Accession ID: MIRT005631 [miRNA, hsa-miR-20a-5p :: SMAD4, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-20aLinkOut: [miRBase ]
Synonyms MIR20, MIRN20, MIRN20A, hsa-mir-20, hsa-mir-20a, miR-20, miRNA20A, MIR20A
Description Homo sapiens miR-20a stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-20a-5p
Evidence Experimental
Experiments Cloned
Putative hsa-miR-20a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SMAD4 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DPC4, JIP, MADH4, MYHRS
Description SMAD family member 4
Transcript NM_005359    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SMAD4 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SMAD4
(miRNA target sites are highlighted)
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             ::| : || |  ||||||| 
1355 - 1376 143.00 -7.25
              :|||  ||| ||  :|||:||| 
3607 - 3633 143.00 -12.70
            :||| | || | ||||:||| 
4353 - 4373 143.00 -12.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-20a-5p :: SMAD4    [ Functional MTI ]
Validation Method
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-20a-5p :: SMAD4    [ Functional MTI ]
Validation Method Microarray , Other
Conditions DLD1
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Interestingly, all miR-17a~92 mimics tested decreased Smad4 mRNA levels, but this downregulation was most profound with miR-18a (Fig. 4C). In the human Smad4 3′-UTR, TargetScan predicts binding sites for miR-17 and miR-19 as well as miR-18a. To determine whether any of these were bona fide target sites, we constructed six sets of psiCHECK2-based sensor plasmids as described above. DLD1 Dicer hypo cells were transfected with these constructs and also control or cognate mimics. The results in Fig. 4D show that of the three sequences tested, only the miR-18a homology region is a bona fide binding site. ...

- Dews, M. Fox, J. L. Hultine, S. Sundaram, et al., 2010, Cancer Res.

Article - Dews, M. Fox, J. L. Hultine, S. Sundaram, et al.
- Cancer Res, 2010
c-Myc stimulates angiogenesis in tumors through mechanisms that remain incompletely understood. Recent work indicates that c-Myc upregulates the miR-17 approximately 92 microRNA cluster and downregulates the angiogenesis inhibitor thrombospondin-1, along with other members of the thrombospondin type 1 repeat superfamily. Here, we show that downregulation of the thrombospondin type 1 repeat protein clusterin in cells overexpressing c-Myc and miR-17 approximately 92 promotes angiogenesis and tumor growth. However, clusterin downregulation by miR-17 approximately 92 is indirect. It occurs as a result of reduced transforming growth factor-beta (TGFbeta) signaling caused by targeting of several regulatory components in this signaling pathway. Specifically, miR-17-5p and miR-20 reduce the expression of the type II TGFbeta receptor and miR-18 limits the expression of Smad4. Supporting these results, in human cancer cell lines, levels of the miR-17 approximately 92 primary transcript MIR17HG negatively correlate with those of many TGFbeta-induced genes that are not direct targets of miR-17 approximately 92 (e.g., clusterin and angiopoietin-like 4). Furthermore, enforced expression of miR-17 approximately 92 in MIR17HG(low) cell lines (e.g., glioblastoma) results in impaired gene activation by TGFbeta. Together, our results define a pathway in which c-Myc activation of miR-17 approximately 92 attenuates the TGFbeta signaling pathway to shut down clusterin expression, thereby stimulating angiogenesis and tumor cell growth.
LinkOut: [PMID: 20940405]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-20a-5p :: SMAD4    [ Functional MTI ]
Validation Method
Article - Memczak, S. Jens, M. Elefsinioti, A. Torti, et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000398417.2 | 3UTR | AUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000398417.2 | 3UTR | AUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000398417.2 | 3UTR | AUUUUUAAGAUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000398417.2 | 3UTR | AUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000398417.2 | 3UTR | AUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000398417.2 | 3UTR | AUUUUUUUUUUCUUUUGCACUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

MiRNA-Target Expression Profile(TCGA):

MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1040 hsa-miR-20a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000002 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 5 4
MIRT000178 TCEAL1 transcription elongation factor A (SII)-like 1 5 2
MIRT000179 CCND1 cyclin D1 5 10
MIRT000180 E2F1 E2F transcription factor 1 6 7
MIRT000181 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 5 2
MIRT000597 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 5 5
MIRT001785 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 6 8
MIRT003010 MAP3K12 mitogen-activated protein kinase kinase kinase 12 2 1
MIRT003011 BCL2 B-cell CLL/lymphoma 2 2 1
MIRT003012 MEF2D myocyte enhancer factor 2D 2 1
MIRT003369 PTEN phosphatase and tensin homolog 5 3
MIRT003382 APP amyloid beta (A4) precursor protein 4 2
MIRT003742 RUNX1 runt-related transcription factor 1 4 1
MIRT003903 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 2 1
MIRT004450 VEGFA vascular endothelial growth factor A 2 1
MIRT004570 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 6
MIRT004711 MUC17 mucin 17, cell surface associated 3 1
MIRT005289 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 2
MIRT005481 BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 4 6
MIRT005627 THBS1 thrombospondin 1 3 1
MIRT005631 SMAD4 SMAD family member 4 3 4
MIRT005854 CCND2 cyclin D2 1 1
MIRT005855 E2F3 E2F transcription factor 3 2 2
MIRT005856 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT005857 RB1 retinoblastoma 1 2 2
MIRT005858 RBL1 retinoblastoma-like 1 (p107) 1 1
MIRT005859 RBL2 retinoblastoma-like 2 (p130) 2 2
MIRT005860 WEE1 WEE1 homolog (S. pombe) 2 3
MIRT006178 IRF2 interferon regulatory factor 2 4 1
MIRT006180 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 4 1
MIRT006289 EGLN3 egl nine homolog 3 (C. elegans) 3 2
MIRT006612 Tgfbr2 transforming growth factor, beta receptor II 3 1
MIRT006754 PPARG peroxisome proliferator-activated receptor gamma 1 1
MIRT006755 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT006756 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 1
MIRT006772 MAP2K3 mitogen-activated protein kinase kinase 3 1 1
MIRT007002 PURA purine-rich element binding protein A 1 1
MIRT031080 IL8 interleukin 8 1 1
MIRT031081 JAK1 Janus kinase 1 2 2
MIRT031082 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT031083 TSG101 tumor susceptibility gene 101 2 4
MIRT035531 SIRPA signal-regulatory protein alpha 1 1
MIRT050476 PHF8 PHD finger protein 8 1 1
MIRT050477 GPATCH11 coiled-coil domain containing 75 1 1
MIRT050478 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT050479 ATP8B2 ATPase, aminophospholipid transporter, class I, type 8B, member 2 1 1
MIRT050480 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 1 1
MIRT050481 INSIG1 insulin induced gene 1 1 1
MIRT050482 RTN2 reticulon 2 1 2
MIRT050483 TCEA1 transcription elongation factor A (SII), 1 1 1
MIRT050484 PLEKHM3 pleckstrin homology domain containing, family M, member 3 1 1
MIRT050485 RPS10 ribosomal protein S10 1 1
MIRT050486 ALDH18A1 aldehyde dehydrogenase 18 family, member A1 1 1
MIRT050487 UEVLD UEV and lactate/malate dehyrogenase domains 1 1
MIRT050488 FGF7 fibroblast growth factor 7 1 1
MIRT050489 SSRP1 structure specific recognition protein 1 1 1
MIRT050490 COX5A cytochrome c oxidase subunit Va 1 1
MIRT050491 AGO1 eukaryotic translation initiation factor 2C, 1 1 2
MIRT050492 KIAA0100 KIAA0100 1 1
MIRT050493 FHL3 four and a half LIM domains 3 1 1
