Accession ID: MIRT005729 [miRNA, hsa-miR-126-3p :: DNMT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-126LinkOut: [miRBase ]
Description Homo sapiens miR-126 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-126-3p
Mature Sequence 52| UCGUACCGUGAGUAAUAAUGCG |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-126-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DNMT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AIM, CXXC9, DNMT, FLJ16293, MCMT, MGC104992
Description DNA (cytosine-5-)-methyltransferase 1
Transcript NM_0011308    LinkOut: [ RefSeq ]
Other Transcripts NM_0013   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DNMT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DNMT1
(miRNA target sites are highlighted)
>DNMT1|NM_0011308|3'UTR
   1 GCCAAAGCCCGAGAGAGTGCCTCAGCTAAAATAAAGGAGGAGGAAGCTGCTAAGGACTAGTTCTGCCCTCCCGTCACCCC
  81 TGTTTCTGGCACCAGGAATCCCCAACATGCACTGATGTTGTGTTTTTAACATGTCAATCTGTCCGTTCACATGTGTGGTA
 161 CATGGTGTTTGTGGCCTTGGCTGACATGAAGCTGTTGTGTGAGGTTCGCTTATCAACTAATGATTTAGTGATCAAATTGT
 241 GCAGTACTTTGTGCATTCTGGATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTACCACTGTATGAGTGGAAATTA
 321 AGACTTTATGTAGTTTTTATATGTTGTAATATTTCTTCAAATAAATCTCTCCTATAAACCAAAAAAAAAAAAAAAAAAAA
 401 AAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-126-3p :: DNMT1    [ Functional MTI ]
Validation Method Flow , Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions Peripheral blood mononuclear cells (PBMCs)
Disease systemic lupus erythematosus
Location of target site 3'UTR
Tools used in this research miRBase Target Database
Original Description (Extracted from the article) ... We demonstrated that miR-126 directly inhibits DNMT1 translation via interaction with its 3'UTR, and that overexpression of miR-126 in CD4 + T cells can significantly reduce DNMT1 protein levels. Overexpressing miR-126 in healthy donor CD4 + T cells caused ...

- Zhao, S. Wang, Y. Liang, Y. Zhao, M. Long, et al., 2010, Arthritis and Rheumatism.

Article - Zhao, S. Wang, Y. Liang, Y. Zhao, M. Long, et al.
- Arthritis and Rheumatism, 2010
OBJECTIVE:: To uncover miRNA genes with abnormal expression in CD4(+) T cells of patients with systemic lupus erythematosus (SLE), and determine the role of miR-126 in the etiology of SLE. METHODS:: miRNA expression patterns in control and SLE CD4(+) T cells were analyzed by miRNA microarray and stem-loop qPCR. Luciferase reporter gene assays were performed to identify miR-126 targets. DNMT1, CD11a, and CD70 mRNA and protein levels were determined by real-time RT-PCR, Western blotting, and flow cytometry. CD11a, CD70, and EGFL7 promoter methylation levels were detected by bisulfite sequencing. IgG levels in T-B cell co-cultures were determined by ELISA. RESULTS:: We found 11 miRNAs to be significantly increased or decreased in SLE CD4(+) T cells relative to controls. Among these, miR-126 was upregulated and its degree of overexpression was inversely correlated with DNMT1 protein levels. We demonstrated that miR-126 directly inhibits DNMT1 translation via interaction with its 3' UTR, and that overexpression of miR-126 in CD4(+) T cells can significantly reduce DNMT1 protein levels. Overexpressing miR-126 in healthy donor CD4(+) T cells caused the demethylation and upregulation of genes encoding CD11a and CD70, thereby causing T and B cell hyperactivity. Inhibiting miR-126 in SLE CD4(+) T cells had opposite effects. The miR-126 host gene EGFL7 was also upregulated in SLE CD4(+) T cells, possibly in a hypomethylation-dependent manner. CONCLUSION:: Our data suggest that miR-126 regulates DNA methylation in CD4(+) T cells and contributes to T cell autoreactivity in SLE by directly targeting DNMT1.
LinkOut: [PMID: 21165896]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-126-3p :: DNMT1    [ Functional MTI ]
Validation Method Flow , Luciferase reporter assay , qRT-PCR , Western blot
Conditions PBMC
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-126 directly inhibits Dnmt1 translation via interaction with its 3  –untranslated region, and that overexpression of miR-126 in CD4  T cells can significantly reduce Dnmt1 protein levels. ...

