Accession ID: MIRT005705 [miRNA, hsa-miR-146a-5p :: CDKN3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-146aLinkOut: [miRBase ]
Synonyms MIRN146, MIRN146A, miR-146a, miRNA146A, MIR146A
Description Homo sapiens miR-146a stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-146a-5p
Mature Sequence 21| UGAGAACUGAAUUCCAUGGGUU |42
Evidence Experimental
Experiments Cloned
Putative hsa-miR-146a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CDKN3 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDI1, CIP2, FLJ25787, KAP, KAP1, MGC70625
Description cyclin-dependent kinase inhibitor 3
Transcript NM_0011308    LinkOut: [ RefSeq ]
Other Transcripts NM_0051   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CDKN3 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CDKN3
(miRNA target sites are highlighted)
>CDKN3|NM_0011308|3'UTR
   1 TCATCAAGAGATTCACAATCAAGATCTGTATCAAGATAAAGGAATTCAAATAGCATATATATGACCATGTCTGAAATGTC
  81 AGTTCTCTAGCATAATTTGTATTGAAATGAAACCACCAGTGTTATCAACTTGAATGTAAATGTACATGTGCAGATATTCC
 161 TAAAGTTTTATTGACAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-146a-5p :: CDKN3    [ Functional MTI ]
Validation Method Western blot , Other
Conditions HMVEC
Original Description (Extracted from the article) ... Of the 29 genes, 5 were human genes (CDKN3, CCNA2, PA2G4, KIF22, and BRCA1) belonging to the functional category of GOTERM_BP_ALL: cell cycle process. Mea- surement of the transcripts of these 5 cell cycle-related genes revealed that 3 genes (CCNA2, PA2G4, and BRCA1) were down- regulated after PMA treatment; however, their expression was rescued upon miR-146a inhibition (Fig. 2B). ...

- Hsieh, C. H. Rau, C. S. Jeng, S. F. Lin, C. et al., 2010, Exp Cell Res.

Article - Hsieh, C. H. Rau, C. S. Jeng, S. F. Lin, C. et al.
- Exp Cell Res, 2010
Phorbol 12-myristate 13-acetate (PMA) is known to activate protein kinase C (PKC) and increase angiogenesis in cultured endothelial cells. Using a microRNA (miRNA) array, we found that PMA induced miR-146a expression in human microvascular endothelial cells. The miR-146a expression was dependent on dose and time and independent of PKC activation. Using a combined approach involving predictions using miRanda algorithm and whole genome microarray experiments with or without inhibition of miR-146a expression by LNA-antimir-146a or LNA-control, 29 potential target genes of miR-146a were identified. Because endothelial cell S phase progression is an early event in the induction of angiogenesis, we evaluated 5 cell cycle-related genes from the 29 target genes and found that the transcripts of 3 genes (CCNA2, PA2G4, and BRCA1) were downregulated after PMA treatment, but their expression was rescued upon miR-146a inhibition. However, inhibition of miR-146a expression failed to alter the cell cycle distribution or angiogenesis induced by PMA treatment. By using a combined approach involving computational prediction and a whole genome microarray experiment in the presence or absence of antimir, the observations in this presented article raise the possibility that antimir strategies might be used to identify the potential miRNA targets.
LinkOut: [PMID: 19944095]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
97 hsa-miR-146a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000006 CXCR4 chemokine (C-X-C motif) receptor 4 5 2
MIRT000301 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 1 1
MIRT000303 CFH complement factor H 2 3
MIRT000304 IRAK2 interleukin-1 receptor-associated kinase 2 3 2
MIRT000449 TLR2 toll-like receptor 2 4 1
MIRT000638 FADD Fas (TNFRSF6)-associated via death domain 2 1
MIRT000711 TRAF6 TNF receptor-associated factor 6 5 13
MIRT000712 IRAK1 interleukin-1 receptor-associated kinase 1 5 11
MIRT000945 ROCK1 Rho-associated, coiled-coil containing protein kinase 1 3 1
MIRT001919 BRCA2 breast cancer 2, early onset 2 1
MIRT001920 BRCA1 breast cancer 1, early onset 5 2
MIRT003319 FAF1 Fas (TNFRSF6) associated factor 1 3 1
MIRT004017 CCNA2 cyclin A2 4 2
MIRT004018 PA2G4 proliferation-associated 2G4, 38kDa 4 2
MIRT004249 SNAP25 synaptosomal-associated protein, 25kDa 1 1
MIRT004409 IL8 interleukin 8 3 3
MIRT004459 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 5 3
MIRT004661 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2 1
MIRT004730 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 4 4