MIRT050494 GDI2 GDP dissociation inhibitor 2 1 1
MIRT050495 INTS3 integrator complex subunit 3 1 1
MIRT050496 HMG20A high mobility group 20A 1 1
MIRT050497 APOA1BP apolipoprotein A-I binding protein 1 1
MIRT050498 PRKD3 protein kinase D3 1 1
MIRT050499 AP3S2 adaptor-related protein complex 3, sigma 2 subunit 1 1
MIRT050500 PCNXL4 pecanex-like 4 (Drosophila) 1 1
MIRT050501 IKZF5 IKAROS family zinc finger 5 (Pegasus) 1 1
MIRT050502 TMEM97 transmembrane protein 97 1 1
MIRT050503 ATP6 ATP synthase F0 subunit 6 1 1
MIRT050504 RPA2 replication protein A2, 32kDa 1 2
MIRT050505 PHYH phytanoyl-CoA 2-hydroxylase 1 1
MIRT050506 KIF2C kinesin family member 2C 1 1
MIRT050507 DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 1 2
MIRT050508 DTX2 deltex homolog 2 (Drosophila) 1 1
MIRT050509 MPHOSPH8 M-phase phosphoprotein 8 1 1
MIRT050510 HAUS2 HAUS augmin-like complex, subunit 2 1 1
MIRT050511 ZNF331 zinc finger protein 331 1 1
MIRT050512 PPP6R3 protein phosphatase 6, regulatory subunit 3 1 2
MIRT050513 METTL22 methyltransferase like 22 1 1
MIRT050514 PPAN peter pan homolog (Drosophila) 1 1
MIRT050515 FBL fibrillarin 1 1
MIRT050516 RPL31 ribosomal protein L31 1 1
MIRT050517 SEPT2 septin 2 1 4
MIRT050518 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT050519 NCOR2 nuclear receptor corepressor 2 1 1
MIRT050520 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT050521 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT050522 TBC1D15 TBC1 domain family, member 15 1 1
MIRT050523 DPY19L4 dpy-19-like 4 (C. elegans) 1 1
MIRT050524 PTPN23 protein tyrosine phosphatase, non-receptor type 23 1 1
MIRT050525 C11orf68 chromosome 11 open reading frame 68 1 1
MIRT050526 CTR9 Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT050527 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT050528 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 1
MIRT050529 CDT1 chromatin licensing and DNA replication factor 1 1 1
MIRT050530 RPL30 ribosomal protein L30 1 1
MIRT050531 MRS2 MRS2 magnesium homeostasis factor homolog (S. cerevisiae) 1 1
MIRT050532 TMX4 thioredoxin-related transmembrane protein 4 1 1
MIRT050533 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 1 4
MIRT050534 LPHN3 latrophilin 3 1 1
MIRT050535 RBM10 RNA binding motif protein 10 1 1
MIRT050536 EMR2 egf-like module containing, mucin-like, hormone receptor-like 2 1 1
MIRT050537 FBXO3 F-box protein 3 1 1
MIRT050538 MLXIP MLX interacting protein 1 2
MIRT050539 RNGTT RNA guanylyltransferase and 5'-phosphatase 1 1
MIRT050540 MAD1L1 MAD1 mitotic arrest deficient-like 1 (yeast) 1 1
MIRT050541 DLC1 deleted in liver cancer 1 1 1
MIRT050542 NUP214 nucleoporin 214kDa 1 1
MIRT050543 PAQR5 progestin and adipoQ receptor family member V 1 1
MIRT050544 BTBD2 BTB (POZ) domain containing 2 1 1
MIRT050545 XYLT2 xylosyltransferase II 1 1
MIRT050546 ZNF398 zinc finger protein 398 1 1
MIRT050547 CEP120 centrosomal protein 120kDa 1 1
MIRT050548 IL17RC interleukin 17 receptor C 1 1
MIRT050549 UBE2C ubiquitin-conjugating enzyme E2C 4 2
MIRT050550 PGK1 phosphoglycerate kinase 1 1 1
MIRT050551 ORMDL3 ORM1-like 3 (S. cerevisiae) 1 2
MIRT050552 TUBB tubulin, beta class I 1 1
MIRT050553 TDRD3 tudor domain containing 3 1 1
MIRT050554 DLG5 discs, large homolog 5 (Drosophila) 1 1
MIRT050555 VEZF1 vascular endothelial zinc finger 1 1 1
MIRT050556 CCDC88C coiled-coil domain containing 88C 1 1
MIRT050557 USP10 ubiquitin specific peptidase 10 1 1
MIRT050558 KIAA1191 KIAA1191 1 4
MIRT050559 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 5 4
MIRT050560 GATA6 GATA binding protein 6 1 5
MIRT050561 RPL18A ribosomal protein L18a 1 1
MIRT050562 TMEM66 transmembrane protein 66 1 1
MIRT050563 ARL9 ADP-ribosylation factor-like 9 1 1
MIRT050564 CTSA cathepsin A 1 1
MIRT050565 ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3 1 1
MIRT050566 MRPL13 mitochondrial ribosomal protein L13 1 1
MIRT050567 MAN1C1 mannosidase, alpha, class 1C, member 1 1 1
MIRT050568 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT050569 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT050570 RFC3 replication factor C (activator 1) 3, 38kDa 1 1
MIRT050571 ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7 1 2
MIRT050572 GPN2 GPN-loop GTPase 2 1 1
MIRT050573 LDHB lactate dehydrogenase B 1 1
MIRT050574 PTPRS protein tyrosine phosphatase, receptor type, S 1 1
MIRT050575 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT050576 CDK16 cyclin-dependent kinase 16 1 1
MIRT050577 WBP4 WW domain binding protein 4 1 1
MIRT050578 CCNB1 cyclin B1 1 1
MIRT050579 POGZ pogo transposable element with ZNF domain 1 1
MIRT050580 KLHL15 kelch-like 15 (Drosophila) 1 2
MIRT050581 RTFDC1 replication termination factor 2 domain containing 1 1 1
MIRT050582 FLNA filamin A, alpha 1 1
MIRT050583 PLXNA1 plexin A1 1 2
MIRT050584 ADSS adenylosuccinate synthase 1 1
MIRT050585 MANEAL mannosidase, endo-alpha-like 1 2
MIRT050586 NUP188 nucleoporin 188kDa 1 1
MIRT050587 ECI1 enoyl-CoA delta isomerase 1 1 1
MIRT050588 NCOA3 nuclear receptor coactivator 3 1 2
MIRT050589 MORF4L2 mortality factor 4 like 2 1 1
MIRT050590 ATL3 atlastin GTPase 3 1 3
MIRT050591 FOXJ3 forkhead box J3 1 3
MIRT050592 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT050593 RPL21 ribosomal protein L21 1 1
MIRT050594 SELENBP1 selenium binding protein 1 1 1
MIRT050595 YBX1 Y box binding protein 1 1 1
MIRT050596 B4GALT2 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 1 1
MIRT050597 PYGB phosphorylase, glycogen; brain 1 1
MIRT050598 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 2
MIRT050599 C9orf78 chromosome 9 open reading frame 78 1 1
MIRT050600 STIL SCL/TAL1 interrupting locus 1 1
MIRT050601 CDK19 cyclin-dependent kinase 19 1 1
MIRT050602 KDM4D lysine (K)-specific demethylase 4D 1 1
MIRT050603 UQCRC1 ubiquinol-cytochrome c reductase core protein I 1 1
MIRT050604 RUFY2 RUN and FYVE domain containing 2 1 2
MIRT050605 RPS27 ribosomal protein S27 1 1
MIRT050606 BTN3A1 butyrophilin, subfamily 3, member A1 1 2
MIRT050607 PBXIP1 pre-B-cell leukemia homeobox interacting protein 1 1 1
MIRT050608 ARFGEF2 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) 1 1
MIRT050609 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT050610 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 3
MIRT050611 SLC25A28 solute carrier family 25 (mitochondrial iron transporter), member 28 1 1
MIRT050612 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT050613 PHC1 polyhomeotic homolog 1 (Drosophila) 1 1
MIRT050614 ZNF706 zinc finger protein 706 1 1
MIRT050615 CCDC47 coiled-coil domain containing 47 1 1
MIRT050616 ARPC2 actin related protein 2/3 complex, subunit 2, 34kDa 1 1
MIRT050617 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 2
MIRT050618 MAGOHB mago-nashi homolog B (Drosophila) 1 1
MIRT050619 ZNF598 zinc finger protein 598 1 1
MIRT050620 LEPREL4 leprecan-like 4 1 1
MIRT050621 CERS2 ceramide synthase 2 1 1
MIRT050622 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT050623 HEXIM1 hexamethylene bis-acetamide inducible 1 1 1
MIRT050624 WAC WW domain containing adaptor with coiled-coil 1 4
MIRT050625 ZNFX1 zinc finger, NFX1-type containing 1 1 4
MIRT050626 RBM12B RNA binding motif protein 12B 1 3
MIRT052914 LIMK1 LIM domain kinase 1 4 1
MIRT052971 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT053007 GJA1 gap junction protein, alpha 1, 43kDa 3 1
MIRT053023 DUSP2 dual specificity phosphatase 2 4 3
MIRT053109 ITGB8 integrin, beta 8 2 1
MIRT053159 SMAD7 SMAD family member 7 3 1
MIRT053208 MAP3K5 mitogen-activated protein kinase kinase kinase 5 3 1
MIRT053332 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 4 2
MIRT053505 TP53INP1 tumor protein p53 inducible nuclear protein 1 4 2
MIRT053563 EGR2 early growth response 2 3 1
MIRT054860 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 3 1
