Accession ID: MIRT005739 [miRNA, hsa-miR-150-5p :: IGF2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-150LinkOut: [miRBase ]
Description Homo sapiens miR-150 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-150-5p
Mature Sequence 16| UCUCCCAACCCUUGUACCAGUG |37
Evidence Experimental
Experiments Cloned
Putative hsa-miR-150-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-150-5p :: IGF2    [ Non-Functional MTI ]
Validation Method Luciferase reporter assay
Conditions C2C12 , HEK293
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Indeed, introduction of synthetic miR-150 duplex into HEK293 cells had no effect on the Igf2 3' UTR reporter (Fig. S4 B). Furthermore, when the putative miR-150 target site was mutated in its seed region (Fig. S4 A), the mutant reporter behaved identically to the wild- type reporter during C2C12 differentiation (Fig. S4 C). These re- sults suggest that miR-150 is unlikely to regulate Igf2, and they also serve as negative controls that validate the reporter assays (Fig. 6), identifying miR-125b as a bona fide Igf2 regulator. ...

- Ge, Y. Sun, Y. Chen, J., 2011, The Journal of cell biology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGACCAUGUUCCCAACCCUCu 5'
            :|||  |  | |||||||| 
Target 5' gcUUGG--CCUGAGUUGGGAGu 3'
2 - 21
Article - Ge, Y. Sun, Y. Chen, J.
- The Journal of cell biology, 2011
MicroRNAs (miRNAs) have emerged as key regulators of skeletal myogenesis, but our knowledge of the identity of the myogenic miRNAs and their targets remains limited. In this study, we report the identification and characterization of a novel myogenic miRNA, miR-125b. We find that the levels of miR-125b decline during myogenesis and that miR-125b negatively modulates myoblast differentiation in culture and muscle regeneration in mice. Our results identify IGF-II (insulin-like growth factor 2), a critical regulator of skeletal myogenesis, as a direct and major target of miR-125b in both myocytes and regenerating muscles, revealing for the first time an miRNA mechanism controlling IGF-II expression. In addition, we provide evidence suggesting that miR-125b biogenesis is negatively controlled by kinase-independent mammalian target of rapamycin (mTOR) signaling both in vitro and in vivo as a part of a dual mechanism by which mTOR regulates the production of IGF-II, a master switch governing the initiation of skeletal myogenesis.
LinkOut: [PMID: 21200031]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
488 hsa-miR-150-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000935 MYB v-myb myeloblastosis viral oncogene homolog (avian) 5 13
MIRT003222 EGR2 early growth response 2 5 2
MIRT004272 VEGFA vascular endothelial growth factor A 2 1
MIRT004357 P2RX7 purinergic receptor P2X, ligand-gated ion channel, 7 5 3
MIRT005739 IGF2 insulin-like growth factor 2 (somatomedin A) 1 1
MIRT006115 MUC4 mucin 4, cell surface associated 3 1
MIRT006604 Myb myeloblastosis oncogene 1 1
MIRT006668 CXCR4 chemokine (C-X-C motif) receptor 4 1 1
MIRT006984 ZEB1 zinc finger E-box binding homeobox 1 4 2
MIRT007016 NOTCH3 notch 3 1 1
MIRT007053 FLT3 fms-related tyrosine kinase 3 1 1
MIRT007087 EP300 E1A binding protein p300 1 1
MIRT021208 cmyb transcription factor cmyb 1 1
MIRT021209 PTPRR protein tyrosine phosphatase, receptor type, R 1 1
MIRT021210 MS4A3 membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) 1 1
MIRT021211 CCNE1 cyclin E1 1 1
MIRT021212 AGA aspartylglucosaminidase 1 1
MIRT045387 ATP13A3 ATPase type 13A3 1 1
MIRT052652 TP53 tumor protein p53 3 2
MIRT054633 BIRC5 baculoviral IAP repeat containing 5 3 1
MIRT054852 SRCIN1 SRC kinase signaling inhibitor 1 4 2
MIRT054868 CBL Cbl proto-oncogene, E3 ubiquitin protein ligase 3 1
