Accession ID: MIRT005739 [miRNA, hsa-miR-150-5p :: IGF2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-150LinkOut: [miRBase ]
Description Homo sapiens miR-150 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-150-5p
Mature Sequence 16| UCUCCCAACCCUUGUACCAGUG |37
Evidence Experimental
Experiments Cloned
Putative hsa-miR-150-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IGF2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C11orf43, FLJ22066, FLJ44734, INSIGF, pp9974
Description insulin-like growth factor 2 (somatomedin A)
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0010071 , NM_0011275   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IGF2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IGF2
(miRNA target sites are highlighted)
>IGF2|NM_0006|3'UTR
   1 TGAGCAAAACTGCCGCAAGTCTGCAGCCCGGCGCCACCATCCTGCAGCCTCCTCCTGACCACGGACGTTTCCATCAGGTT
  81 CCATCCCGAAAATCTCTCGGTTCCACGTCCCCCTGGGGCTTCTCCTGACCCAGTCCCCGTGCCCCGCCTCCCCGAAACAG
 161 GCTACTCTCCTCGGCCCCCTCCATCGGGCTGAGGAAGCACAGCAGCATCTTCAAACATGTACAAAATCGATTGGCTTTAA
 241 ACACCCTTCACATACCCTCCCCCCAAATTATCCCCAATTATCCCCACACATAAAAAATCAAAACATTAAACTAACCCCCT
 321 TCCCCCCCCCCCACAACAACCCTCTTAAAACTAATTGGCTTTTTAGAAACACCCCACAAAAGCTCAGAAATTGGCTTTAA
 401 AAAAAACAACCACCAAAAAAAATCAATTGGCTAAAAAAAAAAAGTATTAAAAACGAATTGGCTGAGAAACAATTGGCAAA
 481 ATAAAGGAATTTGGCACTCCCCACCCCCCTCTTTCTCTTCTCCCTTGGACTTTGAGTCAAATTGGCCTGGACTTGAGTCC
 561 CTGAACCAGCAAAGAGAAAAGAAGGACCCCAGAAATCACAGGTGGGCACGTCGCTGCTACCGCCATCTCCCTTCTCACGG
 641 GAATTTTCAGGGTAAACTGGCCATCCGAAAATAGCAACAACCCAGACTGGCTCCTCACTCCCTTTTCCATCACTAAAAAT
 721 CACAGAGCAGTCAGAGGGACCCAGTAAGACCAAAGGAGGGGAGGACAGAGCATGAAAACCAAAATCCATGCAAATGAAAT
 801 GTAATTGGCACGACCCTCACCCCCAAATCTTACATCTCAATTCCCATCCTAAAAAGCACTCATACTTTATGCATCCCCGC
 881 AGCTACACACACACAACACACAGCACACGCATGAACACAGCACACACACGAGCACAGCACACACACAAACGCACAGCACA
 961 CACAGCACACAGATGAGCACACAGCACACACACAAACGCACAGCACACACACGCACACACATGCACACACAGCACACAAA
1041 CGCACGGCACACACACGCACACACATGCACACACAGCACACACACAAACGCACAGCACACACAAACGCACAGCACACACG
1121 CACACACAGCACACACACGAGCACACAGCACACAAACGCACAGCACACGCACACACATGCACACACAGCACACACACTAG
1201 CACACAGCACACACACAAAGACACAGCACACACATGCACACACAGCACACACACGCGAACACAGCACACACGAACACAGC
1281 ACACACAGCACACACACAAACACAGCACACACATGCACACAGCACACGCACACACAGCACACACATGAACACAGCACACA
1361 GCACACACATGCACACACAGCACACACGCATGCACAGCACACATGAACACAGCACACACACAAACACACAGCACACACAT
1441 GCACACACAGCACACACACTCATGCGCAGCACATACATGAACACAGCTCACAGCACACAAACACGCAGCACACACGTTGC
1521 ACACGCAAGCACCCACCTGCACACACACATGCGCACACACACGCACACCCCCACAAAATTGGATGAAAACAATAAGCATA
1601 TCTAAGCAACTACGATATCTGTATGGATCAGGCCAAAGTCCCGCTAAGATTCTCCAATGTTTTCATGGTCTGAGCCCCGC
1681 TCCTGTTCCCATCTCCACTGCCCCTCGGCCCTGTCTGTGCCCTGCCTCTCAGAGGAGGGGGCTCAGATGGTGCGGCCTGA