MIRT055020 TPRG1L tumor protein p63 regulated 1-like 1 2
MIRT055382 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 3
MIRT055649 WDR37 WD repeat domain 37 1 1
MIRT056476 PFKP phosphofructokinase, platelet 1 5
MIRT056811 REEP3 receptor accessory protein 3 1 2
MIRT057384 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 2
MIRT057822 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT058912 FAM46C family with sequence similarity 46, member C 1 1
MIRT059186 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT060075 TMEM138 transmembrane protein 138 1 1
MIRT060678 KLHL20 kelch-like 20 (Drosophila) 1 1
MIRT061181 MED17 mediator complex subunit 17 1 2
MIRT061789 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 5
MIRT063054 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT063434 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT064435 GPR137B G protein-coupled receptor 137B 1 2
MIRT064797 ZBTB18 zinc finger protein 238 1 2
MIRT065364 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT065670 ACVR1B activin A receptor, type IB 1 3
MIRT065858 GDF11 growth differentiation factor 11 1 1
MIRT065886 RAB5B RAB5B, member RAS oncogene family 1 5
MIRT067229 FOXJ2 forkhead box J2 1 1
MIRT068492 NHLRC3 NHL repeat containing 3 1 1
MIRT070839 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 2
MIRT070995 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT071324 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT071903 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT072247 B2M beta-2-microglobulin 1 5
MIRT072567 USP3 ubiquitin specific peptidase 3 1 1
MIRT073117 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT073374 ABHD2 abhydrolase domain containing 2 1 1
MIRT073407 SEMA4B sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B 1 1
MIRT074789 CYLD cylindromatosis (turban tumor syndrome) 1 1
MIRT074891 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT075775 KIAA0513 KIAA0513 1 3
MIRT076177 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 3
MIRT077064 KRT10 keratin 10 1 4
MIRT077831 MINK1 misshapen-like kinase 1 1 2
MIRT078811 UNK unkempt homolog (Drosophila) 1 1
MIRT079344 CCDC137 coiled-coil domain containing 137 1 2
MIRT079411 FOXK2 forkhead box K2 1 3
MIRT079772 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT080178 PRKACB protein kinase, cAMP-dependent, catalytic, beta 1 1
MIRT080848 RAB12 RAB12, member RAS oncogene family 1 1
MIRT081117 LDLR low density lipoprotein receptor 1 5
MIRT081198 MIDN midnolin 1 6
MIRT081981 GRAMD1A GRAM domain containing 1A 1 1
MIRT082290 FNBP1L formin binding protein 1-like 1 3
MIRT083739 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT083960 RAB22A RAB22A, member RAS oncogene family 1 3
MIRT084344 RRM2 ribonucleotide reductase M2 1 2
MIRT085173 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 2
MIRT085375 SPOPL speckle-type POZ protein-like 1 1
MIRT085867 TANC1 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 1 1
MIRT086425 NABP1 nucleic acid binding protein 1 1 4
MIRT087604 ATG16L1 autophagy related 16-like 1 (S. cerevisiae) 1 1
MIRT088033 UBXN2A UBX domain protein 2A 1 2
MIRT088337 MAPRE3 microtubule-associated protein, RP/EB family, member 3 1 4
MIRT090633 U2SURP U2 snRNP-associated SURP domain containing 1 4
MIRT092685 C3ORF38 chromosome 3 open reading frame 38 1 4
MIRT093800 KLF3 Kruppel-like factor 3 (basic) 1 1
MIRT093941 SLAIN2 SLAIN motif family, member 2 1 1
MIRT095200 SMAD5 SMAD family member 5 1 1
MIRT095719 ANKH ankylosis, progressive homolog (mouse) 1 4
MIRT095997 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT096308 SQSTM1 sequestosome 1 1 1
MIRT097128 FCHO2 FCH domain only 2 1 2
MIRT097603 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 1 1
MIRT097649 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT099308 QKI QKI, KH domain containing, RNA binding 1 2
MIRT099355 C6ORF120 chromosome 6 open reading frame 120 1 1
MIRT099824 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT100277 MICB MHC class I polypeptide-related sequence B 1 1
MIRT100454 ZBTB9 zinc finger and BTB domain containing 9 1 1
MIRT100945 CENPQ centromere protein Q 1 2
MIRT102221 HBP1 HMG-box transcription factor 1 1 2
MIRT102294 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 5
MIRT103189 SP4 Sp4 transcription factor 1 3
MIRT104161 PHTF2 putative homeodomain transcription factor 2 1 3
MIRT104394 ANKIB1 ankyrin repeat and IBR domain containing 1 1 1
MIRT108651 ZBTB33 zinc finger and BTB domain containing 33 1 3
MIRT108719 XIAP X-linked inhibitor of apoptosis 1 1
MIRT110266 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT112089 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 3
MIRT115779 CAPN15 small optic lobes homolog (Drosophila) 1 1
MIRT121800 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT122363 RGMB RGM domain family, member B 1 2
MIRT124125 GINS4 GINS complex subunit 4 (Sld5 homolog) 1 2
MIRT125725 TRIM8 tripartite motif containing 8 1 1
MIRT126308 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT126344 ZRANB1 zinc finger, RAN-binding domain containing 1 1 1
MIRT126550 MASTL microtubule associated serine/threonine kinase-like 1 2
MIRT127161 VPS26A vacuolar protein sorting 26 homolog A (S. pombe) 1 1
MIRT129131 ARCN1 archain 1 1 1
MIRT130070 TXNIP thioredoxin interacting protein 1 3
MIRT132394 PPP1R12B protein phosphatase 1, regulatory subunit 12B 1 1
MIRT133313 ORAI1 ORAI calcium release-activated calcium modulator 1 1 1
MIRT134275 DNM1L dynamin 1-like 1 1
MIRT135706 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase, type II, gamma 1 1
MIRT135793 GNS glucosamine (N-acetyl)-6-sulfatase 1 4
MIRT136562 TXLNA taxilin alpha 1 1
MIRT138110 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT138348 FRMD6 FERM domain containing 6 1 1
MIRT138792 SUSD6 KIAA0247 1 1
MIRT140626 PLEKHO2 pleckstrin homology domain containing, family O member 2 1 1
MIRT140794 SMAD6 SMAD family member 6 1 1
MIRT141126 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141698 RCCD1 RCC1 domain containing 1 1 1
MIRT142095 CCP110 centriolar coiled coil protein 110kDa 1 1
MIRT142381 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT144207 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT144294 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 5
MIRT144978 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT145019 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 1 1
MIRT145597 LASP1 LIM and SH3 protein 1 1 2
MIRT146071 RUNDC1 RUN domain containing 1 1 1
MIRT147118 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT147273 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 6
MIRT147921 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT148868 ANKRD12 ankyrin repeat domain 12 1 1
MIRT151690 CHAF1A chromatin assembly factor 1, subunit A (p150) 1 1
MIRT151799 BLOC1S3 biogenesis of lysosomal organelles complex-1, subunit 3 1 1
MIRT151853 ARHGAP35 Rho GTPase activating protein 35 1 1
MIRT151932 TBC1D17 TBC1 domain family, member 17 1 1
MIRT152367 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT152673 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT153327 MAVS mitochondrial antiviral signaling protein 1 2
MIRT153454 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT153969 PRNP prion protein 1 2
MIRT155231 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT155333 IFNAR1 interferon (alpha, beta and omega) receptor 1 1 1
MIRT155886 SIK1 salt-inducible kinase 1 1 1
MIRT156404 RAPGEF4 Rap guanine nucleotide exchange factor (GEF) 4 1 1
MIRT156640 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT157145 FAM117B family with sequence similarity 117, member B 1 1
MIRT157585 MTMR3 myotubularin related protein 3 1 1
