 1 1
MIRT485369 MYLIP myosin regulatory light chain interacting protein 1 6
MIRT485589 FOXQ1 forkhead box Q1 1 1
MIRT485818 ARID4B AT rich interactive domain 4B (RBP1-like) 1 3
MIRT486030 LPAR2 lysophosphatidic acid receptor 2 1 1
MIRT486758 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT489608 ZDHHC20 zinc finger, DHHC-type containing 20 1 5
MIRT491661 PDRG1 p53 and DNA-damage regulated 1 1 5
MIRT491808 ZFYVE21 zinc finger, FYVE domain containing 21 1 4
MIRT492012 UGCG UDP-glucose ceramide glucosyltransferase 1 1
MIRT492380 SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) 1 1
MIRT492782 PDGFB platelet-derived growth factor beta polypeptide 1 1
MIRT493127 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 4
MIRT493617 HMGB3 high mobility group box 3 1 3
MIRT494078 DUSP2 dual specificity phosphatase 2 1 2
MIRT494430 BTG2 BTG family, member 2 1 2
MIRT496065 MORC1 MORC family CW-type zinc finger 1 1 1
MIRT498164 FEM1C fem-1 homolog c (C. elegans) 1 5
MIRT499908 KIAA1191 KIAA1191 1 3
MIRT500725 TRIM37 tripartite motif containing 37 1 1
MIRT500767 TMEM127 transmembrane protein 127 1 5
MIRT500872 SUCO SUN domain containing ossification factor 1 3
MIRT501468 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 5
MIRT502006 MAP7 microtubule-associated protein 7 1 4
MIRT502052 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 1 3
MIRT502373 GIGYF1 GRB10 interacting GYF protein 1 1 5
MIRT502405 GATA6 GATA binding protein 6 1 4
MIRT503082 C11orf30 chromosome 11 open reading frame 30 1 5
MIRT503216 ACER2 alkaline ceramidase 2 1 1
MIRT503611 ZNF780A zinc finger protein 780A 1 1
MIRT503807 ZNF12 zinc finger protein 12 1 4
MIRT503830 TMEM242 transmembrane protein 242 1 2
MIRT503968 ZNF180 zinc finger protein 180 1 3
MIRT504100 C9orf40 chromosome 9 open reading frame 40 1 4
MIRT504567 ZNF417 zinc finger protein 417 1 3
MIRT504642 MFSD8 major facilitator superfamily domain containing 8 1 3
MIRT505061 ZNF202 zinc finger protein 202 1 3
MIRT505493 SRSF2 serine/arginine-rich splicing factor 2 1 3
MIRT505869 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT505982 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 3
MIRT506459 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT506546 MORF4L1 mortality factor 4 like 1 1 4
MIRT506623 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 4
MIRT506663 MAPK1 mitogen-activated protein kinase 1 1 3
MIRT506684 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT506849 KIF23 kinesin family member 23 1 3
MIRT506874 KIAA1147 KIAA1147 1 1
MIRT506888 KIAA0101 KIAA0101 1 2
MIRT506992 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT507204 FZD9 frizzled family receptor 9 1 3
MIRT507371 FAM129A family with sequence similarity 129, member A 1 4
MIRT507436 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT507948 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT507966 BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 1 4
MIRT508091 ANKRD52 ankyrin repeat domain 52 1 2
MIRT508577 CEP72 centrosomal protein 72kDa 1 2
MIRT508746 ZNF682 zinc finger protein 682 1 2
MIRT508838 GPR155 G protein-coupled receptor 155 1 1
MIRT509131 BMP8B bone morphogenetic protein 8b 1 3
MIRT509746 EFCAB11 EF-hand calcium binding domain 11 1 2
MIRT510030 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 2
MIRT510879 RAN RAN, member RAS oncogene family 1 5
MIRT511088 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 3
MIRT511264 KLHL36 kelch-like 36 (Drosophila) 1 3
MIRT511321 KIAA1551 KIAA1551 1 1
MIRT511557 HMGB1 high mobility group box 1 1 3
MIRT512323 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 3
MIRT513468 NARS asparaginyl-tRNA synthetase 1 3
MIRT513707 RBM20 RNA binding motif protein 20 1 2
MIRT513749 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT513992 CEP97 centrosomal protein 97kDa 1 2
MIRT514102 EPS15L1 epidermal growth factor receptor pathway substrate 15-like 1 1 3
MIRT514138 SERF2 small EDRK-rich factor 2 1 1
MIRT514322 FXYD5 FXYD domain containing ion transport regulator 5 1 3
MIRT514999 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 1
MIRT515206 CRCP CGRP receptor component 1 1
MIRT515576 TMEM134 transmembrane protein 134 1 1
MIRT516061 MED18 mediator complex subunit 18 1 1
MIRT516371 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT516560 MIXL1 Mix paired-like homeobox 1 1