1761 GTGTGCGGCCGGCGGCATTTGGGATACACCCGTAGGGTGGGCGGGGTGTGTCCCAGGCCTAATTCCATCTTTCCACCATG
1841 ACAGAGATGCCCTTGTGAGGCTGGCCTCCTTGGCGCCTGTCCCCACGGCCCCCGCAGCGTGAGCCACGATGCTCCCCATA
1921 CCCCACCCATTCCCGATACACCTTACTTACTGTGTGTTGGCCCAGCCAGAGTGAGGAAGGAGTTTGGCCACATTGGAGAT
2001 GGCGGTAGCTGAGCAGACATGCCCCCACGAGTAGCCTGACTCCCTGGTGTGCTCCTGGAAGGAAGATCTTGGGGACCCCC
2081 CCACCGGAGCACACCTAGGGATCATCTTTGCCCGTCTCCTGGGGACCCCCCAAGAAATGTGGAGTCCTCGGGGGCCGTGC
2161 ACTGATGCGGGGAGTGTGGGAAGTCTGGCGGTTGGAGGGGTGGGTGGGGGGCAGTGGGGGCTGGGCGGGGGGAGTTCTGG
2241 GGTAGGAAGTGGTCCCGGGAGATTTTGGATGGAAAAGTCAGGAGGATTGACAGCAGACTTGCAGAATTACATAGAGAAAT
2321 TAGGAACCCCCAAATTTCATGTCAATTGATCTATTCCCCCTCTTTGTTTCTTGGGGCATTTTTCCTTTTTTTTTTTTTTT
2401 TGTTTTTTTTTTACCCCTCCTTAGCTTTATGCGCTCAGAAACCAAATTAAACCCCCCCCCCATGTAACAGGGGGGCAGTG
2481 ACAAAAGCAAGAACGCACGAAGCCAGCCTGGAGACCACCACGTCCTGCCCCCCGCCATTTATCGCCCTGATTGGATTTTG
2561 TTTTTCATCTGTCCCTGTTGCTTGGGTTGAGTTGAGGGTGGAGCCTCCTGGGGGGCACTGGCCACTGAGCCCCCTTGGAG
2641 AAGTCAGAGGGGAGTGGAGAAGGCCACTGTCCGGCCTGGCTTCTGGGGACAGTGGCTGGTCCCCAGAAGTCCTGAGGGCG
2721 GAGGGGGGGGTTGGGCAGGGTCTCCTCAGGTGTCAGGAGGGTGCTCGGAGGCCACAGGAGGGGGCTCCTGGCTGGCCTGA
2801 GGCTGGCCGGAGGGGAAGGGGCTAGCAGGTGTGTAAACAGAGGGTTCCATCAGGCTGGGGCAGGGTGGCCGCCTTCCGCA
2881 CACTTGAGGAACCCTCCCCTCTCCCTCGGTGACATCTTGCCCGCCCCTCAGCACCCTGCCTTGTCTCCAGGAGGTCCGAA
2961 GCTCTGTGGGACCTCTTGGGGGCAAGGTGGGGTGAGGCCGGGGAGTAGGGAGGTCAGGCGGGTCTGAGCCCACAGAGCAG
3041 GAGAGCTGCCAGGTCTGCCCATCGACCAGGTTGCTTGGGCCCCGGAGCCCACGGGTCTGGTGATGCCATAGCAGCCACCA
3121 CCGCGGCGCCTAGGGCTGCGGCAGGGACTCGGCCTCTGGGAGGTTTACCTCGCCCCCACTTGTGCCCCCAGCTCAGCCCC
3201 CCTGCACGCAGCCCGACTAGCAGTCTAGAGGCCTGAGGCTTCTGGGTCCTGGTGACGGGGCTGGCATGACCCCGGGGGTC
3281 GTCCATGCCAGTCCGCCTCAGTCGCAGAGGGTCCCTCGGCAAGCGCCCTGTGAGTGGGCCATTCGGAACATTGGACAGAA
3361 GCCCAAAGAGCCAAATTGTCACAATTGTGGAACCCACATTGGCCTGAGATCCAAAACGCTTCGAGGCACCCCAAATTACC
3441 TGCCCATTCGTCAGGACACCCACCCACCCAGTGTTATATTCTGCCTCGCCGGAGTGGGTGTTCCCGGGGGCACTTGCCGA
3521 CCAGCCCCTTGCGTCCCCAGGTTTGCAGCTCTCCCCTGGGCCACTAACCATCCTGGCCCGGGCTGCCTGTCTGACCTCCG
3601 TGCCTAGTCGTGGCTCTCCATCTTGTCTCCTCCCCGTGTCCCCAATGTCTTCAGTGGGGGGCCCCCTCTTGGGTCCCCTC
3681 CTCTGCCATCACCTGAAGACCCCCACGCCAAACACTGAATGTCACCTGTGCCTGCCGCCTCGGTCCACCTTGCGGCCCGT
3761 GTTTGACTCAACTCAACTCCTTTAACGCTAATATTTCCGGCAAAATCCCATGCTTGGGTTTTGTCTTTAACCTTGTAACG
3841 CTTGCAATCCCAATAAAGCATTAAAAGTCATGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-150-5p :: IGF2    [ Non-Functional MTI ]
Validation Method Luciferase reporter assay
Conditions C2C12 , HEK293