MIRT158288 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT158573 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT159105 NRBP1 nuclear receptor binding protein 1 1 2
MIRT159399 FEZ2 fasciculation and elongation protein zeta 2 (zygin II) 1 1
MIRT160004 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT164198 GAB1 GRB2-associated binding protein 1 1 1
MIRT164524 MSMO1 methylsterol monooxygenase 1 1 2
MIRT164659 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT164720 ADD1 adducin 1 (alpha) 1 1
MIRT166062 FAF2 Fas associated factor family member 2 1 1
MIRT167840 HECA headcase homolog (Drosophila) 1 1
MIRT168216 BTN3A2 butyrophilin, subfamily 3, member A2 1 1
MIRT169663 AGFG2 ArfGAP with FG repeats 2 1 1
MIRT170564 CASP2 caspase 2, apoptosis-related cysteine peptidase 1 1
MIRT170849 TAX1BP1 Tax1 (human T-cell leukemia virus type I) binding protein 1 1 3
MIRT172197 OXR1 oxidation resistance 1 1 1
MIRT173112 E2F5 E2F transcription factor 5, p130-binding 1 1
MIRT173688 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT175379 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT175594 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT175644 PHF6 PHD finger protein 6 1 1
MIRT176079 CHIC1 cysteine-rich hydrophobic domain 1 1 1
MIRT178062 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT182517 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT187472 PCBP2 poly(rC) binding protein 2 1 2
MIRT188183 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT194849 UBFD1 ubiquitin family domain containing 1 1 1
MIRT199106 ZNF532 zinc finger protein 532 1 1
MIRT199283 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 1
MIRT200924 ZNF264 zinc finger protein 264 1 3
MIRT201019 ZNF805 zinc finger protein 805 1 1
MIRT205046 CREB1 cAMP responsive element binding protein 1 1 1
MIRT205281 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT206192 RAB10 RAB10, member RAS oncogene family 1 2
MIRT208975 SKIL SKI-like oncogene 1 5
MIRT213203 REST RE1-silencing transcription factor 1 1
MIRT213321 KIAA0232 KIAA0232 1 1
MIRT216423 SERF1A small EDRK-rich factor 1A (telomeric) 1 1
MIRT216448 SERF1B small EDRK-rich factor 1B (centromeric) 1 1
MIRT216661 F2R coagulation factor II (thrombin) receptor 1 1
MIRT220118 CAV1 caveolin 1, caveolae protein, 22kDa 1 1
MIRT222673 EIF4H eukaryotic translation initiation factor 4H 1 3
MIRT222908 CROT carnitine O-octanoyltransferase 1 1
MIRT224747 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT224885 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT227326 TRIM32 tripartite motif containing 32 1 1
MIRT230965 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT238172 ANKRD33B ankyrin repeat domain 33B 1 5
MIRT241294 ZC3H12C zinc finger CCCH-type containing 12C 1 4
MIRT242196 TTC9 tetratricopeptide repeat domain 9 1 2
MIRT242657 SALL3 sal-like 3 (Drosophila) 1 2
MIRT243778 AFF1 AF4/FMR2 family, member 1 1 1
MIRT244588 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT246959 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT247079 CEP57 centrosomal protein 57kDa 1 1
MIRT248850 SESN2 sestrin 2 1 1
MIRT250444 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT254248 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT257279 FOXC1 forkhead box C1 1 1
MIRT266048 FJX1 four jointed box 1 (Drosophila) 1 2
MIRT266853 SLC25A44 solute carrier family 25, member 44 1 1
MIRT280207 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT280991 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT283172 C16ORF52 chromosome 16 open reading frame 52 1 1
MIRT286945 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT289571 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT291931 TPM4 tropomyosin 4 1 1
MIRT293645 PVR poliovirus receptor 1 2
MIRT296868 REV1 REV1, polymerase (DNA directed) 1 1
MIRT299337 CYBRD1 cytochrome b reductase 1 1 1
MIRT302434 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT303488 NAGK N-acetylglucosamine kinase 1 3
MIRT322520 HMBOX1 homeobox containing 1 1 1
MIRT325510 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT363922 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT368882 BCL2L2 BCL2-like 2 1 1
MIRT397684 ATXN7L3B ataxin 7-like 3B 1 1
MIRT400046 ADRBK2 adrenergic, beta, receptor kinase 2 1 1
MIRT437765 PRKG1 protein kinase, cGMP-dependent, type I 3 1
MIRT437766 PRKG1 protein kinase, cGMP-dependent, type I 3 1
MIRT437767 PRKG1 protein kinase, cGMP-dependent, type I 3 1
MIRT437768 Prkg1 protein kinase, cGMP-dependent, type 1 3 1
MIRT437769 Prkg1 protein kinase, cGMP-dependent, type I 3 1
MIRT437944 RGS5 regulator of G-protein signaling 5 3 1
MIRT438054 ETV1 ets variant 1 4 1
MIRT438160 EPAS1 endothelial PAS domain protein 1 1 1
MIRT438351 FBXO31 F-box protein 31 4 2
MIRT438791 TP53 tumor protein p53 1 1
MIRT438806 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT438812 PKD1 polycystic kidney disease 1 (autosomal dominant) 1 1
MIRT439181 ZNF800 zinc finger protein 800 1 1
MIRT439185 ZNF770 zinc finger protein 770 1 1
MIRT439192 ZNF597 zinc finger protein 597 1 1
MIRT439211 ZNF280C zinc finger protein 280C 1 1
MIRT439214 ZNF280B zinc finger protein 280B 1 1
MIRT439225 ZNF12 zinc finger protein 12 1 4
MIRT439256 ZBTB7A zinc finger and BTB domain containing 7A 1 2
MIRT439257 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT439259 ZBTB4 zinc finger and BTB domain containing 4 1 4
MIRT439269 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 2
MIRT439286 WDR89 WD repeat domain 89 1 1
MIRT439291 WDR1 WD repeat domain 1 1 1
MIRT439295 VTI1A vesicle transport through interaction with t-SNAREs homolog 1A (yeast) 1 1
MIRT439300 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT439306 VDAC1 voltage-dependent anion channel 1 1 1
MIRT439319 UXS1 UDP-glucuronate decarboxylase 1 1 1
MIRT439327 USP32 ubiquitin specific peptidase 32 1 2
MIRT439332 USP28 ubiquitin specific peptidase 28 1 1
MIRT439337 USP16 ubiquitin specific peptidase 16 1 1
MIRT439349 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT439366 UBC ubiquitin C 1 1
MIRT439372 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 1
MIRT439399 TOPORS topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase 1 1
MIRT439410 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1 2
MIRT439416 TMX3 thioredoxin-related transmembrane protein 3 1 1
MIRT439423 TMEM67 transmembrane protein 67 1 1
MIRT439427 TMEM64 transmembrane protein 64 1 2
MIRT439435 TMEM167A transmembrane protein 167A 1 1
MIRT439439 TMEM127 transmembrane protein 127 1 5
MIRT439440 TMEM123 transmembrane protein 123 1 1
MIRT439460 TGOLN2 trans-golgi network protein 2 1 1
MIRT439478 TCF4 transcription factor 4 1 1
MIRT439489 TADA2B transcriptional adaptor 2B 1 1
MIRT439512 STX6 syntaxin 6 1 1
MIRT439521 STK17B serine/threonine kinase 17b 1 1
MIRT439535 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT439537 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT439566 SOD2 superoxide dismutase 2, mitochondrial 1 2
MIRT439590 SLK STE20-like kinase 1 1
MIRT439594 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT439606 SLC35F5 solute carrier family 35, member F5 1 3
MIRT439620 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT439633 SIKE1 suppressor of IKBKE 1 1 1
MIRT439644 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 2
MIRT439648 PEAK1 NKF3 kinase family member 1 1
MIRT439654 SRSF2 serine/arginine-rich splicing factor 2 1 3
MIRT439680 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT439688 SEC23A Sec23 homolog A (S. cerevisiae) 1 1
MIRT439692 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT439703 SCAMP2 secretory carrier membrane protein 2 1 2
MIRT439711 SAMD9L sterile alpha motif domain containing 9-like 1 1
MIRT439715 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT439742 RPL17 ribosomal protein L17 1 1
MIRT439758 RNF216 ring finger protein 216 1 1