MIRT516800 PTRF polymerase I and transcript release factor 1 2
MIRT517022 COX19 cytochrome c oxidase assembly homolog 19 (S. cerevisiae) 1 1
MIRT517188 SLC28A1 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 1 1
MIRT517261 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 2
MIRT518318 ZNF514 zinc finger protein 514 1 2
MIRT518469 KIF6 kinesin family member 6 1 1
MIRT518700 KCNMB1 potassium large conductance calcium-activated channel, subfamily M, beta member 1 1 1
MIRT518805 MED16 mediator complex subunit 16 1 2
MIRT518864 NEK8 NIMA (never in mitosis gene a)- related kinase 8 1 1
MIRT518973 GRK7 G protein-coupled receptor kinase 7 1 1
MIRT519433 KCNA7 potassium voltage-gated channel, shaker-related subfamily, member 7 1 2
MIRT519549 TMEM38A transmembrane protein 38A 1 1
MIRT520083 YIPF4 Yip1 domain family, member 4 1 1
MIRT520157 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT521011 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT521305 RRAGD Ras-related GTP binding D 1 2
MIRT521550 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 2
MIRT522173 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 2
MIRT522199 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 4
MIRT522507 MFN1 mitofusin 1 1 1
MIRT523084 HYPK huntingtin interacting protein K 1 1
MIRT523655 FOXK1 forkhead box K1 1 2
MIRT524084 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT524252 DCTN6 dynactin 6 1 1
MIRT524296 CYCS cytochrome c, somatic 1 1
MIRT524458 CNKSR3 CNKSR family member 3 1 1
MIRT524707 BTG3 BTG family, member 3 1 4
MIRT524985 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT525205 ZNF93 zinc finger protein 93 1 1
MIRT525489 TPK1 thiamin pyrophosphokinase 1 1 1
MIRT525766 SOD2 superoxide dismutase 2, mitochondrial 1 2
MIRT526640 NME6 NME/NM23 nucleoside diphosphate kinase 6 1 1
MIRT527207 XIRP2 xin actin-binding repeat containing 2 1 1
MIRT527260 TMEM196 transmembrane protein 196 1 1
MIRT527475 CLEC12B C-type lectin domain family 12, member B 1 2
MIRT528375 ZMYM1 zinc finger, MYM-type 1 1 2
MIRT530004 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 2
MIRT530592 ABHD15 abhydrolase domain containing 15 1 1
MIRT530990 EXO5 exonuclease 5 1 2
MIRT531780 TXK TXK tyrosine kinase 1 2
MIRT531840 MTPAP mitochondrial poly(A) polymerase 1 2
MIRT532054 FHDC1 FH2 domain containing 1 1 1
MIRT532619 SPTLC2 serine palmitoyltransferase, long chain base subunit 2 1 1
MIRT532928 ZNF385A zinc finger protein 385A 1 1
MIRT533091 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 2
MIRT533882 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT534011 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT534572 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 2
MIRT534632 RNASEH1 ribonuclease H1 1 2
MIRT535034 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT536313 LIMA1 LIM domain and actin binding 1 1 3
MIRT536447 KMT2B myeloid/lymphoid or mixed-lineage leukemia 4 1 3
MIRT536502 KIAA0922 KIAA0922 1 1
MIRT536543 KCNJ8 potassium inwardly-rectifying channel, subfamily J, member 8 1 1
MIRT537451 FBXL7 F-box and leucine-rich repeat protein 7 1 1
MIRT537736 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT538046 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 1
MIRT538720 CAPRIN2 caprin family member 2 1 3
MIRT539428 ADAT2 adenosine deaminase, tRNA-specific 2 1 1
MIRT540279 FAM89A family with sequence similarity 89, member A 1 1
MIRT541092 RLIM ring finger protein, LIM domain interacting 1 1
MIRT542064 SLC25A46 solute carrier family 25, member 46 1 1
MIRT542146 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT542272 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT543189 FICD FIC domain containing 1 1
MIRT543584 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT544633 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT545207 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT546261 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1 2
MIRT546298 TMEM200C transmembrane protein 200C 1 2
MIRT546693 RORA RAR-related orphan receptor A 1 2
MIRT546826 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT547086 PLRG1 pleiotropic regulator 1 1 1
MIRT547796 KATNAL1 katanin p60 subunit A-like 1 1 2
MIRT548323 EPHA4 EPH receptor A4 1 1
MIRT548473 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT548823 CLIC4 chloride intracellular channel 4 1 2
