Accession ID: MIRT005705 [miRNA, hsa-miR-146a ::
CDKN3, target gene]
| pre-miRNA ID | hsa-mir-146a LinkOut: [miRBase ] |
|---|---|
| Synonyms | MIRN146, MIRN146A, miR-146a, miRNA146A, MIR146A |
| Description | Homo sapiens miR-146a stem-loop |
| Comment | This miRNA sequence is predicted based on homology to a verified miRNA from mouse . |
| 2nd Structure of pre-miRNA | ![]() |
| Mature miRNA | hsa-miR-146a-3p |
|---|---|
| Mature Sequence | 57| CCUCUGAAAUUCAGUUCUUCAG |78 |
| Evidence | Experimental |
| Experiments | Cloned |
| Putative hsa-miR-146a-3p Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
| Mature miRNA | hsa-miR-146a-5p |
| Mature Sequence | 21| UGAGAACUGAAUUCCAUGGGUU |42 |
| Evidence | Experimental |
| Experiments | Cloned |
| Putative hsa-miR-146a-5p Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
![]() |
| Gene Symbol | CDKN3 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ] | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Synonyms | CDI1, CIP2, FLJ25787, KAP, KAP1, MGC70625 | ||||||||||||||||||||
| Description | cyclin-dependent kinase inhibitor 3 | ||||||||||||||||||||
| Transcript | NM_001130851 LinkOut: [ RefSeq ] | ||||||||||||||||||||
| Other Transcripts | NM_005192 | ||||||||||||||||||||
| Expression | LinkOut: [ BioGPS ] | ||||||||||||||||||||
| Putative miRNA Targets on CDKN3 | LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ] | ||||||||||||||||||||
| 3'UTR of CDKN3 (miRNA target sites are highlighted) |
>CDKN3|NM_001130851|3'UTR
1 TCATCAAGAGATTCACAATCAAGATCTGTATCAAGATAAAGGAATTCAAATAGCATATATATGACCATGTCTGAAATGTC
81 AGTTCTCTAGCATAATTTGTATTGAAATGAAACCACCAGTGTTATCAACTTGAATGTAAATGTACATGTGCAGATATTCC
161 TAAAGTTTTATTGACAAAAAAAAAAAAAAAAA
Target sites Provided by authors Predicted by miRanda |
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
| miRNA:Target | hsa-miR-146a :: CDKN3 [ Non-Functional MTI ] |
|---|---|
| Validation Method | Western blot |
| Conditions | HMVEC |
| Original Description (Extracted from the article) | ... Of the 29 genes, 5 were human genes (CDKN3, CCNA2, PA2G4, KIF22, and BRCA1) belonging to the functional category of GOTERM_BP_ALL: cell cycle process. Mea- surement of the transcripts of these 5 cell cycle-related genes revealed that 3 genes (CCNA2, PA2G4, and BRCA1) were down- regulated after PMA treatment; however, their expression was rescued upon miR-146a inhibition (Fig. 2B). ... - Hsieh, C. H. Rau, C. S. Jeng, S. F. Lin, C. et al., 2010, Exp Cell Res. |
| Article |
- Hsieh, C. H.
Rau, C. S.
Jeng, S. F.
Lin, C. et al. - Exp Cell Res, 2010
Phorbol 12-myristate 13-acetate (PMA) is known to activate protein kinase C (PKC) and increase angiogenesis in cultured endothelial cells. Using a microRNA (miRNA) array, we found that PMA induced miR-146a expression in human microvascular endothelial cells. The miR-146a expression was dependent on dose and time and independent of PKC activation. Using a combined approach involving predictions using miRanda algorithm and whole genome microarray experiments with or without inhibition of miR-146a expression by LNA-antimir-146a or LNA-control, 29 potential target genes of miR-146a were identified. Because endothelial cell S phase progression is an early event in the induction of angiogenesis, we evaluated 5 cell cycle-related genes from the 29 target genes and found that the transcripts of 3 genes (CCNA2, PA2G4, and BRCA1) were downregulated after PMA treatment, but their expression was rescued upon miR-146a inhibition. However, inhibition of miR-146a expression failed to alter the cell cycle distribution or angiogenesis induced by PMA treatment. By using a combined approach involving computational prediction and a whole genome microarray experiment in the presence or absence of antimir, the observations in this presented article raise the possibility that antimir strategies might be used to identify the potential miRNA targets.
LinkOut: [PMID: 19944095]
|