MIRT133589 ADIPOR2 adiponectin receptor 2 2 1
MIRT136366 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT222062 PURB purine-rich element binding protein B 1 3
MIRT222128 FOXK1 forkhead box K1 1 1
MIRT232510 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT293382 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT388973 CNPPD1 cyclin Pas1/PHO80 domain containing 1 1 1
MIRT392627 HILPDA hypoxia inducible lipid droplet-associated 1 1
MIRT437627 SYNPO2 synaptopodin 2 2 1
MIRT437628 PDIA6 protein disulfide isomerase family A, member 6 2 1
MIRT437629 EREG epiregulin 3 2
MIRT437630 TOM1 target of myb1 (chicken) 2 1
MIRT437631 CNST consortin, connexin sorting protein 2 1
MIRT437632 TRPS1 trichorhinophalangeal syndrome I 2 1
MIRT437633 CAST calpastatin 2 1
MIRT437634 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 3 2
MIRT437635 C16orf63 FGFR1OP N-terminal like 2 1
MIRT437823 COL4A4 collagen, type IV, alpha 4 1 1
MIRT437824 SP1 Sp1 transcription factor 1 1
MIRT437917 CISH cytokine inducible SH2-containing protein 2 1
MIRT438120 CCR6 chemokine (C-C motif) receptor 6 3 1
MIRT447959 WDR77 WD repeat domain 77 1 1
MIRT461324 MRPS27 mitochondrial ribosomal protein S27 1 1
MIRT493802 GAN gigaxonin 1 3
MIRT495023 C2CD4B C2 calcium-dependent domain containing 4B 1 1
MIRT495046 AGTPBP1 ATP/GTP binding protein 1 1 1
MIRT496570 DGCR6L DiGeorge syndrome critical region gene 6-like 1 1
MIRT497483 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT497936 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT503982 C4orf29 chromosome 4 open reading frame 29 1 2
MIRT504020 ACSL6 acyl-CoA synthetase long-chain family member 6 1 1
MIRT504765 TEP1 telomerase-associated protein 1 1 2
MIRT504841 RRP36 ribosomal RNA processing 36 homolog (S. cerevisiae) 1 3
MIRT505556 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 1 1
MIRT506090 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT509109 BMP8B bone morphogenetic protein 8b 1 3
MIRT513390 TUBB4A tubulin, beta 4A class IVa 1 1
MIRT514115 SERF2 small EDRK-rich factor 2 1 1
MIRT514299 FXYD5 FXYD domain containing ion transport regulator 5 1 2
MIRT514959 SIGLEC11 sialic acid binding Ig-like lectin 11 1 1
MIRT515171 AHI1 Abelson helper integration site 1 1 1
MIRT515373 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT515723 SEPT14 septin 14 1 2
MIRT516023 A1CF APOBEC1 complementation factor 1 1
MIRT516252 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT516535 MIXL1 Mix paired-like homeobox 1 1
MIRT516803 ZNF708 zinc finger protein 708 1 2
MIRT516989 COX19 cytochrome c oxidase assembly homolog 19 (S. cerevisiae) 1 2
MIRT517038 FGD6 FYVE, RhoGEF and PH domain containing 6 1 1
MIRT517097 CCDC30 coiled-coil domain containing 30 1 2
MIRT517794 EFCAB11 EF-hand calcium binding domain 11 1 2
MIRT518871 NKD1 naked cuticle homolog 1 (Drosophila) 1 1
MIRT519497 MAPK13 mitogen-activated protein kinase 13 1 1
MIRT520436 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT520989 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT521526 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 2
MIRT521645 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT522851 KIAA1551 KIAA1551 1 1
MIRT522973 INTU inturned planar cell polarity effector homolog (Drosophila) 1 1
MIRT523061 HYPK huntingtin interacting protein K 1 1
MIRT523581 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT524273 CYCS cytochrome c, somatic 1 2
MIRT524435 CNKSR3 CNKSR family member 3 1 1
MIRT524603 CACYBP calcyclin binding protein 1 1
MIRT524962 AGO3 eukaryotic translation initiation factor 2C, 3 1 2
MIRT525288 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT526171 ANKRD65 ankyrin repeat domain 65 1 1
MIRT526618 NME6 NME/NM23 nucleoside diphosphate kinase 6 1 1