MIRT548866 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT549112 C16orf70 chromosome 16 open reading frame 70 1 2
MIRT549256 ATXN1 ataxin 1 1 2
MIRT549327 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT549827 LUZP2 leucine zipper protein 2 1 1
MIRT550098 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT550309 ZNF681 zinc finger protein 681 1 1
MIRT551128 ZNF107 zinc finger protein 107 1 1
MIRT551749 FMNL2 formin-like 2 1 1
MIRT552209 F2RL3 coagulation factor II (thrombin) receptor-like 3 1 1
MIRT552690 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 2
MIRT552868 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT553037 USP48 ubiquitin specific peptidase 48 1 1
MIRT553575 TMEM100 transmembrane protein 100 1 1
MIRT553703 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT554417 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT554483 SAMD12 sterile alpha motif domain containing 12 1 1
MIRT554533 RUFY2 RUN and FYVE domain containing 2 1 1
MIRT554559 RRN3 RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) 1 1
MIRT554755 RHOC ras homolog family member C 1 1
MIRT555469 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT556160 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 2
MIRT556191 MCC mutated in colorectal cancers 1 1
MIRT556597 LEPROT leptin receptor overlapping transcript 1 1
MIRT556909 ISOC1 isochorismatase domain containing 1 1 1
MIRT557033 HOXD11 homeobox D11 1 1
MIRT557597 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT557764 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT557890 FEM1B fem-1 homolog b (C. elegans) 1 2
MIRT558272 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 2
MIRT558339 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 2
MIRT558778 CFL2 cofilin 2 (muscle) 1 2
MIRT558940 CBX1 chromobox homolog 1 1 1
MIRT559447 ARSJ arylsulfatase family, member J 1 1
MIRT561248 ZNF354B zinc finger protein 354B 1 1
MIRT561651 RUNX3 runt-related transcription factor 3 1 1
MIRT562220 HMGB2 high mobility group box 2 1 1
MIRT562428 EFCAB14 KIAA0494 1 2
MIRT562562 CCDC71L coiled-coil domain containing 71-like 1 2
MIRT562970 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT563384 DSPP dentin sialophosphoprotein 1 1
MIRT564688 ZNF35 zinc finger protein 35 1 1
MIRT564799 ZBTB7A zinc finger and BTB domain containing 7A 1 2
MIRT565703 SESN3 sestrin 3 1 1
MIRT565919 SCAMP2 secretory carrier membrane protein 2 1 2
MIRT566146 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT566575 OTUD4 OTU domain containing 4 1 1
MIRT566888 LRP12 low density lipoprotein receptor-related protein 12 1 1
MIRT567062 KCNB1 potassium voltage-gated channel, Shab-related subfamily, member 1 1 1
MIRT567118 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT567548 FGFR1OP FGFR1 oncogene partner 1 1
MIRT567632 FAM210A family with sequence similarity 210, member A 1 2
MIRT567690 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT567854 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT567928 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 2
MIRT567997 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT568185 CCDC6 coiled-coil domain containing 6 1 1
MIRT568275 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT571020 CKAP2 cytoskeleton associated protein 2 1 1
MIRT571683 RRAS2 related RAS viral (r-ras) oncogene homolog 2 1 1
MIRT571699 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT571729 RPL17-C18orf32 RPL17-C18orf32 readthrough 1 1
MIRT571869 NKIRAS1 NFKB inhibitor interacting Ras-like 1 1 1
MIRT572214 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT572681 AGMAT agmatine ureohydrolase (agmatinase) 1 2
MIRT573921 SNAP47 synaptosomal-associated protein, 47kDa 1 1
MIRT574723 HAUS8 HAUS augmin-like complex, subunit 8 1 2
MIRT575219 Piwil2 piwi-like homolog 2 (Drosophila) 1 1
MIRT575994 Fem1a feminization 1 homolog a (C. elegans) 1 1
MIRT608373 PIWIL2 piwi-like 2 (Drosophila) 1 3
MIRT608753 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT608979 PRKCB protein kinase C, beta 1 1
MIRT611004 BRI3BP BRI3 binding protein 1 2
MIRT611841 FEM1A fem-1 homolog a (C. elegans) 1 2
MIRT612616 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT614268 WDR53 WD repeat domain 53 1 2
