Accession ID: MIRT005763 [miRNA, hsa-miR-15a-5p :: TP53, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-15aLinkOut: [miRBase ]
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Mature Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-15a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TP53 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ92943, LFS1, TRP53, p53
Description tumor protein p53
Transcript NM_0011261    LinkOut: [ RefSeq ]
Other Transcripts NM_0011261 , NM_0005 , NM_0011261 , NM_0011261 , NM_0011261 , NM_0011261   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TP53 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TP53
(miRNA target sites are highlighted)
>TP53|NM_0011261|3'UTR
   1 TAAAGAGAGCATGAAAATGGTTCTATGACTTTGCCTGATACAGATGCTACTTGACTTACGATGGTGTTACTTCCTGATAA
  81 ACTCGTCGTAAGTTGAAAATATTATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTC
 161 AAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTAC
 241 CTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTGTTCCCCACTGAC
 321 AGCCTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTC
 401 AGAAGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGG
 481 AGGAGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGT
 561 TCTTGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTC
 641 CCTCACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGCATTTGCACCTACCTCACAGAGTGCATT
 721 GTGAGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGAACTTGACCCCCTTGAG
 801 GGTGCTTGTTCCCTCTCCCTGTTGGTCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTC
 881 AAGTCTCTGCTGGCCCAGCCAAACCCTGTCTGACAACCTCTTGGTGAACCTTAGTACCTAAAAGGAAATCTCACCCCATC
 961 CCACACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATTTCT
1041 TTTTTCTTTTTTTTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTG
1121 ATCTTGGCTTACTGCAGCCTTTGCCTCCCCGGCTCGAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTC
1201 ATGCCACCATGGCCAGCCAACTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTTGCCCAGGCTGGTCTCAAACTCC
1281 TGGGCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACAATTGTGAGCCACCACGTCCAGCTGGAAGGG
1361 TCAACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTT
1441 TTATATCGATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTG
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: TP53    [ Functional MTI ]
Validation Method Immunoblot , Luciferase reporter assay
Conditions MEG-01 , K562 , H1299 , A549 , HeLa
Disease chronic lymphocytic leukemia
Location of target site 3'UTR
Original Description (Extracted from the article) ... A luciferase reporter assay showed that both miR-15a and miR-16 directly target the identified TP53 binding site and significantly reduced the luciferase reporter activity compared with a scrambled oligonucleotide-negative control// ...

- Fabbri, M. Bottoni, A. Shimizu, M. Spizzo, et al., 2011, JAMA : the journal of the American Medical Association.

Article - Fabbri, M. Bottoni, A. Shimizu, M. Spizzo, et al.
- JAMA : the journal of the American Medical Association, 2011
CONTEXT: Chromosomal abnormalities (namely 13q, 17p, and 11q deletions) have prognostic implications and are recurrent in chronic lymphocytic leukemia (CLL), suggesting that they are involved in a common pathogenetic pathway; however, the molecular mechanism through which chromosomal abnormalities affect the pathogenesis and outcome of CLL is unknown. OBJECTIVE: To determine whether the microRNA miR-15a/miR-16-1 cluster (located at 13q), tumor protein p53 (TP53, located at 17p), and miR-34b/miR-34c cluster (located at 11q) are linked in a molecular pathway that explains the pathogenetic and prognostic implications (indolent vs aggressive form) of recurrent 13q, 17p, and 11q deletions in CLL. DESIGN, SETTING, AND PATIENTS: CLL Research Consortium institutions provided blood samples from untreated patients (n = 206) diagnosed with B-cell CLL between January 2000 and April 2008. All samples were evaluated for the occurrence of cytogenetic abnormalities as well as the expression levels of the miR-15a/miR-16-1 cluster, miR-34b/miR-34c cluster, TP53, and zeta-chain (TCR)-associated protein kinase 70 kDa (ZAP70), a surrogate prognostic marker of CLL. The functional relationship between these genes was studied using in vitro gain- and loss-of-function experiments in cell lines and primary samples and was validated in a separate cohort of primary CLL samples. MAIN OUTCOME MEASURES: Cytogenetic abnormalities; expression levels of the miR-15a/miR-16-1 cluster, miR-34 family, TP53 gene, downstream effectors cyclin-dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A) and B-cell CLL/lymphoma 2 binding component 3 (BBC3), and ZAP70 gene; genetic interactions detected by chromatin immunoprecipitation. RESULTS: In CLLs with 13q deletions the miR-15a/miR-16-1 cluster directly targeted TP53 (mean luciferase activity for miR-15a vs scrambled control, 0.68 relative light units (RLU) [95% confidence interval {CI}, 0.63-0.73]; P = .02; mean for miR-16 vs scrambled control, 0.62 RLU [95% CI, 0.59-0.65]; P = .02) and its downstream effectors. In leukemic cell lines and primary CLL cells, TP53 stimulated the transcription of miR-15/miR-16-1 as well as miR-34b/miR-34c clusters, and the miR-34b/miR-34c cluster directly targeted the ZAP70 kinase (mean luciferase activity for miR-34a vs scrambled control, 0.33 RLU [95% CI, 0.30-0.36]; P = .02; mean for miR-34b vs scrambled control, 0.31 RLU [95% CI, 0.30-0.32]; P = .01; and mean for miR-34c vs scrambled control, 0.35 RLU [95% CI, 0.33-0.37]; P = .02). CONCLUSIONS: A microRNA/TP53 feedback circuitry is associated with CLL pathogenesis and outcome. This mechanism provides a novel pathogenetic model for the association of 13q deletions with the indolent form of CLL that involves microRNAs, TP53, and ZAP70.
