Accession ID: MIRT005764 [miRNA, hsa-miR-16-5p :: TP53, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-16-1LinkOut: [miRBase ]
Description Homo sapiens miR-16-1 stem-loop
Comment Human miR-16 has been cloned by independent groups . A second putative mir-16 hairpin precursor is located on chromosome 3 (MIR:MI0000738).
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-16-5p
Mature Sequence 14| UAGCAGCACGUAAAUAUUGGCG |35
Evidence Experimental
Experiments Northern
Putative hsa-miR-16-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TP53 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ92943, LFS1, TRP53, p53
Description tumor protein p53
Transcript NM_0011261    LinkOut: [ RefSeq ]
Other Transcripts NM_0011261 , NM_0005 , NM_0011261 , NM_0011261 , NM_0011261 , NM_0011261   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TP53 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TP53
(miRNA target sites are highlighted)
>TP53|NM_0011261|3'UTR
   1 TAAAGAGAGCATGAAAATGGTTCTATGACTTTGCCTGATACAGATGCTACTTGACTTACGATGGTGTTACTTCCTGATAA
  81 ACTCGTCGTAAGTTGAAAATATTATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTC
 161 AAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTAC
 241 CTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTGTTCCCCACTGAC
 321 AGCCTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTC
 401 AGAAGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGG
 481 AGGAGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGT
 561 TCTTGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTC
 641 CCTCACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGCATTTGCACCTACCTCACAGAGTGCATT
 721 GTGAGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGAACTTGACCCCCTTGAG
 801 GGTGCTTGTTCCCTCTCCCTGTTGGTCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTC
 881 AAGTCTCTGCTGGCCCAGCCAAACCCTGTCTGACAACCTCTTGGTGAACCTTAGTACCTAAAAGGAAATCTCACCCCATC
 961 CCACACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATTTCT
1041 TTTTTCTTTTTTTTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTG
1121 ATCTTGGCTTACTGCAGCCTTTGCCTCCCCGGCTCGAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTC
1201 ATGCCACCATGGCCAGCCAACTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTTGCCCAGGCTGGTCTCAAACTCC
1281 TGGGCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACAATTGTGAGCCACCACGTCCAGCTGGAAGGG
1361 TCAACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTT
1441 TTATATCGATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gcgGUUAUAAAUGCACGACGau 5'
             |||||    : ||||||  
Target 5' ttaCAATAAAACTTTGCTGCca 3'
1459 - 1480 131.00 -9.60
2
miRNA  3' gcGGUUAUAAAUGC---ACGACgau 5'
            || |||| |::|   |||||   
Target 5' ggCCCATATCTGTGAAATGCTGgca 3'
670 - 694 124.00 -13.50
3
miRNA  3' gcGGUUAU---AAAUGCACGACGau 5'
            :||| |   ||||| | ||||  
Target 5' ggTCAACATCTTTTACATTCTGCaa 3'
1359 - 1383 116.00 -8.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: TP53    [ Functional MTI ]
Validation Method Immunoblot , Luciferase reporter assay
Conditions MEG-01 , K562 , H1299 , A549 , HeLa
Disease chronic lymphocytic leukemia
Location of target site 3'UTR
Original Description (Extracted from the article) ... A luciferase reporter assay showed that both miR-15a and miR-16 directly target the identified TP53 binding site and significantly reduced the luciferase reporter activity compared with a scrambled oligonucleotide-negative control// ...

- Fabbri, M. Bottoni, A. Shimizu, M. Spizzo, et al., 2011, JAMA : the journal of the American Medical Association.

Article - Fabbri, M. Bottoni, A. Shimizu, M. Spizzo, et al.
- JAMA : the journal of the American Medical Association, 2011
CONTEXT: Chromosomal abnormalities (namely 13q, 17p, and 11q deletions) have prognostic implications and are recurrent in chronic lymphocytic leukemia (CLL), suggesting that they are involved in a common pathogenetic pathway; however, the molecular mechanism through which chromosomal abnormalities affect the pathogenesis and outcome of CLL is unknown. OBJECTIVE: To determine whether the microRNA miR-15a/miR-16-1 cluster (located at 13q), tumor protein p53 (TP53, located at 17p), and miR-34b/miR-34c cluster (located at 11q) are linked in a molecular pathway that explains the pathogenetic and prognostic implications (indolent vs aggressive form) of recurrent 13q, 17p, and 11q deletions in CLL. DESIGN, SETTING, AND PATIENTS: CLL Research Consortium institutions provided blood samples from untreated patients (n = 206) diagnosed with B-cell CLL between January 2000 and April 2008. All samples were evaluated for the occurrence of cytogenetic abnormalities as well as the expression levels of the miR-15a/miR-16-1 cluster, miR-34b/miR-34c cluster, TP53, and zeta-chain (TCR)-associated protein kinase 70 kDa (ZAP70), a surrogate prognostic marker of CLL. The functional relationship between these genes was studied using in vitro gain- and loss-of-function experiments in cell lines and primary samples and was validated in a separate cohort of primary CLL samples. MAIN OUTCOME MEASURES: Cytogenetic abnormalities; expression levels of the miR-15a/miR-16-1 cluster, miR-34 family, TP53 gene, downstream effectors cyclin-dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A) and B-cell CLL/lymphoma 2 binding component 3 (BBC3), and ZAP70 gene; genetic interactions detected by chromatin immunoprecipitation. RESULTS: In CLLs with 13q deletions the miR-15a/miR-16-1 cluster directly targeted TP53 (mean luciferase activity for miR-15a vs scrambled control, 0.68 relative light units (RLU) [95% confidence interval {CI}, 0.63-0.73]; P = .02; mean for miR-16 vs scrambled control, 0.62 RLU [95% CI, 0.59-0.65]; P = .02) and its downstream effectors. In leukemic cell lines and primary CLL cells, TP53 stimulated the transcription of miR-15/miR-16-1 as well as miR-34b/miR-34c clusters, and the miR-34b/miR-34c cluster directly targeted the ZAP70 kinase (mean luciferase activity for miR-34a vs scrambled control, 0.33 RLU [95% CI, 0.30-0.36]; P = .02; mean for miR-34b vs scrambled control, 0.31 RLU [95% CI, 0.30-0.32]; P = .01; and mean for miR-34c vs scrambled control, 0.35 RLU [95% CI, 0.33-0.37]; P = .02). CONCLUSIONS: A microRNA/TP53 feedback circuitry is associated with CLL pathogenesis and outcome. This mechanism provides a novel pathogenetic model for the association of 13q deletions with the indolent form of CLL that involves microRNAs, TP53, and ZAP70.