MIRT615181 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT615452 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT616177 TCEB1 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) 1 1
MIRT616442 FAM126B family with sequence similarity 126, member B 1 2
MIRT619846 POLM polymerase (DNA directed), mu 1 2
MIRT620982 TM4SF5 transmembrane 4 L six family member 5 1 1
MIRT624431 CBX8 chromobox homolog 8 1 1
MIRT626043 ATAT1 alpha tubulin acetyltransferase 1 1 2
MIRT626226 PNRC1 proline-rich nuclear receptor coactivator 1 1 2
MIRT626935 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT628570 MELK maternal embryonic leucine zipper kinase 1 1
MIRT633127 CBX5 chromobox homolog 5 1 1
MIRT634103 APOH apolipoprotein H (beta-2-glycoprotein I) 1 1
MIRT634460 PAK6 p21 protein (Cdc42/Rac)-activated kinase 6 1 1
MIRT634651 HIP1 huntingtin interacting protein 1 1 1
MIRT634960 GTF2H2C general transcription factor IIH, polypeptide 2C 1 2
MIRT640015 OSTM1 osteopetrosis associated transmembrane protein 1 1 1
MIRT641711 SPCS1 signal peptidase complex subunit 1 homolog (S. cerevisiae) 1 1
MIRT641803 USP32 ubiquitin specific peptidase 32 1 2
MIRT645220 POLR3F polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa 1 1
MIRT662412 ICA1L islet cell autoantigen 1,69kDa-like 1 2
MIRT664233 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT664399 CYB5A cytochrome b5 type A (microsomal) 1 1
MIRT664799 LIAS lipoic acid synthetase 1 2
MIRT673139 MFSD2A major facilitator superfamily domain containing 2A 1 1
MIRT675844 DHODH dihydroorotate dehydrogenase (quinone) 1 2
MIRT677160 DEGS1 delta(4)-desaturase, sphingolipid 1 1 1
MIRT677266 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT678753 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT680379 GATAD1 GATA zinc finger domain containing 1 1 2
MIRT680706 ZNF785 zinc finger protein 785 1 1
MIRT680784 WDR73 WD repeat domain 73 1 1
MIRT681416 RMND1 required for meiotic nuclear division 1 homolog (S. cerevisiae) 1 1
MIRT681846 N4BP2L2 NEDD4 binding protein 2-like 2 1 1
MIRT682337 RAB42 RAB42, member RAS oncogene family 1 1
MIRT683335 C19orf40 chromosome 19 open reading frame 40 1 1
MIRT683405 ESR2 estrogen receptor 2 (ER beta) 1 1
MIRT683509 ZNF7 zinc finger protein 7 1 1
MIRT683541 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT683892 OCIAD1 OCIA domain containing 1 1 1
MIRT683965 MYLK3 myosin light chain kinase 3 1 1
MIRT683994 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT684097 TLR7 toll-like receptor 7 1 1
MIRT684150 CEP104 centrosomal protein 104kDa 1 1
MIRT684375 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT684591 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT684634 GTF2IRD2B GTF2I repeat domain containing 2B 1 1
MIRT684665 PDE4C phosphodiesterase 4C, cAMP-specific 1 1
MIRT684730 LRRD1 leucine-rich repeats and death domain containing 1 1 1
MIRT684759 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT684804 MYO1F myosin IF 1 1
MIRT684936 CD28 CD28 molecule 1 1
MIRT685212 DCTN5 dynactin 5 (p25) 1 1
MIRT685265 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT685333 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT685368 CCL5 chemokine (C-C motif) ligand 5 1 1
MIRT685536 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT685595 KCNK6 potassium channel, subfamily K, member 6 1 1
MIRT685726 BHMT2 betaine--homocysteine S-methyltransferase 2 1 1
MIRT685759 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT685800 ZNF426 zinc finger protein 426 1 1
MIRT685899 RTN2 reticulon 2 1 1
MIRT685972 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT686123 TNIP3 TNFAIP3 interacting protein 3 1 1
MIRT686173 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT686300 WWC1 WW and C2 domain containing 1 1 1
MIRT686338 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT686461 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT686503 TRIOBP TRIO and F-actin binding protein 1 1
MIRT686544 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT686599 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT686844 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT686897 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT686926 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 2
MIRT686997 SERINC1 serine incorporator 1 1 1
MIRT687061 RNF115 ring finger protein 115 1 1
MIRT687096 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT687271 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT687612 MANEAL mannosidase, endo-alpha-like 1 1
