Accession ID: MIRT005744 [miRNA, hsa-miR-451a :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-451aLinkOut: [miRBase ]
Description Homo sapiens miR-451a stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-451a
Mature Sequence 17| AAACCGUUACCAUUACUGAGUU |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-451a Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2
Description B-cell CLL/lymphoma 2
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0006   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_0006|3'UTR
   1 TGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGT
  81 ACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACA
 161 CACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATT
 241 ATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAG
 321 CACCGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCA
 401 TCTGAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGT
 481 GTTCATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCT
 561 CCCTGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAG
 641 ATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTT
 721 TTTAAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTA
 801 TATTCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTT
 881 GAGGAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCT
 961 TTTAGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACT
1041 GGCCTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCA
1121 AGAAAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGG
1201 AGCCACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATG
1281 GTGAAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCT
1361 TGGCCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAG
1441 GTGTCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAA
1521 AACCTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGG
1601 TGGGGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGA
1681 ATCAGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGT
1761 ACTCTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGT
1841 TTTTAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTG
1921 ATTCTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCAC
2001 TGAGGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCC
2081 CTTTGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATG
2161 TTTGGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGA
2241 CCTTTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTT
2321 CTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGA
2401 AGCCAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATT
2481 TTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAAT
2561 GGAGTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTT
2641 TAATATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAG
2721 GTCACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCA
2801 GCCTCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTA
2881 AAAACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATC
2961 TAATTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTC
3041 TTTATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACT
3121 TTCCAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCC
3201 CTCGCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATT
3281 TGGCAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAA
3361 ACAAGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGT
3441 TTTATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGG
3521 AGTTATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGA
3601 GTGAACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTC
3681 TAATTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTAC
3761 TCTATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGA
3841 TCTTATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGC
3921 TTATGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACA
4001 AAGGACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGA
4081 AGTTTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGT
4161 GACAAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCG
4241 TTTGGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAAC
4321 AGGATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTT
4401 TATAAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTC
4481 CATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATG
4561 AATGGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCT
4641 GCATACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTA
4721 TTAATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCA
4801 GATAGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGC
4881 TTTCTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTAT
4961 TTTTGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTAC
5041 CTTCCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTA
5121 AGGATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTG
5201 GAAAAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATAC
5281 TG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugaGUCAUUACCAUUGCCAAa 5'
              ::||| | ||| ||||| 
Target 5' tgaaTGGTACT-GTACCGGTTc 3'
4559 - 4579 129.00 -9.90
2
miRNA  3' uuGAGUCAUUACCAUUGCCAaa 5'
            :|::| |:| | ||:|||  
Target 5' cgTTTGGCAGT-GCAATGGTat 3'
4239 - 4259 119.00 -10.06
3
miRNA  3' uugAGUCAUUACCAUUGCCAAa 5'
             | || || |||:|: ||| 
Target 5' ttgTGAGCAAAGGTGATCGTTt 3'
1875 - 1896 107.00 -7.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-451a :: BCL2    [ Functional MTI ]
Validation Method qRT-PCR , Western blot
Conditions A172 , LN229 , U251
Location of target site 3'UTR
Tools used in this research unknown
Original Description (Extracted from the article) ... We demonstrate that over-expression of miR-451 in human glioblastoma cell lines A172, LN229 and U251 significantly impacts cell proliferation, invasion and apoptosis. Our results suggest that these biologic effects may be due to modulated expression of a panel of proteins including Cyclin D1, p27, MMP 2/9 and Bcl-2. In addition, miR-451 regulates Akt expression in our studies. The transcription factor Akt1 plays a critical role in controlling a range of diverse cellular functions ...

- Nan, Y. Han, L. Zhang, A. Wang, G. Jia, Z. et al., 2010, Brain Res.

Article - Nan, Y. Han, L. Zhang, A. Wang, G. Jia, Z. et al.
- Brain Res, 2010
MicroRNAs (miRNAs) are small non-coding RNAs that negatively regulate gene expression at the post-transcriptional and/or translational level by binding loosely complimentary sequences in the 3'untranslated regions (UTRs) of target mRNAs. Increased expression of several miRNAs, specifically hsa-miR-21, have been reported to modulate glioma development. Here we report downregulation of miR-451 in A172, LN229 and U251 human glioblastoma cells. Increased expression of miR-451 by administration of miR-451 mimics oligonucleotides reversed the biology of each of the three cell lines, inhibiting cell growth, inducing G0/G1 phase arrest and increasing cell apoptosis. Further, treatment with miR-451 mimics oligonucleotides diminished the invasive capacity of these cells, as the number of cells invading through matrigel was significantly decreased. Akt1, CyclinD1, MMP-2, MMP-9 and Bcl-2 protein expression decreased, and p27 expression increased in a dose-dependent manner with miR-451 mimics oligonucleotides. Taken together, these studies reveal miR-451 impacts glioblastoma cell proliferation, invasion and apoptosis, perhaps via regulation of the PI3K/AKT signaling pathway. We propose an essential role for miR-451 as a tumor-suppressor of human glioma.
LinkOut: [PMID: 20816946]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
12 hsa-miR-451a Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000046 MIF macrophage migration inhibitory factor (glycosylation-inhibiting factor) 5 2
MIRT000500 CAB39 calcium binding protein 39 5 2
MIRT005656 ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 4 1
MIRT005740 AKT1 v-akt murine thymoma viral oncogene homolog 1 2 1
MIRT005742 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 2 1
MIRT005743 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 2 1
MIRT005744 BCL2 B-cell CLL/lymphoma 2 2 1
MIRT006358 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 1
MIRT006533 RAB14 RAB14, member RAS oncogene family 4 1
MIRT006597 TMED7 transmembrane emp24 protein transport domain containing 7 2 1
MIRT016628 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 1
MIRT016629 UBE2H ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) 1 1