MIRT527226 C3orf36 chromosome 3 open reading frame 36 1 2
MIRT528701 TRAF3IP2 TRAF3 interacting protein 2 1 2
MIRT529981 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 1
MIRT530022 KIAA1875 KIAA1875 1 1
MIRT530238 PLXDC1 plexin domain containing 1 1 1
MIRT530573 ABHD15 abhydrolase domain containing 15 1 1
MIRT530807 GPR182 G protein-coupled receptor 182 1 1
MIRT531755 TXK TXK tyrosine kinase 1 1
MIRT532028 FHDC1 FH2 domain containing 1 1 1
MIRT534310 SKIDA1 SKI/DACH domain containing 1 1 1
MIRT535305 PHF12 PHD finger protein 12 1 1
MIRT537947 DSN1 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT540257 FAM89A family with sequence similarity 89, member A 1 1
MIRT540369 MASTL microtubule associated serine/threonine kinase-like 1 1
MIRT540648 ZNF514 zinc finger protein 514 1 1
MIRT540669 MIS18A MIS18 kinetochore protein homolog A (S. pombe) 1 2
MIRT542033 PTRF polymerase I and transcript release factor 1 1
MIRT542124 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT542350 MED16 mediator complex subunit 16 1 1
MIRT544456 KRBOX4 zinc finger family member 673 1 1
MIRT547164 PDZD8 PDZ domain containing 8 1 1
MIRT548162 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 1
MIRT551677 BBS5 Bardet-Biedl syndrome 5 1 1
MIRT551694 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT555324 PPP2CB protein phosphatase 2, catalytic subunit, beta isozyme 1 1
MIRT555448 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT557269 HMGB1 high mobility group box 1 1 2
MIRT557564 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT563033 CEP72 centrosomal protein 72kDa 1 1
MIRT572904 RUNDC3B RUN domain containing 3B 1 1
MIRT575896 Dis3 DIS3 mitotic control homolog (S. cerevisiae) 1 1
MIRT607666 BTN3A2 butyrophilin, subfamily 3, member A2 1 1
MIRT608731 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT608837 PTCHD1 patched domain containing 1 1 1
MIRT609296 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 1
MIRT610291 DIS3 DIS3 mitotic control homolog (S. cerevisiae) 1 1
MIRT610301 KLHL21 kelch-like 21 (Drosophila) 1 1
MIRT610640 PIGM phosphatidylinositol glycan anchor biosynthesis, class M 1 1
MIRT611035 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT612595 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT613614 FAM185A family with sequence similarity 185, member A 1 1
MIRT614242 WDR53 WD repeat domain 53 1 2
MIRT615157 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT615549 TNFSF15 tumor necrosis factor (ligand) superfamily, member 15 1 1
MIRT617736 ATCAY ataxia, cerebellar, Cayman type 1 2
MIRT618237 PGBD4 piggyBac transposable element derived 4 1 1
MIRT618289 ZNF682 zinc finger protein 682 1 1
MIRT618692 CAMK1D calcium/calmodulin-dependent protein kinase ID 1 1
MIRT619031 SLC35G1 solute carrier family 35, member G1 1 1
MIRT619053 TTC4 tetratricopeptide repeat domain 4 1 1
MIRT619079 DNAAF3 dynein, axonemal, assembly factor 3 1 1
MIRT619258 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT619659 CORO2A coronin, actin binding protein, 2A 1 2
MIRT619759 MYO1F myosin IF 1 2
MIRT620183 TRIM72 tripartite motif containing 72 1 1
MIRT620889 ANO7 anoctamin 7 1 1
MIRT620905 MUT methylmalonyl CoA mutase 1 1
MIRT621044 PPP2R3A protein phosphatase 2, regulatory subunit B'', alpha 1 1
MIRT621088 WDR12 WD repeat domain 12 1 1
MIRT621237 SIGLEC9 sialic acid binding Ig-like lectin 9 1 2
MIRT621448 TCN2 transcobalamin II 1 1
MIRT621707 TRIP11 thyroid hormone receptor interactor 11 1 1
MIRT621721 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT622504 RBM3 RNA binding motif (RNP1, RRM) protein 3 1 2
MIRT623203 MTSS1L metastasis suppressor 1-like 1 1
MIRT623514 KCNK3 potassium channel, subfamily K, member 3 1 1
MIRT623799 GK5 glycerol kinase 5 (putative) 1 2