MIRT687667 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT687875 ISCA2 iron-sulfur cluster assembly 2 homolog (S. cerevisiae) 1 1
MIRT688000 GTF2IRD2 GTF2I repeat domain containing 2 1 1
MIRT688140 GEMIN8 gem (nuclear organelle) associated protein 8 1 1
MIRT688234 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT688292 FAM213A family with sequence similarity 213, member A 1 1
MIRT688474 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT688523 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT688683 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT688847 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT689129 ZBTB25 zinc finger and BTB domain containing 25 1 1
MIRT689191 ZNF665 zinc finger protein 665 1 1
MIRT689816 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT689861 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT690756 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT691001 ZNF578 zinc finger protein 578 1 1
MIRT691093 NUGGC nuclear GTPase, germinal center associated 1 1
MIRT691350 KIAA1841 KIAA1841 1 1
MIRT691513 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT691595 CCDC125 coiled-coil domain containing 125 1 1
MIRT691631 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT692091 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT692128 CXorf38 chromosome X open reading frame 38 1 2
MIRT692337 RFK riboflavin kinase 1 1
MIRT692399 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT692460 METTL8 methyltransferase like 8 1 1
MIRT692563 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT692624 GDF5OS growth differentiation factor 5 opposite strand 1 1
MIRT692805 SYNPO2L synaptopodin 2-like 1 1
MIRT692836 C1orf50 chromosome 1 open reading frame 50 1 1
MIRT692898 RBM41 RNA binding motif protein 41 1 1
MIRT693008 LGSN lengsin, lens protein with glutamine synthetase domain 1 1
MIRT693158 THEM4 thioesterase superfamily member 4 1 1
MIRT693369 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT694130 ZNF446 zinc finger protein 446 1 1
MIRT694214 ZNF347 zinc finger protein 347 1 1
MIRT694680 C14orf119 chromosome 14 open reading frame 119 1 1
MIRT694834 STX4 syntaxin 4 1 1
MIRT694956 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 1 1
MIRT695200 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT695682 MAN2B2 mannosidase, alpha, class 2B, member 2 1 1
MIRT695853 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT695945 ZNF174 zinc finger protein 174 1 1
MIRT696203 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT696464 SUGP1 SURP and G patch domain containing 1 1 1
MIRT696880 UBOX5 U-box domain containing 5 1 1
MIRT696927 C14orf105 chromosome 14 open reading frame 105 1 1
MIRT697266 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697411 ZMAT3 zinc finger, matrin-type 3 1 1
MIRT698005 TSPAN6 tetraspanin 6 1 1
MIRT699291 SLC6A4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT699337 SLC35F5 solute carrier family 35, member F5 1 3
MIRT699654 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT699716 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT700065 RPL14 ribosomal protein L14 1 1
MIRT700123 RNF19B ring finger protein 19B 1 1
MIRT700446 PURB purine-rich element binding protein B 1 2
MIRT701131 PAPD5 PAP associated domain containing 5 1 1
MIRT701315 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT701597 MYPN myopalladin 1 1
MIRT702391 KLF10 Kruppel-like factor 10 1 1
MIRT702546 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT703112 GPRIN3 GPRIN family member 3 1 1
MIRT704131 DRAXIN dorsal inhibitory axon guidance protein 1 1
MIRT704162 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT704218 LDHD lactate dehydrogenase D 1 1
MIRT704784 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT705105 C4orf29 chromosome 4 open reading frame 29 1 1
MIRT705370 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT706121 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT706296 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT706332 CCDC30 coiled-coil domain containing 30 1 1
MIRT706372 STAC2 SH3 and cysteine rich domain 2 1 1
MIRT706424 HAS2 hyaluronan synthase 2 1 1
MIRT706535 MTMR9 myotubularin related protein 9 1 1
MIRT707609 PCNXL2 pecanex-like 2 (Drosophila) 1 1