MIRT439776 RFXANK regulatory factor X-associated ankyrin-containing protein 1 1
MIRT439786 REEP5 receptor accessory protein 5 1 1
MIRT439809 RBBP7 retinoblastoma binding protein 7 1 1
MIRT439821 RAN RAN, member RAS oncogene family 1 5
MIRT439832 RABEP1 rabaptin, RAB GTPase binding effector protein 1 1 1
MIRT439837 RAB30 RAB30, member RAS oncogene family 1 1
MIRT439848 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 3
MIRT439853 PURB purine-rich element binding protein B 1 2
MIRT439863 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 5
MIRT439874 PTGES3 prostaglandin E synthase 3 (cytosolic) 1 1
MIRT439875 PTGER4 prostaglandin E receptor 4 (subtype EP4) 1 1
MIRT439905 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT439910 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT439915 PPP1R3B protein phosphatase 1, regulatory subunit 3B 1 1
MIRT439933 POLQ polymerase (DNA directed), theta 1 1
MIRT439940 PNPLA4 patatin-like phospholipase domain containing 4 1 1
MIRT439954 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT439959 PKMYT1 protein kinase, membrane associated tyrosine/threonine 1 1 1
MIRT439971 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT439977 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT439991 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT440006 PDZD11 PDZ domain containing 11 1 1
MIRT440025 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 1
MIRT440046 PANK3 pantothenate kinase 3 1 1
MIRT440068 NUP98 nucleoporin 98kDa 1 1
MIRT440072 NUP35 nucleoporin 35kDa 1 1
MIRT440093 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 4
MIRT440099 NPAT nuclear protein, ataxia-telangiectasia locus 1 2
MIRT440112 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 3
MIRT440138 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT440145 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT440158 N4BP1 NEDD4 binding protein 1 1 1
MIRT440170 MXI1 MAX interactor 1 1 1
MIRT440208 MTF1 metal-regulatory transcription factor 1 1 1
MIRT440233 MKRN1 makorin ring finger protein 1 1 1
MIRT440235 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 4
MIRT440260 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 2
MIRT440278 MAPK1 mitogen-activated protein kinase 1 1 3
MIRT440284 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 2
MIRT440286 MAP3K14 mitogen-activated protein kinase kinase kinase 14 1 1
MIRT440296 M6PR mannose-6-phosphate receptor (cation dependent) 1 5
MIRT440318 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT440325 LIMA1 LIM domain and actin binding 1 1 3
MIRT440340 LAPTM4A lysosomal protein transmembrane 4 alpha 1 7
MIRT440346 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT440357 KLHL28 kelch-like 28 (Drosophila) 1 5
MIRT440369 KIF23 kinesin family member 23 1 3
MIRT440386 CCSER2 family with sequence similarity 190, member B 1 1
MIRT440388 ATG14 autophagy related 14 1 1
MIRT440391 EFCAB14 KIAA0494 1 2
MIRT440410 KATNAL1 katanin p60 subunit A-like 1 1 2
MIRT440417 ITPKB inositol-trisphosphate 3-kinase B 1 1
MIRT440427 ITCH itchy E3 ubiquitin protein ligase 1 1
MIRT440430 IQSEC1 IQ motif and Sec7 domain 1 1 1
MIRT440451 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT440469 IER3 immediate early response 3 1 1
MIRT440506 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT440509 HAUS8 HAUS augmin-like complex, subunit 8 1 2
MIRT440520 HCP5 HLA complex P5 (non-protein coding) 1 1
MIRT440537 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT440543 GOLGA1 golgin A1 1 1
MIRT440557 GNAS GNAS complex locus 1 1
MIRT440561 GLO1 glyoxalase I 1 2
MIRT440573 GIGYF1 GRB10 interacting GYF protein 1 1 5
MIRT440583 GBP3 guanylate binding protein 3 1 1
MIRT440590 GAK cyclin G associated kinase 1 1
MIRT440593 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT440595 GABBR1 gamma-aminobutyric acid (GABA) B receptor, 1 1 1
MIRT440601 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT440609 FTSJD1 FtsJ methyltransferase domain containing 1 1 1
MIRT440633 FMNL3 formin-like 3 1 1
MIRT440646 FEM1C fem-1 homolog c (C. elegans) 1 5
MIRT440653 FBXO48 F-box protein 48 1 1
MIRT440657 FBXO21 F-box protein 21 1 1
MIRT440660 FBXO10 F-box protein 10 1 1
MIRT440662 FBXL5 F-box and leucine-rich repeat protein 5 1 7
MIRT440674 FAM83D family with sequence similarity 83, member D 1 1
MIRT440677 FAM57A family with sequence similarity 57, member A 1 1
MIRT440685 FAM129A family with sequence similarity 129, member A 1 4
MIRT440686 FAM126B family with sequence similarity 126, member B 1 2
MIRT440693 FAM102A family with sequence similarity 102, member A 1 1
MIRT440699 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT440703 ETF1 eukaryotic translation termination factor 1 1 1
MIRT440712 ERAP1 endoplasmic reticulum aminopeptidase 1 1 1
MIRT440720 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT440729 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT440752 EEA1 early endosome antigen 1 1 1
MIRT440755 E2F2 E2F transcription factor 2 1 1
MIRT440759 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 2
MIRT440767 DUSP18 dual specificity phosphatase 18 1 1
MIRT440797 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT440826 DENND5B DENN/MADD domain containing 5B 1 1
MIRT440840 DDHD1 DDHD domain containing 1 1 1
MIRT440857 CTSS cathepsin S 1 1
MIRT440873 CRTC3 CREB regulated transcription coactivator 3 1 1
MIRT440876 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 2
MIRT440886 CPOX coproporphyrinogen oxidase 1 1
MIRT440918 CNOT7 CCR4-NOT transcription complex, subunit 7 1 1
MIRT440933 CLOCK clock homolog (mouse) 1 1
MIRT440941 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT440943 CHURC1 churchill domain containing 1 1 1
MIRT440953 CFL2 cofilin 2 (muscle) 1 2
MIRT440954 CEP97 centrosomal protein 97kDa 1 2
MIRT440976 CD47 CD47 molecule 1 1
MIRT440986 CCL1 chemokine (C-C motif) ligand 1 1 1
MIRT441010 CAPRIN2 caprin family member 2 1 3
MIRT441022 CAMK2N2 calcium/calmodulin-dependent protein kinase II inhibitor 2 1 1
MIRT441030 TMEM245 transmembrane protein 245 1 1
MIRT441031 C9orf40 chromosome 9 open reading frame 40 1 4
MIRT441033 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT441036 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT441043 C5orf28 chromosome 5 open reading frame 28 1 1
MIRT441050 PRR14L proline rich 14-like 1 1
MIRT441055 SUCO SUN domain containing ossification factor 1 3
MIRT441057 C1orf63 chromosome 1 open reading frame 63 1 1
MIRT441073 FAM210A family with sequence similarity 210, member A 1 2
MIRT441080 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT441082 C14orf28 chromosome 14 open reading frame 28 1 1
MIRT441084 METTL21D methyltransferase like 21D 1 1
MIRT441088 C11orf30 chromosome 11 open reading frame 30 1 5
MIRT441094 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT441097 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT441126 BAGE5 B melanoma antigen family, member 5 1 1
MIRT441138 ATXN1 ataxin 1 1 2
MIRT441150 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT441164 ATG2B autophagy related 2B 1 1
MIRT441167 ATG2A autophagy related 2A 1 1
MIRT441187 ARL1 ADP-ribosylation factor-like 1 1 1
MIRT441189 ARID4B AT rich interactive domain 4B (RBP1-like) 1 3
MIRT441201 ARHGAP1 Rho GTPase activating protein 1 1 4
MIRT441213 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT441217 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 1
MIRT441223 ANKRD52 ankyrin repeat domain 52 1 2
MIRT441227 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT441232 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT441235 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT441239 AKTIP AKT interacting protein 1 1
MIRT441293 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT441296 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT441312 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT441316 AAK1 AP2 associated kinase 1 1 1