MIRT624223 CXorf21 chromosome X open reading frame 21 1 1
MIRT625681 SYAP1 synapse associated protein 1 1 1
MIRT625818 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT626154 NFYA nuclear transcription factor Y, alpha 1 1
MIRT626174 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 2
MIRT626202 PNRC1 proline-rich nuclear receptor coactivator 1 1 2
MIRT626803 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT626912 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT627968 NIPAL1 NIPA-like domain containing 1 1 1
MIRT629503 AS3MT arsenic (+3 oxidation state) methyltransferase 1 1
MIRT629823 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT630112 PNPLA3 patatin-like phospholipase domain containing 3 1 1
MIRT630643 ELK1 ELK1, member of ETS oncogene family 1 1
MIRT631462 FBXO47 F-box protein 47 1 1
MIRT631508 FFAR4 omega-3 fatty acid receptor 1 1 1
MIRT631740 NKX2-1 NK2 homeobox 1 1 1
MIRT632154 CWC25 CWC25 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT632501 RAB13 RAB13, member RAS oncogene family 1 1
MIRT632582 POLQ polymerase (DNA directed), theta 1 1
MIRT633103 CBX5 chromobox homolog 5 1 1
MIRT633206 WFDC6 WAP four-disulfide core domain 6 1 1
MIRT633814 WDR92 WD repeat domain 92 1 1
MIRT634081 APOH apolipoprotein H (beta-2-glycoprotein I) 1 1
MIRT634291 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 1
MIRT634636 HIP1 huntingtin interacting protein 1 1 2
MIRT634883 SENP8 SUMO/sentrin specific peptidase family member 8 1 1
MIRT634936 GTF2H2C general transcription factor IIH, polypeptide 2C 1 1
MIRT635444 SLC25A44 solute carrier family 25, member 44 1 1
MIRT635751 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha 1 1
MIRT636475 KLHL7 kelch-like 7 (Drosophila) 1 1
MIRT636869 ARSE arylsulfatase E (chondrodysplasia punctata 1) 1 1
MIRT637182 TMEM50A transmembrane protein 50A 1 1
MIRT638017 TTC31 tetratricopeptide repeat domain 31 1 1
MIRT638109 YPEL1 yippee-like 1 (Drosophila) 1 1
MIRT638739 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT638924 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT639858 TBC1D16 TBC1 domain family, member 16 1 1
MIRT640453 IP6K2 inositol hexakisphosphate kinase 2 1 2
MIRT640896 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT641015 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT641259 C8orf46 chromosome 8 open reading frame 46 1 1
MIRT641762 ZNF207 zinc finger protein 207 1 1
MIRT641819 ULK2 unc-51-like kinase 2 (C. elegans) 1 1
MIRT641969 PWWP2A PWWP domain containing 2A 1 1
MIRT642223 RABAC1 Rab acceptor 1 (prenylated) 1 1
MIRT642330 ZNF573 zinc finger protein 573 1 1
MIRT642473 C16orf58 chromosome 16 open reading frame 58 1 1
MIRT642610 APOPT1 apoptogenic 1, mitochondrial 1 1
MIRT643113 SMIM7 small integral membrane protein 7 1 1
MIRT643598 SPAG16 sperm associated antigen 16 1 1
MIRT643643 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT643902 TCEB2 transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) 1 1
MIRT644048 WWC2 WW and C2 domain containing 2 1 1
MIRT644189 LAT2 linker for activation of T cells family, member 2 1 1
MIRT644530 TMEM134 transmembrane protein 134 1 1
MIRT644842 SEC14L4 SEC14-like 4 (S. cerevisiae) 1 1
MIRT645545 RBL1 retinoblastoma-like 1 (p107) 1 1
MIRT646835 TLDC1 KIAA1609 1 1
MIRT647519 PPIE peptidylprolyl isomerase E (cyclophilin E) 1 1
MIRT647786 ASB8 ankyrin repeat and SOCS box containing 8 1 1
MIRT648208 TRIM35 tripartite motif containing 35 1 1
MIRT648267 ZNF582 zinc finger protein 582 1 1
MIRT648368 CYB5A cytochrome b5 type A (microsomal) 1 1
MIRT648452 LEAP2 liver expressed antimicrobial peptide 2 1 1
MIRT648672 ZNF626 zinc finger protein 626 1 1
MIRT648832 C8orf37 chromosome 8 open reading frame 37 1 1