MIRT707837 TMEM133 transmembrane protein 133 1 1
MIRT708391 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT708470 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 1
MIRT709093 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT709558 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT710426 YTHDC1 YTH domain containing 1 1 1
MIRT711790 RFXAP regulatory factor X-associated protein 1 1
MIRT713355 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT714327 ZNF454 zinc finger protein 454 1 1
MIRT716561 GOLGA2 golgin A2 1 1
MIRT719092 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
MIRT725228 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT726011 ZNF800 zinc finger protein 800 1 1
MIRT726015 ZNF770 zinc finger protein 770 1 1
MIRT726031 ZNF597 zinc finger protein 597 1 1
MIRT726035 ZNF280C zinc finger protein 280C 1 1
MIRT726038 ZNF280B zinc finger protein 280B 1 1
MIRT726080 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT726102 WDR89 WD repeat domain 89 1 1
MIRT726109 WDR1 WD repeat domain 1 1 1
MIRT726116 VTI1A vesicle transport through interaction with t-SNAREs homolog 1A (yeast) 1 1
MIRT726136 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT726140 VDAC1 voltage-dependent anion channel 1 1 1
MIRT726154 UXS1 UDP-glucuronate decarboxylase 1 1 1
MIRT726170 USP28 ubiquitin specific peptidase 28 1 1
MIRT726174 USP16 ubiquitin specific peptidase 16 1 1
MIRT726187 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT726202 UBC ubiquitin C 1 1
MIRT726214 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 1
MIRT726249 TOPORS topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase 1 1
MIRT726269 TMX3 thioredoxin-related transmembrane protein 3 1 1
MIRT726283 TMEM67 transmembrane protein 67 1 1
MIRT726303 TMEM167A transmembrane protein 167A 1 1
MIRT726310 TMEM123 transmembrane protein 123 1 1
MIRT726329 TGOLN2 trans-golgi network protein 2 1 1
MIRT726345 TCF4 transcription factor 4 1 1
MIRT726404 TADA2B transcriptional adaptor 2B 1 1
MIRT726413 STX6 syntaxin 6 1 1
MIRT726427 STK17B serine/threonine kinase 17b 1 1
MIRT726445 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT726450 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT726498 SLK STE20-like kinase 1 1
MIRT726526 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT726560 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT726575 SIKE1 suppressor of IKBKE 1 1 1
MIRT726608 PEAK1 NKF3 kinase family member 1 1
MIRT726636 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT726644 SEC23A Sec23 homolog A (S. cerevisiae) 1 1
MIRT726648 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT726661 SAMD9L sterile alpha motif domain containing 9-like 1 1
MIRT726670 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT726689 RPL17 ribosomal protein L17 1 1
MIRT726697 RPA2 replication protein A2, 32kDa 1 1
MIRT726728 RNF216 ring finger protein 216 1 1
MIRT726753 RFXANK regulatory factor X-associated ankyrin-containing protein 1 1
MIRT726781 RBBP7 retinoblastoma binding protein 7 1 1
MIRT726805 RABEP1 rabaptin, RAB GTPase binding effector protein 1 1 1
MIRT726816 RAB30 RAB30, member RAS oncogene family 1 1
MIRT726836 PTGES3 prostaglandin E synthase 3 (cytosolic) 1 1
MIRT726839 PTGER4 prostaglandin E receptor 4 (subtype EP4) 1 1
MIRT726871 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT726877 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT726884 PPP1R3B protein phosphatase 1, regulatory subunit 3B 1 1
MIRT726906 POLQ polymerase (DNA directed), theta 1 1
MIRT726914 PNPLA4 patatin-like phospholipase domain containing 4 1 1
MIRT726925 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT726928 PKMYT1 protein kinase, membrane associated tyrosine/threonine 1 1 1
MIRT726935 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT726948 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT726953 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT726962 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT726987 PDZD11 PDZ domain containing 11 1 1
MIRT726993 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 1
MIRT727018 PANK3 pantothenate kinase 3 1 1
MIRT727046 ORMDL3 ORM1-like 3 (S. cerevisiae) 1 1
MIRT727051 NUP98 nucleoporin 98kDa 1 1
MIRT727055 NUP35 nucleoporin 35kDa 1 1
MIRT727103 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT727107 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT727117 N4BP1 NEDD4 binding protein 1 1 1