MIRT441880 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT442202 CCDC132 coiled-coil domain containing 132 1 1
MIRT442551 SLCO5A1 solute carrier organic anion transporter family, member 5A1 1 1
MIRT442768 NRIP3 nuclear receptor interacting protein 3 1 1
MIRT442802 CEP170 centrosomal protein 170kDa 1 2
MIRT443258 A1CF APOBEC1 complementation factor 1 1
MIRT443712 LLPH LLP homolog, long-term synaptic facilitation (Aplysia) 1 1
MIRT444311 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT444437 EMC1 ER membrane protein complex subunit 1 1 1
MIRT448315 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT448365 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 3
MIRT448645 NPNT nephronectin 1 1
MIRT448728 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT449173 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT450189 TMEM9B TMEM9 domain family, member B 1 1
MIRT450915 CADM2 cell adhesion molecule 2 1 1
MIRT450954 ATAD2 ATPase family, AAA domain containing 2 1 1
MIRT458293 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT463554 ZBTB5 zinc finger and BTB domain containing 5 1 2
MIRT464847 RPS27A ribosomal protein S27a 1 6
MIRT465236 TRIP10 thyroid hormone receptor interactor 10 1 1
MIRT465539 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT466455 TFAM transcription factor A, mitochondrial 1 4
MIRT467495 SMIM13 chromosome 6 open reading frame 228 1 3
MIRT467895 SLC22A23 solute carrier family 22, member 23 1 1
MIRT468161 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT468185 SGMS1 sphingomyelin synthase 1 1 1
MIRT469861 PXK PX domain containing serine/threonine kinase 1 4
MIRT470052 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT471004 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT472168 NIN ninein (GSK3B interacting protein) 1 2
MIRT472288 NFIB nuclear factor I/B 1 2
MIRT473167 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT474598 KLF6 Kruppel-like factor 6 1 1
MIRT475410 ICMT isoprenylcysteine carboxyl methyltransferase 1 2
MIRT475477 HSPA8 heat shock 70kDa protein 8 1 3
MIRT476130 GPR157 G protein-coupled receptor 157 1 3
MIRT477116 FAM160B1 family with sequence similarity 160, member B1 1 3
MIRT477193 F3 coagulation factor III (thromboplastin, tissue factor) 1 4
MIRT477286 ERGIC2 ERGIC and golgi 2 1 1
MIRT478722 CSNK1A1 casein kinase 1, alpha 1 1 2
MIRT479040 COIL coilin 1 5
MIRT479064 CNOT6L CCR4-NOT transcription complex, subunit 6-like 1 4
MIRT479268 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT480567 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT480676 BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) 1 1
MIRT480786 BMP2 bone morphogenetic protein 2 1 1
MIRT480953 BBX bobby sox homolog (Drosophila) 1 4
MIRT481882 ANKRD50 ankyrin repeat domain 50 1 1
MIRT482138 AKAP11 A kinase (PRKA) anchor protein 11 1 6
MIRT482477 ADAR adenosine deaminase, RNA-specific 1 2
MIRT484868 ZNF70 zinc finger protein 70 1 2
MIRT484885 ZNF652 zinc finger protein 652 1 1
MIRT484922 ZFYVE26 zinc finger, FYVE domain containing 26 1 2
MIRT485095 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 2
MIRT485193 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 2
MIRT485331 MYO1D myosin ID 1 1
MIRT485368 MYLIP myosin regulatory light chain interacting protein 1 6
MIRT485588 FOXQ1 forkhead box Q1 1 1
MIRT486029 LPAR2 lysophosphatidic acid receptor 2 1 1
MIRT486757 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT489607 ZDHHC20 zinc finger, DHHC-type containing 20 1 5
MIRT491660 PDRG1 p53 and DNA-damage regulated 1 1 5
MIRT491807 ZFYVE21 zinc finger, FYVE domain containing 21 1 4
MIRT492011 UGCG UDP-glucose ceramide glucosyltransferase 1 1
MIRT492377 SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) 1 1
MIRT492786 PDGFB platelet-derived growth factor beta polypeptide 1 1
MIRT493619 HMGB3 high mobility group box 3 1 3
MIRT494427 BTG2 BTG family, member 2 1 2
MIRT496064 MORC1 MORC family CW-type zinc finger 1 1 1
MIRT500724 TRIM37 tripartite motif containing 37 1 1
MIRT502008 MAP7 microtubule-associated protein 7 1 4
MIRT503213 ACER2 alkaline ceramidase 2 1 1
MIRT503562 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 2
MIRT503610 ZNF780A zinc finger protein 780A 1 1
MIRT503829 TMEM242 transmembrane protein 242 1 2
MIRT503967 ZNF180 zinc finger protein 180 1 3
MIRT504566 ZNF417 zinc finger protein 417 1 3
MIRT504641 MFSD8 major facilitator superfamily domain containing 8 1 3
MIRT505060 ZNF202 zinc finger protein 202 1 3
MIRT505866 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT506282 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT506378 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 3
MIRT506458 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT506547 MORF4L1 mortality factor 4 like 1 1 4
MIRT506622 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 4
MIRT506685 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT506873 KIAA1147 KIAA1147 1 1
MIRT506887 KIAA0101 KIAA0101 1 2
MIRT506991 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT507203 FZD9 frizzled family receptor 9 1 3
MIRT507440 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT507947 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT508576 CEP72 centrosomal protein 72kDa 1 2
MIRT508745 ZNF682 zinc finger protein 682 1 2
MIRT508837 GPR155 G protein-coupled receptor 155 1 1
MIRT509130 BMP8B bone morphogenetic protein 8b 1 3
MIRT509745 EFCAB11 EF-hand calcium binding domain 11 1 2
MIRT510029 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 2
MIRT511267 KLHL36 kelch-like 36 (Drosophila) 1 3
MIRT511320 KIAA1551 KIAA1551 1 1
MIRT511556 HMGB1 high mobility group box 1 1 3
MIRT512322 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 3
MIRT513467 NARS asparaginyl-tRNA synthetase 1 3
MIRT513709 RBM20 RNA binding motif protein 20 1 2
MIRT513751 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT514101 EPS15L1 epidermal growth factor receptor pathway substrate 15-like 1 1 3
MIRT514137 SERF2 small EDRK-rich factor 2 1 1
MIRT514320 FXYD5 FXYD domain containing ion transport regulator 5 1 3
MIRT514998 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 1
MIRT515205 CRCP CGRP receptor component 1 1
MIRT515575 TMEM134 transmembrane protein 134 1 1
MIRT516060 MED18 mediator complex subunit 18 1 1
MIRT516559 MIXL1 Mix paired-like homeobox 1 1
MIRT516799 PTRF polymerase I and transcript release factor 1 2
MIRT517021 COX19 cytochrome c oxidase assembly homolog 19 (S. cerevisiae) 1 1
MIRT517187 SLC28A1 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 1 1
MIRT517260 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 2
MIRT518317 ZNF514 zinc finger protein 514 1 2
MIRT518468 KIF6 kinesin family member 6 1 1
MIRT518699 KCNMB1 potassium large conductance calcium-activated channel, subfamily M, beta member 1 1 1
MIRT518804 MED16 mediator complex subunit 16 1 2
MIRT518863 NEK8 NIMA (never in mitosis gene a)- related kinase 8 1 1
MIRT518972 GRK7 G protein-coupled receptor kinase 7 1 1
MIRT519432 KCNA7 potassium voltage-gated channel, shaker-related subfamily, member 7 1 2
MIRT519548 TMEM38A transmembrane protein 38A 1 1
MIRT520082 YIPF4 Yip1 domain family, member 4 1 1
MIRT520156 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT521010 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT521304 RRAGD Ras-related GTP binding D 1 2
MIRT521549 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 2
MIRT522172 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 2
MIRT522505 MFN1 mitofusin 1 1 1
MIRT523083 HYPK huntingtin interacting protein K 1 1
MIRT523654 FOXK1 forkhead box K1 1 2
MIRT524083 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT524251 DCTN6 dynactin 6 1 1
MIRT524295 CYCS cytochrome c, somatic 1 1