LinkOut: [PMID: 21205967]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
132 hsa-miR-15a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 polycomb ring finger oncogene 3 1
MIRT000282 WNT3A wingless-type MMTV integration site family, member 3A 3 2
MIRT000283 MYB v-myb myeloblastosis viral oncogene homolog (avian) 5 3
MIRT000284 CDC25A cell division cycle 25 homolog A (S. pombe) 2 1
MIRT000285 CCND2 cyclin D2 3 3
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 B-cell CLL/lymphoma 2 5 12
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2 (Drosophila) 2 1
MIRT000823 TMEM251 chromosome 14 open reading frame 109 2 1
MIRT000825 CARD8 caspase recruitment domain family, member 8 2 1
MIRT000827 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63kDa 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein-like 2 2 1
MIRT000835 ECHDC1 enoyl CoA hydratase domain containing 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3-like 2 1
MIRT000851 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 2 1
MIRT000853 H3F3B H3 histone, family 3B (H3.3B) 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase-like hydrolase domain containing 2 2 1
MIRT000859 HERC6 hect domain and RLD 6 2 1
MIRT000863 HRSP12 heat-responsive protein 12 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock 70kDa protein 1A 2 1
MIRT000868 JUN jun oncogene 2 1
MIRT000878 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 2 1
MIRT000880 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 2 1
MIRT000884 OMA1 OMA1 homolog, zinc metallopeptidase (S. cerevisiae) 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase-like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase, beta 2 1
MIRT000892 PMS1 PMS1 postmeiotic segregation increased 1 (S. cerevisiae) 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 primase, DNA, polypeptide 1 (49kDa) 2 1
MIRT000898 RAD51C RAD51 homolog C (S. cerevisiae) 2 1
MIRT000900 RHOT1 ras homolog gene family, member T1 2 1
MIRT000902 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 2 1
MIRT000906 SLC35A1 solute carrier family 35 (CMP-sialic acid transporter), member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35, member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 6
MIRT001228 CCNE1 cyclin E1 5 4
MIRT001802 BACE1 beta-site APP-cleaving enzyme 1 2 1
MIRT002946 DMTF1 cyclin D binding myb-like transcription factor 1 2 1
MIRT003333 BRCA1 breast cancer 1, early onset 2 2
MIRT003334 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 2
MIRT003872 WIPF1 WAS/WASL interacting protein family, member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 2 1
MIRT003874 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69, member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 coiled-coil domain containing 111 2 1
MIRT003883 C2orf43 chromosome 2 open reading frame 43 2 1
MIRT003884 C4orf27 chromosome 4 open reading frame 27 2 1
MIRT003885 NIPAL2 NIPA-like domain containing 2 2 1
MIRT003886 TRMT13 coiled-coil domain containing 76 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta (A4) precursor protein 2 1
MIRT004046 UCP2 uncoupling protein 2 (mitochondrial, proton carrier) 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 4 3
MIRT004680 TSPYL2 TSPY-like 2 2 1
MIRT004829 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 (keratinocyte growth factor) 2 1
MIRT006176 CLCN3 chloride channel 3 4 1
MIRT006177 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 4 1
MIRT006181 MN1 meningioma (disrupted in balanced translocation) 1 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 3 1
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon, gamma 2 1
MIRT006998 PURA purine-rich element binding protein A 1 1
MIRT007090 RECK reversion-inducing-cysteine-rich protein with kazal motifs 2 1
MIRT032077 DLK1 delta-like 1 homolog (Drosophila) 2 1
MIRT051311 PLA2G2D phospholipase A2, group IID 1 1
MIRT051312 ACVR1B activin A receptor, type IB 1 1
MIRT051313 IKBKG inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase, modifier subunit 1 1
MIRT051315 PCF11 PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) 1 1
MIRT051316 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP 30kDa subunit 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y-like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3, acidic 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT051329 CCT6B chaperonin containing TCP1, subunit 6B (zeta 2) 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC-like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 1
MIRT051342 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 1 1
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif-containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT051349 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing 1 1