MIRT648921 ZNF551 zinc finger protein 551 1 1
MIRT649211 KIAA1715 KIAA1715 1 1
MIRT649728 LTBP2 latent transforming growth factor beta binding protein 2 1 1
MIRT649821 PSMC1 proteasome (prosome, macropain) 26S subunit, ATPase, 1 1 1
MIRT650419 FKBP9 FK506 binding protein 9, 63 kDa 1 1
MIRT650938 CTNS cystinosin, lysosomal cystine transporter 1 1
MIRT651025 ZNF699 zinc finger protein 699 1 1
MIRT651604 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT652017 TTYH3 tweety homolog 3 (Drosophila) 1 1
MIRT652285 TNS4 tensin 4 1 1
MIRT652335 TMOD3 tropomodulin 3 (ubiquitous) 1 2
MIRT652352 TMOD2 tropomodulin 2 (neuronal) 1 2
MIRT652359 TMEM92 transmembrane protein 92 1 1
MIRT652404 TMEM33 transmembrane protein 33 1 1
MIRT652917 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT653393 SLFN13 schlafen family member 13 1 1
MIRT653609 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT653858 SHE Src homology 2 domain containing E 1 1
MIRT654009 SCO1 SCO1 cytochrome c oxidase assembly protein 1 1
MIRT654056 S1PR1 sphingosine-1-phosphate receptor 1 1 1
MIRT654233 RNF165 ring finger protein 165 1 1
MIRT654504 RABIF RAB interacting factor 1 1
MIRT654973 PLEKHA2 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 1 1
MIRT655024 PLA2G16 phospholipase A2, group XVI 1 1
MIRT655509 PAIP2B poly(A) binding protein interacting protein 2B 1 1
MIRT655745 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT656186 MON1B MON1 homolog B (yeast) 1 1
MIRT657019 KCNK5 potassium channel, subfamily K, member 5 1 1
MIRT657104 JDP2 Jun dimerization protein 2 1 1
MIRT657466 C21orf33 chromosome 21 open reading frame 33 1 1
MIRT658458 FAM13B family with sequence similarity 13, member B 1 1
MIRT658577 EPHB2 EPH receptor B2 1 1
MIRT658696 EMC3 ER membrane protein complex subunit 3 1 1
MIRT658869 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT659038 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 1 1
MIRT659449 CNNM2 cyclin M2 1 1
MIRT659591 CEP135 centrosomal protein 135kDa 1 1
MIRT659645 CDK2 cyclin-dependent kinase 2 1 1
MIRT660332 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT660548 ARHGAP29 Rho GTPase activating protein 29 1 1
MIRT661925 MLN motilin 1 1
MIRT662388 ICA1L islet cell autoantigen 1,69kDa-like 1 2
MIRT662936 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT662982 PAK3 p21 protein (Cdc42/Rac)-activated kinase 3 1 1
MIRT663592 TRPV2 transient receptor potential cation channel, subfamily V, member 2 1 1
MIRT664898 EMC7 ER membrane protein complex subunit 7 1 1
MIRT665117 DNASE2 deoxyribonuclease II, lysosomal 1 1
MIRT666531 RNF157 ring finger protein 157 1 1
MIRT667341 MSANTD3 Myb/SANT-like DNA-binding domain containing 3 1 1
MIRT668932 COL9A2 collagen, type IX, alpha 2 1 1
MIRT669579 AKIRIN1 akirin 1 1 1
MIRT669700 ABHD2 abhydrolase domain containing 2 1 1
MIRT670609 NPHP1 nephronophthisis 1 (juvenile) 1 1
MIRT670886 CYTIP cytohesin 1 interacting protein 1 1
MIRT670937 LIPG lipase, endothelial 1 1
MIRT671957 SPPL3 signal peptide peptidase like 3 1 1
MIRT673112 MFSD2A major facilitator superfamily domain containing 2A 1 1
MIRT673403 WNT7B wingless-type MMTV integration site family, member 7B 1 1
MIRT673545 DEGS1 delta(4)-desaturase, sphingolipid 1 1 1
MIRT674411 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 1 1
MIRT676075 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT676146 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT676294 SLC25A37 solute carrier family 25 (mitochondrial iron transporter), member 37 1 1
MIRT676444 PLEKHM3 pleckstrin homology domain containing, family M, member 3 1 1
MIRT676502 GJD3 gap junction protein, delta 3, 31.9kDa 1 1
MIRT676625 CSNK1E casein kinase 1, epsilon 1 1
MIRT676658 LRRC27 leucine rich repeat containing 27 1 1