MIRT004731 MTA2 metastasis associated 1 family, member 2 3 1
MIRT005463 CD40LG CD40 ligand 4 1
MIRT005581 FAS Fas (TNF receptor superfamily, member 6) 3 1
MIRT005705 CDKN3 cyclin-dependent kinase inhibitor 3 2 1
MIRT005706 KIF22 kinesin family member 22 2 1
MIRT005806 ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) 3 1
MIRT006209 SMAD4 SMAD family member 4 4 2
MIRT006530 TLR4 toll-like receptor 4 4 1
MIRT007243 WASF2 WAS protein family, member 2 1 1
MIRT021214 NFIX nuclear factor I/X (CCAAT-binding transcription factor) 1 1
MIRT021215 IRF7 interferon regulatory factor 7 1 1
MIRT021216 RAD54L RAD54-like (S. cerevisiae) 1 1
MIRT021217 PPP1R1C protein phosphatase 1, regulatory (inhibitor) subunit 1C 1 1
MIRT021218 TRIM14 tripartite motif-containing 14 1 1
MIRT021219 TMSB15A thymosin beta 15a 1 1
MIRT021220 ITGB2 integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) 1 1
MIRT021221 SNTG2 syntrophin, gamma 2 1 1
MIRT021222 RSAD2 radical S-adenosyl methionine domain containing 2 1 1
MIRT021223 TIMELESS timeless homolog (Drosophila) 1 1
MIRT021224 PRR15 proline rich 15 1 1
MIRT021225 PEX11G peroxisomal biogenesis factor 11 gamma 1 1
MIRT021226 PLEKHA4 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 1 1
MIRT021227 BGLAP bone gamma-carboxyglutamate (gla) protein 1 1
MIRT021228 SYT12 synaptotagmin XII 1 1
MIRT021229 STAT1 signal transducer and activator of transcription 1, 91kDa 1 1
MIRT021230 LMO2 LIM domain only 2 (rhombotin-like 1) 1 2
MIRT021231 CD83 CD83 molecule 1 1
MIRT021232 IFIT1 interferon-induced protein with tetratricopeptide repeats 1 1 1
MIRT021233 IFITM1 interferon induced transmembrane protein 1 (9-27) 1 1
MIRT021234 OLFML2A olfactomedin-like 2A 1 1
MIRT021235 ISG15 ISG15 ubiquitin-like modifier 1 1
MIRT021236 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT021237 IFITM3 interferon induced transmembrane protein 3 (1-8U) 1 1
MIRT021238 RGS13 regulator of G-protein signaling 13 1 1
MIRT021239 CCL8 chemokine (C-C motif) ligand 8 1 1
MIRT021240 MTUS2 microtubule associated tumor suppressor candidate 2 1 1
MIRT021241 BLMH bleomycin hydrolase 1 1
MIRT021242 MCPH1 microcephalin 1 1 1
MIRT021243 NMI N-myc (and STAT) interactor 1 1
MIRT021244 HSPA1A heat shock 70kDa protein 1A 1 1
MIRT021245 TRIM22 tripartite motif-containing 22 1 1
MIRT021246 ITGBL1 integrin, beta-like 1 (with EGF-like repeat domains) 1 1
MIRT021247 SPATS2L spermatogenesis associated, serine-rich 2-like 1 1
MIRT021248 POLE2 polymerase (DNA directed), epsilon 2 (p59 subunit) 1 1
MIRT021249 IFI44 interferon-induced protein 44 1 1
MIRT021250 OASL 2'-5'-oligoadenylate synthetase-like 1 1
MIRT021251 LTB lymphotoxin beta (TNF superfamily, member 3) 1 1
MIRT021252 PBLD phenazine biosynthesis-like protein domain containing 1 1
MIRT021253 IFI44L interferon-induced protein 44-like 1 1
MIRT021254 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT021255 MR1 major histocompatibility complex, class I-related 1 1
MIRT021256 IFI27 interferon, alpha-inducible protein 27 1 1
MIRT021257 TBP TATA box binding protein 1 1
MIRT021258 ELL3 elongation factor RNA polymerase II-like 3 1 1
MIRT021259 METTL7A methyltransferase like 7A 1 1
MIRT021260 MCM10 minichromosome maintenance complex component 10 1 1
MIRT021261 LINC00304 chromosome 16 open reading frame 81 1 1
MIRT021262 SDCBP2 syndecan binding protein (syntenin) 2 1 1
MIRT021263 STON2 stonin 2 1 1
MIRT021264 BCL2A1 BCL2-related protein A1 1 1
MIRT021265 COL13A1 collagen, type XIII, alpha 1 1 1
MIRT021266 IRF5 interferon regulatory factor 5 1 1
MIRT021267 MX2 myxovirus (influenza virus) resistance 2 (mouse) 1 1
MIRT021268 VWCE von Willebrand factor C and EGF domains 1 1
MIRT021269 EPSTI1 epithelial stromal interaction 1 (breast) 1 1
MIRT021270 OSBPL1A oxysterol binding protein-like 1A 1 1
MIRT021271 CD86 CD86 molecule 1 1
MIRT021272 IFIT5 interferon-induced protein with tetratricopeptide repeats 5 1 1
MIRT021273 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT021274 GIMAP4 GTPase, IMAP family member 4 1 1
MIRT021275 CCR9 chemokine (C-C motif) receptor 9 1 1
MIRT021276 SAMD9L sterile alpha motif domain containing 9-like 1 1
MIRT021277 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 1 1
MIRT021278 CD80 CD80 molecule 1 1
MIRT021279 SPP1 secreted phosphoprotein 1 1 1
MIRT021280 SLPI secretory leukocyte peptidase inhibitor 2 1
MIRT035533 L1CAM L1 cell adhesion molecule 1 1
MIRT045694 MSC musculin 1 1