MIRT524457 CNKSR3 CNKSR family member 3 1 1
MIRT524706 BTG3 BTG family, member 3 1 4
MIRT524984 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT525204 ZNF93 zinc finger protein 93 1 1
MIRT525488 TPK1 thiamin pyrophosphokinase 1 1 1
MIRT526639 NME6 NME/NM23 nucleoside diphosphate kinase 6 1 1
MIRT527206 XIRP2 xin actin-binding repeat containing 2 1 1
MIRT527259 TMEM196 transmembrane protein 196 1 1
MIRT527474 CLEC12B C-type lectin domain family 12, member B 1 2
MIRT528374 ZMYM1 zinc finger, MYM-type 1 1 2
MIRT530003 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 2
MIRT530591 ABHD15 abhydrolase domain containing 15 1 1
MIRT530989 EXO5 exonuclease 5 1 2
MIRT531480 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 2
MIRT531779 TXK TXK tyrosine kinase 1 2
MIRT531839 MTPAP mitochondrial poly(A) polymerase 1 2
MIRT532053 FHDC1 FH2 domain containing 1 1 1
MIRT532618 SPTLC2 serine palmitoyltransferase, long chain base subunit 2 1 1
MIRT532922 ZNF385A zinc finger protein 385A 1 1
MIRT533881 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT534008 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT534573 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 2
MIRT534631 RNASEH1 ribonuclease H1 1 2
MIRT535033 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT536446 KMT2B myeloid/lymphoid or mixed-lineage leukemia 4 1 3
MIRT536503 KIAA0922 KIAA0922 1 1
MIRT536542 KCNJ8 potassium inwardly-rectifying channel, subfamily J, member 8 1 1
MIRT537450 FBXL7 F-box and leucine-rich repeat protein 7 1 1
MIRT537742 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT538040 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 1
MIRT538070 DIAPH2 diaphanous homolog 2 (Drosophila) 1 1
MIRT539427 ADAT2 adenosine deaminase, tRNA-specific 2 1 1
MIRT540278 FAM89A family with sequence similarity 89, member A 1 1
MIRT541093 RLIM ring finger protein, LIM domain interacting 1 1
MIRT542063 SLC25A46 solute carrier family 25, member 46 1 1
MIRT542145 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT542271 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT543188 FICD FIC domain containing 1 1
MIRT543511 PLS1 plastin 1 1 1
MIRT543583 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT544632 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT545206 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT546299 TMEM200C transmembrane protein 200C 1 2
MIRT546694 RORA RAR-related orphan receptor A 1 2
MIRT546827 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT547085 PLRG1 pleiotropic regulator 1 1 1
MIRT548324 EPHA4 EPH receptor A4 1 1
MIRT548396 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 2
MIRT548822 CLIC4 chloride intracellular channel 4 1 2
MIRT548867 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT549113 C16orf70 chromosome 16 open reading frame 70 1 2
MIRT549826 LUZP2 leucine zipper protein 2 1 1
MIRT550097 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT550308 ZNF681 zinc finger protein 681 1 1
MIRT551127 ZNF107 zinc finger protein 107 1 1
MIRT551748 FMNL2 formin-like 2 1 1
MIRT552208 F2RL3 coagulation factor II (thrombin) receptor-like 3 1 1
MIRT552689 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 2
MIRT552869 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT552899 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT553034 USP48 ubiquitin specific peptidase 48 1 1
MIRT553579 TMEM100 transmembrane protein 100 1 1
MIRT553705 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT554416 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT554485 SAMD12 sterile alpha motif domain containing 12 1 1
MIRT554558 RRN3 RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) 1 1
MIRT554751 RHOC ras homolog family member C 1 1
MIRT555468 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT556188 MCC mutated in colorectal cancers 1 1
MIRT556596 LEPROT leptin receptor overlapping transcript 1 1
MIRT556908 ISOC1 isochorismatase domain containing 1 1 1
MIRT557037 HOXD11 homeobox D11 1 1
MIRT557596 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT557768 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT557892 FEM1B fem-1 homolog b (C. elegans) 1 2
MIRT558341 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 2
MIRT558939 CBX1 chromobox homolog 1 1 1
MIRT559442 ARSJ arylsulfatase family, member J 1 1
MIRT561247 ZNF354B zinc finger protein 354B 1 1
MIRT561650 RUNX3 runt-related transcription factor 3 1 1
MIRT562219 HMGB2 high mobility group box 2 1 1
MIRT562567 CCDC71L coiled-coil domain containing 71-like 1 2
MIRT562969 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT563383 DSPP dentin sialophosphoprotein 1 1
MIRT564687 ZNF35 zinc finger protein 35 1 1
MIRT565704 SESN3 sestrin 3 1 1
MIRT566145 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT566573 OTUD4 OTU domain containing 4 1 1
MIRT566882 LRP12 low density lipoprotein receptor-related protein 12 1 1
MIRT567059 KCNB1 potassium voltage-gated channel, Shab-related subfamily, member 1 1 1
MIRT567117 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT567547 FGFR1OP FGFR1 oncogene partner 1 1
MIRT567689 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT567850 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT567996 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT568184 CCDC6 coiled-coil domain containing 6 1 1
MIRT568274 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT571019 CKAP2 cytoskeleton associated protein 2 1 1
MIRT571682 RRAS2 related RAS viral (r-ras) oncogene homolog 2 1 1
MIRT571698 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT571728 RPL17-C18orf32 RPL17-C18orf32 readthrough 1 1
MIRT571863 NKIRAS1 NFKB inhibitor interacting Ras-like 1 1 1
MIRT572213 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT572680 AGMAT agmatine ureohydrolase (agmatinase) 1 2
MIRT573920 SNAP47 synaptosomal-associated protein, 47kDa 1 1
MIRT575218 Piwil2 piwi-like homolog 2 (Drosophila) 1 1
MIRT575993 Fem1a feminization 1 homolog a (C. elegans) 1 1
MIRT608372 PIWIL2 piwi-like 2 (Drosophila) 1 3
MIRT608752 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT608978 PRKCB protein kinase C, beta 1 1
MIRT611003 BRI3BP BRI3 binding protein 1 2
MIRT611840 FEM1A fem-1 homolog a (C. elegans) 1 2
MIRT612615 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT614267 WDR53 WD repeat domain 53 1 2
MIRT615180 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT615451 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT616176 TCEB1 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) 1 1
MIRT619845 POLM polymerase (DNA directed), mu 1 2
MIRT620981 TM4SF5 transmembrane 4 L six family member 5 1 1
MIRT624428 CBX8 chromobox homolog 8 1 1
MIRT625084 C15orf41 chromosome 15 open reading frame 41 1 1
MIRT626042 ATAT1 alpha tubulin acetyltransferase 1 1 2
MIRT626225 PNRC1 proline-rich nuclear receptor coactivator 1 1 2
MIRT626934 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT628569 MELK maternal embryonic leucine zipper kinase 1 1
MIRT633126 CBX5 chromobox homolog 5 1 1
MIRT634102 APOH apolipoprotein H (beta-2-glycoprotein I) 1 1
MIRT634459 PAK6 p21 protein (Cdc42/Rac)-activated kinase 6 1 1
MIRT634650 HIP1 huntingtin interacting protein 1 1 1
MIRT634959 GTF2H2C general transcription factor IIH, polypeptide 2C 1 2
MIRT640014 OSTM1 osteopetrosis associated transmembrane protein 1 1 1
MIRT641710 SPCS1 signal peptidase complex subunit 1 homolog (S. cerevisiae) 1 1
MIRT645219 POLR3F polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa 1 1
MIRT662411 ICA1L islet cell autoantigen 1,69kDa-like 1 2
MIRT664232 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT664398 CYB5A cytochrome b5 type A (microsomal) 1 1
MIRT664798 LIAS lipoic acid synthetase 1 2
MIRT673138 MFSD2A major facilitator superfamily domain containing 2A 1 1