- Zhao, S. Wang, Y. Liang, Y. Zhao, M. Long, et al., 2011, Arthritis and Rheumatism.

Article - Zhao, S. Wang, Y. Liang, Y. Zhao, M. Long, et al.
- Arthritis and Rheumatism, 2011
OBJECTIVE: To identify microRNA genes with abnormal expression in the CD4+ T cells of patients with systemic lupus erythematosus (SLE) and to determine the role of microRNA-126 (miR-126) in the etiology of SLE. METHODS: MicroRNA expression patterns in CD4+ T cells from patients with SLE and healthy control subjects were analyzed by microRNA microarray and stem loop quantitative polymerase chain reaction (qPCR). Luciferase reporter gene assays were performed to identify miR-126 targets. Dnmt1, CD11a, and CD70 messenger RNA and protein levels were determined by real-time qPCR, Western blotting, and flow cytometry. CD11a, CD70, and EGFL7 promoter methylation levels were detected by bisulfite sequencing. IgG levels in T cell-B cell cocultures were determined by enzyme-linked immunosorbent assay. RESULTS: The expression of 11 microRNA was significantly increased or decreased in CD4+ T cells from patients with SLE relative to that in CD4+ T cells from control subjects. Among these, miR-126 was up-regulated, and its degree of overexpression was inversely correlated with Dnmt1 protein levels. We demonstrated that miR-126 directly inhibits Dnmt1 translation via interaction with its 3'-untranslated region, and that overexpression of miR-126 in CD4+ T cells can significantly reduce Dnmt1 protein levels. The overexpression of miR-126 in CD4+ T cells from healthy donors caused the demethylation and up-regulation of genes encoding CD11a and CD70, thereby causing T cell and B cell hyperactivity. The inhibition of miR-126 in CD4+ T cells from patients with SLE had the opposite effects. Expression of the miR-126 host gene EGFL7 was also up-regulated in CD4+ T cells from patients with SLE, possibly in a hypomethylation-dependent manner. CONCLUSION: Our data suggest that miR-126 regulates DNA methylation in CD4+ T cells and contributes to T cell autoreactivity in SLE by directly targeting Dnmt1.
LinkOut: [PMID: 21538319]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
32 hsa-miR-126-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000343 SPRED1 sprouty-related, EVH1 domain containing 1 4 5
MIRT000344 PLK2 polo-like kinase 2 (Drosophila) 3 2
MIRT000798 SLC45A3 solute carrier family 45, member 3 3 1
MIRT000965 CCNE2 cyclin E2 2 1
MIRT000966 RGS3 regulator of G-protein signaling 3 2 2
MIRT000967 TOM1 target of myb1 (chicken) 4 2
MIRT001918 HOXA9 homeobox A9 4 1
MIRT002993 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 5 6
MIRT003428 VEGFA vascular endothelial growth factor A 4 4
MIRT003894 PIK3R2 phosphoinositide-3-kinase, regulatory subunit 2 (beta) 4 4
MIRT004081 VCAM1 vascular cell adhesion molecule 1 3 1
MIRT004355 IRS1 insulin receptor substrate 1 4 3
MIRT005020 E2F1 E2F transcription factor 1 2 1
MIRT005370 SOX2 SRY (sex determining region Y)-box 2 5 1
MIRT005538 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 5 1
MIRT005540 TWF2 twinfilin, actin-binding protein, homolog 2 (Drosophila) 4 1
MIRT005727 PTPN7 protein tyrosine phosphatase, non-receptor type 7 3 1
MIRT005729 DNMT1 DNA (cytosine-5-)-methyltransferase 1 4 2
MIRT006450 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 4 1
MIRT006543 IGFBP2 insulin-like growth factor binding protein 2, 36kDa 4 1
MIRT006544 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 4 1
MIRT006545 MERTK c-mer proto-oncogene tyrosine kinase 4 1
MIRT006558 EGFL7 EGF-like-domain, multiple 7 4 2
MIRT006679 SLC7A5 solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 3 1
MIRT006831 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 3 1
MIRT006883 TEK TEK tyrosine kinase, endothelial 3 1
MIRT007266 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 1 1
MIRT007269 MMP7 matrix metallopeptidase 7 (matrilysin, uterine) 1 1
MIRT007381 CXCL12 chemokine (C-X-C motif) ligand 12 1 1
MIRT021281 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT021282 PGR progesterone receptor 2 1
MIRT045695 RBMX RNA binding motif protein, X-linked 1 1