MIRT727129 MXI1 MAX interactor 1 1 1
MIRT727173 MLXIP MLX interacting protein 1 1
MIRT727187 MKRN1 makorin ring finger protein 1 1 1
MIRT727236 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT727256 MAP3K14 mitogen-activated protein kinase kinase kinase 14 1 1
MIRT727275 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT727328 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT727338 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT727364 CCSER2 family with sequence similarity 190, member B 1 1
MIRT727369 ATG14 autophagy related 14 1 1
MIRT727415 ITPKB inositol-trisphosphate 3-kinase B 1 1
MIRT727420 ITCH itchy E3 ubiquitin protein ligase 1 1
MIRT727430 IQSEC1 IQ motif and Sec7 domain 1 1 1
MIRT727444 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT727473 IER3 immediate early response 3 1 1
MIRT727499 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT727516 HCP5 HLA complex P5 (non-protein coding) 1 1
MIRT727534 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT727554 GOLGA1 golgin A1 1 1
MIRT727601 GBP3 guanylate binding protein 3 1 1
MIRT727611 GAK cyclin G associated kinase 1 1
MIRT727615 GABBR1 gamma-aminobutyric acid (GABA) B receptor, 1 1 1
MIRT727628 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT727640 FTSJD1 FtsJ methyltransferase domain containing 1 1 1
MIRT727654 FMNL3 formin-like 3 1 1
MIRT727666 FBXO48 F-box protein 48 1 1
MIRT727674 FBXO21 F-box protein 21 1 1
MIRT727684 FBXO10 F-box protein 10 1 1
MIRT727695 FAM83D family with sequence similarity 83, member D 1 1
MIRT727708 FAM57A family with sequence similarity 57, member A 1 1
MIRT727731 FAM102A family with sequence similarity 102, member A 1 1
MIRT727735 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT727744 ETF1 eukaryotic translation termination factor 1 1 1
MIRT727750 ERAP1 endoplasmic reticulum aminopeptidase 1 1 1
MIRT727771 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT727784 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT727805 EEA1 early endosome antigen 1 1 1
MIRT727822 E2F2 E2F transcription factor 2 1 1
MIRT727842 DUSP18 dual specificity phosphatase 18 1 1
MIRT727883 DENND5B DENN/MADD domain containing 5B 1 1
MIRT727888 DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 1 1
MIRT727896 DDHD1 DDHD domain containing 1 1 1
MIRT727921 CTSS cathepsin S 1 1
MIRT727928 CRTC3 CREB regulated transcription coactivator 3 1 1
MIRT727949 CPOX coproporphyrinogen oxidase 1 1
MIRT727970 CNOT7 CCR4-NOT transcription complex, subunit 7 1 1
MIRT727975 CLOCK clock homolog (mouse) 1 1
MIRT727989 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT727995 CHURC1 churchill domain containing 1 1 1
MIRT728026 CD47 CD47 molecule 1 1
MIRT728053 CAMK2N2 calcium/calmodulin-dependent protein kinase II inhibitor 2 1 1
MIRT728057 TMEM245 transmembrane protein 245 1 1
MIRT728074 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT728083 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT728095 C5orf28 chromosome 5 open reading frame 28 1 1
MIRT728109 PRR14L proline rich 14-like 1 1
MIRT728120 C1orf63 chromosome 1 open reading frame 63 1 1
MIRT728142 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT728145 C14orf28 chromosome 14 open reading frame 28 1 1
MIRT728152 METTL21D methyltransferase like 21D 1 1
MIRT728175 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT728186 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT728228 BAGE5 B melanoma antigen family, member 5 1 1
MIRT728259 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT728281 ATG2B autophagy related 2B 1 1
MIRT728286 ATG2A autophagy related 2A 1 1
MIRT728313 ARL1 ADP-ribosylation factor-like 1 1 1
MIRT728322 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT728337 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 1
MIRT728340 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT728351 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT728364 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT728367 AKTIP AKT interacting protein 1 1
MIRT728404 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT728408 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT728416 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT728421 AAK1 AP2 associated kinase 1 1 1
Error report submission
Your e-Mail*