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Indeed, introduction of synthetic miR-150 duplex into HEK293 cells had no effect on the Igf2 3' UTR reporter (Fig. S4 B). Furthermore, when the putative miR-150 target site was mutated in its seed region (Fig. S4 A), the mutant reporter behaved identically to the wild- type reporter during C2C12 differentiation (Fig. S4 C). These re- sults suggest that miR-150 is unlikely to regulate Igf2, and they also serve as negative controls that validate the reporter assays (Fig. 6), identifying miR-125b as a bona fide Igf2 regulator. ...

- Ge, Y. Sun, Y. Chen, J., 2011, The Journal of cell biology.

Article - Ge, Y. Sun, Y. Chen, J.
- The Journal of cell biology, 2011
MicroRNAs (miRNAs) have emerged as key regulators of skeletal myogenesis, but our knowledge of the identity of the myogenic miRNAs and their targets remains limited. In this study, we report the identification and characterization of a novel myogenic miRNA, miR-125b. We find that the levels of miR-125b decline during myogenesis and that miR-125b negatively modulates myoblast differentiation in culture and muscle regeneration in mice. Our results identify IGF-II (insulin-like growth factor 2), a critical regulator of skeletal myogenesis, as a direct and major target of miR-125b in both myocytes and regenerating muscles, revealing for the first time an miRNA mechanism controlling IGF-II expression. In addition, we provide evidence suggesting that miR-125b biogenesis is negatively controlled by kinase-independent mammalian target of rapamycin (mTOR) signaling both in vitro and in vivo as a part of a dual mechanism by which mTOR regulates the production of IGF-II, a master switch governing the initiation of skeletal myogenesis.
LinkOut: [PMID: 21200031]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
19 hsa-miR-150-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000935 MYB v-myb myeloblastosis viral oncogene homolog (avian) 4 7
MIRT003222 EGR2 early growth response 2 4 1
MIRT004272 VEGFA vascular endothelial growth factor A 2 1
MIRT004357 P2RX7 purinergic receptor P2X, ligand-gated ion channel, 7 3 1
MIRT005739 IGF2 insulin-like growth factor 2 (somatomedin A) 1 1
MIRT006115 MUC4 mucin 4, cell surface associated 3 1
MIRT006604 Myb myeloblastosis oncogene 1 1
MIRT006668 CXCR4 chemokine (C-X-C motif) receptor 4 1 1
MIRT006984 ZEB1 zinc finger E-box binding homeobox 1 3 1
MIRT007016 NOTCH3 Notch homolog 3 (Drosophila) 1 1
MIRT007053 FLT3 fms-related tyrosine kinase 3 1 1
MIRT007087 EP300 E1A binding protein p300 1 1
MIRT021208 cmyb transcription factor cmyb 1 1
MIRT021209 PTPRR protein tyrosine phosphatase, receptor type, R 1 1
MIRT021210 MS4A3 membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) 1 1
MIRT021211 CCNE1 cyclin E1 1 1
MIRT021212 AGA aspartylglucosaminidase 1 1
MIRT045387 ATP13A3 ATPase type 13A3 1 1
MIRT052652 TP53 tumor protein p53 2 1