MIRT676693 LAIR1 leukocyte-associated immunoglobulin-like receptor 1 1 1
MIRT676779 NPHS1 nephrosis 1, congenital, Finnish type (nephrin) 1 1
MIRT676788 CXorf38 chromosome X open reading frame 38 1 3
MIRT676939 EMP2 epithelial membrane protein 2 1 1
MIRT676949 S1PR3 sphingosine-1-phosphate receptor 3 1 1
MIRT677098 MFSD11 major facilitator superfamily domain containing 11 1 2
MIRT677239 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT677370 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT677490 GTF2H2 general transcription factor IIH, polypeptide 2, 44kDa 1 1
MIRT677539 TM4SF5 transmembrane 4 L six family member 5 1 1
MIRT677677 PRPF38A PRP38 pre-mRNA processing factor 38 (yeast) domain containing A 1 1
MIRT677765 GRM6 glutamate receptor, metabotropic 6 1 1
MIRT678016 SPIC Spi-C transcription factor (Spi-1/PU.1 related) 1 1
MIRT678038 CCS copper chaperone for superoxide dismutase 1 1
MIRT678358 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT678445 PARD6G par-6 partitioning defective 6 homolog gamma (C. elegans) 1 1
MIRT678508 LCTL lactase-like 1 1
MIRT678523 ZNF347 zinc finger protein 347 1 2
MIRT678643 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT678725 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT678925 XPOT exportin, tRNA 1 1
MIRT678988 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT679073 MANEAL mannosidase, endo-alpha-like 1 1
MIRT679116 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 1 1
MIRT679280 MIPOL1 mirror-image polydactyly 1 1 1
MIRT679378 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT679700 MTRNR2L5 MT-RNR2-like 5 1 1
MIRT679714 RPL24 ribosomal protein L24 1 1
MIRT679889 SNX2 sorting nexin 2 1 1
MIRT679936 MCTS1 malignant T cell amplified sequence 1 1 1
MIRT679993 RUNDC1 RUN domain containing 1 1 1
MIRT680064 CD96 CD96 molecule 1 1
MIRT680080 THAP1 THAP domain containing, apoptosis associated protein 1 1 1
MIRT680093 SLC35F6 chromosome 2 open reading frame 18 1 2
MIRT680452 PDE6A phosphodiesterase 6A, cGMP-specific, rod, alpha 1 1
MIRT680489 XIAP X-linked inhibitor of apoptosis 1 1
MIRT681820 N4BP2L2 NEDD4 binding protein 2-like 2 1 1
MIRT683311 C19orf40 chromosome 19 open reading frame 40 1 1
MIRT683378 ESR2 estrogen receptor 2 (ER beta) 1 1
MIRT683419 ZNF878 zinc finger protein 878 1 1
MIRT683486 ZNF7 zinc finger protein 7 1 1
MIRT683619 PCP4L1 Purkinje cell protein 4 like 1 1 1
MIRT683682 MICA MHC class I polypeptide-related sequence A 1 1
MIRT683864 OCIAD1 OCIA domain containing 1 1 1
MIRT683938 MYLK3 myosin light chain kinase 3 1 2
MIRT683969 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT684072 TLR7 toll-like receptor 7 1 1
MIRT684125 CEP104 centrosomal protein 104kDa 1 1
MIRT684473 INTS7 integrator complex subunit 7 1 1
MIRT684484 GPR137B G protein-coupled receptor 137B 1 1
MIRT684704 LRRD1 leucine-rich repeats and death domain containing 1 1 1
MIRT685188 DCTN5 dynactin 5 (p25) 1 1
MIRT685238 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT685513 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT685619 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT685655 C11orf1 chromosome 11 open reading frame 1 1 1
MIRT685701 BHMT2 betaine--homocysteine S-methyltransferase 2 1 1
MIRT685734 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT685775 ZNF426 zinc finger protein 426 1 1
MIRT685876 RTN2 reticulon 2 1 1
MIRT685941 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT686099 TNIP3 TNFAIP3 interacting protein 3 1 1
MIRT686149 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT686278 WWC1 WW and C2 domain containing 1 1 1
MIRT686310 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT686355 USP15 ubiquitin specific peptidase 15 1 1