MIRT675843 DHODH dihydroorotate dehydrogenase (quinone) 1 2
MIRT677159 DEGS1 delta(4)-desaturase, sphingolipid 1 1 1
MIRT677265 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT678752 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT680378 GATAD1 GATA zinc finger domain containing 1 1 2
MIRT680705 ZNF785 zinc finger protein 785 1 1
MIRT680783 WDR73 WD repeat domain 73 1 1
MIRT681415 RMND1 required for meiotic nuclear division 1 homolog (S. cerevisiae) 1 1
MIRT681709 ABI2 abl-interactor 2 1 1
MIRT681845 N4BP2L2 NEDD4 binding protein 2-like 2 1 1
MIRT682336 RAB42 RAB42, member RAS oncogene family 1 1
MIRT683334 C19orf40 chromosome 19 open reading frame 40 1 1
MIRT683404 ESR2 estrogen receptor 2 (ER beta) 1 1
MIRT683508 ZNF7 zinc finger protein 7 1 1
MIRT683540 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT683891 OCIAD1 OCIA domain containing 1 1 1
MIRT683964 MYLK3 myosin light chain kinase 3 1 1
MIRT683993 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT684096 TLR7 toll-like receptor 7 1 1
MIRT684149 CEP104 centrosomal protein 104kDa 1 1
MIRT684374 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT684590 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT684633 GTF2IRD2B GTF2I repeat domain containing 2B 1 1
MIRT684664 PDE4C phosphodiesterase 4C, cAMP-specific 1 1
MIRT684729 LRRD1 leucine-rich repeats and death domain containing 1 1 1
MIRT684758 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT684803 MYO1F myosin IF 1 1
MIRT684935 CD28 CD28 molecule 1 1
MIRT685211 DCTN5 dynactin 5 (p25) 1 1
MIRT685264 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT685332 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT685367 CCL5 chemokine (C-C motif) ligand 5 1 1
MIRT685535 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT685594 KCNK6 potassium channel, subfamily K, member 6 1 1
MIRT685725 BHMT2 betaine--homocysteine S-methyltransferase 2 1 1
MIRT685758 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT685799 ZNF426 zinc finger protein 426 1 1
MIRT685971 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT686122 TNIP3 TNFAIP3 interacting protein 3 1 1
MIRT686172 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT686299 WWC1 WW and C2 domain containing 1 1 1
MIRT686337 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT686460 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT686504 TRIOBP TRIO and F-actin binding protein 1 1
MIRT686543 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT686598 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT686843 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT686896 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT686996 SERINC1 serine incorporator 1 1 1
MIRT687060 RNF115 ring finger protein 115 1 1
MIRT687095 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT687270 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT687666 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT687874 ISCA2 iron-sulfur cluster assembly 2 homolog (S. cerevisiae) 1 1
MIRT687999 GTF2IRD2 GTF2I repeat domain containing 2 1 1
MIRT688139 GEMIN8 gem (nuclear organelle) associated protein 8 1 1
MIRT688233 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT688291 FAM213A family with sequence similarity 213, member A 1 1
MIRT688473 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT688522 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT688682 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT688716 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 1
MIRT688846 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT689128 ZBTB25 zinc finger and BTB domain containing 25 1 1
MIRT689190 ZNF665 zinc finger protein 665 1 1
MIRT689815 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT689860 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT690755 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT691000 ZNF578 zinc finger protein 578 1 1
MIRT691092 NUGGC nuclear GTPase, germinal center associated 1 1
MIRT691349 KIAA1841 KIAA1841 1 1
MIRT691512 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT691594 CCDC125 coiled-coil domain containing 125 1 1
MIRT691630 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT692090 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT692127 CXorf38 chromosome X open reading frame 38 1 2
MIRT692336 RFK riboflavin kinase 1 1
MIRT692398 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT692459 METTL8 methyltransferase like 8 1 1
MIRT692562 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT692623 GDF5OS growth differentiation factor 5 opposite strand 1 1
MIRT692804 SYNPO2L synaptopodin 2-like 1 1
MIRT692835 C1orf50 chromosome 1 open reading frame 50 1 1
MIRT692897 RBM41 RNA binding motif protein 41 1 1
MIRT693007 LGSN lengsin, lens protein with glutamine synthetase domain 1 1
MIRT693157 THEM4 thioesterase superfamily member 4 1 1
MIRT693368 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT694129 ZNF446 zinc finger protein 446 1 1
MIRT694213 ZNF347 zinc finger protein 347 1 1
MIRT694679 C14orf119 chromosome 14 open reading frame 119 1 1
MIRT694833 STX4 syntaxin 4 1 1
MIRT694955 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 1 1
MIRT695199 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT695681 MAN2B2 mannosidase, alpha, class 2B, member 2 1 1
MIRT695852 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT695944 ZNF174 zinc finger protein 174 1 1
MIRT696202 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT696463 SUGP1 SURP and G patch domain containing 1 1 1
MIRT696879 UBOX5 U-box domain containing 5 1 1
MIRT696926 C14orf105 chromosome 14 open reading frame 105 1 1
MIRT697265 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697410 ZMAT3 zinc finger, matrin-type 3 1 1
MIRT698004 TSPAN6 tetraspanin 6 1 1
MIRT699290 SLC6A4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT699653 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT699715 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT700064 RPL14 ribosomal protein L14 1 1
MIRT700122 RNF19B ring finger protein 19B 1 1
MIRT701130 PAPD5 PAP associated domain containing 5 1 1
MIRT701314 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT701596 MYPN myopalladin 1 1
MIRT702396 KLF10 Kruppel-like factor 10 1 1
MIRT702545 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT703111 GPRIN3 GPRIN family member 3 1 1
MIRT704130 DRAXIN dorsal inhibitory axon guidance protein 1 1
MIRT704161 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT704217 LDHD lactate dehydrogenase D 1 1
MIRT704783 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT705104 C4orf29 chromosome 4 open reading frame 29 1 1
MIRT705369 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT706125 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT706295 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT706331 CCDC30 coiled-coil domain containing 30 1 1
MIRT706371 STAC2 SH3 and cysteine rich domain 2 1 1
MIRT706423 HAS2 hyaluronan synthase 2 1 1
MIRT706534 MTMR9 myotubularin related protein 9 1 1
MIRT707608 PCNXL2 pecanex-like 2 (Drosophila) 1 1
MIRT707836 TMEM133 transmembrane protein 133 1 1
MIRT708390 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT708469 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 1
MIRT709092 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT709557 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT710425 YTHDC1 YTH domain containing 1 1 1
MIRT711789 RFXAP regulatory factor X-associated protein 1 1
MIRT713354 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT714326 ZNF454 zinc finger protein 454 1 1
MIRT716560 GOLGA2 golgin A2 1 1
MIRT719091 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
MIRT725227 PEA15 phosphoprotein enriched in astrocytes 15 1 1
Error report submission
Your e-Mail*