MIRT686381 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT686472 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT686484 TRIOBP TRIO and F-actin binding protein 1 1
MIRT686685 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT686821 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT686908 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT686977 SERINC1 serine incorporator 1 1 1
MIRT687036 RNF115 ring finger protein 115 1 1
MIRT687071 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT687245 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT687395 NSUN4 NOP2/Sun domain family, member 4 1 1
MIRT687640 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT687830 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT687853 ISCA2 iron-sulfur cluster assembly 2 homolog (S. cerevisiae) 1 1
MIRT687922 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT688023 GPN2 GPN-loop GTPase 2 1 1
MIRT688266 FAM213A family with sequence similarity 213, member A 1 1
MIRT688500 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT688628 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 1
MIRT688672 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT688822 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT689061 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT689116 ZBTB25 zinc finger and BTB domain containing 25 1 1
MIRT689165 ZNF665 zinc finger protein 665 1 1
MIRT689792 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT689837 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT690069 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT690688 PTCHD3 patched domain containing 3 1 1
MIRT690731 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT690978 ZNF578 zinc finger protein 578 1 1
MIRT691070 NUGGC nuclear GTPase, germinal center associated 1 1
MIRT691323 KIAA1841 KIAA1841 1 1
MIRT691489 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT692063 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT692204 NOL9 nucleolar protein 9 1 1
MIRT692315 RFK riboflavin kinase 1 1
MIRT692375 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT692435 METTL8 methyltransferase like 8 1 1
MIRT692472 APEX2 APEX nuclease (apurinic/apyrimidinic endonuclease) 2 1 1
MIRT692538 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT692600 GDF5OS growth differentiation factor 5 opposite strand 1 1
MIRT692781 SYNPO2L synaptopodin 2-like 1 1
MIRT692872 RBM41 RNA binding motif protein 41 1 1
MIRT692976 LGSN lengsin, lens protein with glutamine synthetase domain 1 1
MIRT693347 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT694048 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT694091 KIAA0930 KIAA0930 1 1
MIRT694658 C14orf119 chromosome 14 open reading frame 119 1 1
MIRT694811 STX4 syntaxin 4 1 1
MIRT694930 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 1 1
MIRT695658 MAN2B2 mannosidase, alpha, class 2B, member 2 1 1
MIRT695828 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT695970 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT696179 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT696328 FAM153B family with sequence similarity 153, member B 1 1
MIRT696858 UBOX5 U-box domain containing 5 1 1
MIRT696900 C14orf105 chromosome 14 open reading frame 105 1 1
MIRT697242 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697386 ZMAT3 zinc finger, matrin-type 3 1 1
MIRT698328 TMEM127 transmembrane protein 127 1 1
MIRT698923 SPEM1 spermatid maturation 1 1 1
MIRT699262 SLC6A4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT699313 SLC35F5 solute carrier family 35, member F5 1 2
MIRT699628 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT699818 SCN2B sodium channel, voltage-gated, type II, beta subunit 1 1
MIRT700044 RPL14 ribosomal protein L14 1 1
MIRT700100 RNF19B ring finger protein 19B 1 1
MIRT700506 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 1
MIRT700751 PLAA phospholipase A2-activating protein 1 1
MIRT700834 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT701202 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT701292 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT701823 MRPL37 mitochondrial ribosomal protein L37 1 1
MIRT702046 METTL21A methyltransferase like 21A 1 1
MIRT702438 KIAA1549 KIAA1549 1 1
MIRT703033 HAS2 hyaluronan synthase 2 1 2
MIRT703087 GPRIN3 GPRIN family member 3 1 1
MIRT703842 ETV3 ets variant 3 1 1
MIRT704108 DRAXIN dorsal inhibitory axon guidance protein 1 1
MIRT704142 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT704179 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT704192 LDHD lactate dehydrogenase D 1 1
MIRT704758 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT705345 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT706024 ZSCAN2 zinc finger and SCAN domain containing 2 1 1
MIRT706040 F2R coagulation factor II (thrombin) receptor 1 1
MIRT706103 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT706346 STAC2 SH3 and cysteine rich domain 2 1 1
MIRT706512 MTMR9 myotubularin related protein 9 1 1
MIRT706798 RAI1 retinoic acid induced 1 1 1
MIRT708366 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT708653 LYRM7 LYR motif containing 7 1 1
MIRT708813 CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT709069 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT709501 RHOH ras homolog family member H 1 1
MIRT709533 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT709958 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 1
MIRT710521 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT711654 RAB21 RAB21, member RAS oncogene family 1 1
MIRT711849 AMOTL2 angiomotin like 2 1 1
MIRT712974 KANSL3 KAT8 regulatory NSL complex subunit 3 1 1
MIRT713935 PIGR polymeric immunoglobulin receptor 1 1
MIRT714303 ZNF454 zinc finger protein 454 1 1
MIRT714609 EXO5 exonuclease 5 1 1
MIRT714993 TSPAN11 tetraspanin 11 1 1
MIRT715730 PIAS2 protein inhibitor of activated STAT, 2 1 1
MIRT715791 TBL3 transducin (beta)-like 3 1 1
MIRT716541 GOLGA2 golgin A2 1 1
MIRT716624 CRCP CGRP receptor component 1 1
MIRT717144 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 1 1
MIRT717414 ZCCHC24 zinc finger, CCHC domain containing 24 1 1
MIRT717527 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT717916 LRRC15 leucine rich repeat containing 15 1 1
MIRT717971 PXMP4 peroxisomal membrane protein 4, 24kDa 1 1
MIRT718744 ATP9A ATPase, class II, type 9A 1 1
MIRT719068 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
MIRT719098 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT719144 DPYSL5 dihydropyrimidinase-like 5 1 1
MIRT719223 CAMK4 calcium/calmodulin-dependent protein kinase IV 1 1
MIRT719923 PRKAB1 protein kinase, AMP-activated, beta 1 non-catalytic subunit 1 1
MIRT720721 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 1 1
MIRT721507 CARHSP1 calcium regulated heat stable protein 1, 24kDa 1 1
MIRT721911 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 1 1
MIRT722613 TEAD1 TEA domain family member 1 (SV40 transcriptional enhancer factor) 1 1
MIRT722704 ZNF460 zinc finger protein 460 1 1
MIRT722874 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT723730 ZHX3 zinc fingers and homeoboxes 3 1 1
MIRT723998 LMTK2 lemur tyrosine kinase 2 1 1
MIRT724002 TMEM174 transmembrane protein 174 1 1
MIRT724383 NEK8 NIMA (never in mitosis gene a)- related kinase 8 1 1
MIRT724547 HAUS2 HAUS augmin-like complex, subunit 2 1 1
MIRT724839 ATAD2B ATPase family, AAA domain containing 2B 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*