LinkOut: [PMID: 21205967]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1158 hsa-miR-16-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000266 BMI1 BMI1 polycomb ring finger oncogene 3 1
MIRT000267 CDK2 cyclin-dependent kinase 2 1 1
MIRT000268 CDK1 cyclin-dependent kinase 1 1 1
MIRT000270 HMGA1 high mobility group AT-hook 1 4 2
MIRT000536 ACVR2A activin A receptor, type IIA 3 1
MIRT000803 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000805 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT000807 TPI1 triosephosphate isomerase 1 1 1
MIRT000809 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT000811 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000816 WT1 Wilms tumor 1 2 1
MIRT000818 ASXL2 additional sex combs like 2 (Drosophila) 2 1
MIRT000822 TMEM251 chromosome 14 open reading frame 109 2 1
MIRT000824 CARD8 caspase recruitment domain family, member 8 2 1
MIRT000826 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 2 1
MIRT000828 CENPJ centromere protein J 2 1
MIRT000830 CEP63 centrosomal protein 63kDa 2 1
MIRT000832 CREBL2 cAMP responsive element binding protein-like 2 2 1
MIRT000834 ECHDC1 enoyl CoA hydratase domain containing 1 2 1
MIRT000846 GOLGA5 golgin A5 2 1
MIRT000848 GOLPH3L golgi phosphoprotein 3-like 2 1
MIRT000850 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 2 1
MIRT000852 H3F3B H3 histone, family 3B (H3.3B) 2 1
MIRT000854 HACE1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 2 1
MIRT000856 HDHD2 haloacid dehalogenase-like hydrolase domain containing 2 2 1
MIRT000858 HERC6 hect domain and RLD 6 2 1
MIRT000862 HRSP12 heat-responsive protein 12 2 1
MIRT000864 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000867 JUN jun oncogene 2 1
MIRT000877 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 2 1
MIRT000879 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 2 1
MIRT000883 OMA1 OMA1 homolog, zinc metallopeptidase (S. cerevisiae) 2 1
MIRT000885 OSGEPL1 O-sialoglycoprotein endopeptidase-like 1 2 1
MIRT000887 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000889 PHKB phosphorylase kinase, beta 2 1
MIRT000891 PMS1 PMS1 postmeiotic segregation increased 1 (S. cerevisiae) 2 1
MIRT000893 PNN pinin, desmosome associated protein 2 1
MIRT000895 PRIM1 primase, DNA, polypeptide 1 (49kDa) 2 1
MIRT000897 RAD51C RAD51 homolog C (S. cerevisiae) 2 1
MIRT000899 RHOT1 ras homolog gene family, member T1 2 1
MIRT000901 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 2 1
MIRT000905 SLC35A1 solute carrier family 35 (CMP-sialic acid transporter), member A1 2 1
MIRT000907 SLC35B3 solute carrier family 35, member B3 2 1
MIRT000909 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 2 1
MIRT000913 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT000915 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000921 ZNF559 zinc finger protein 559 2 1
MIRT000939 CDK6 cyclin-dependent kinase 6 4 1
MIRT000940 CCND3 cyclin D3 4 1
MIRT001225 CCND1 cyclin D1 4 7
MIRT001226 CCNE1 cyclin E1 6 8
MIRT001395 ZNF622 zinc finger protein 622 3 2
MIRT001396 YIF1B Yip1 interacting factor homolog B (S. cerevisiae) 3 2
MIRT001397 VTI1B vesicle transport through interaction with t-SNAREs homolog 1B (yeast) 3 2
MIRT001398 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 2 1
MIRT001399 UBE4A ubiquitination factor E4A (UFD2 homolog, yeast) 2 1
MIRT001400 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 1
MIRT001401 UBE2S ubiquitin-conjugating enzyme E2S 2 1
MIRT001402 TXN2 thioredoxin 2 2 1
MIRT001403 TPM3 tropomyosin 3 2 1
MIRT001404 TOMM34 translocase of outer mitochondrial membrane 34 3 2
MIRT001405 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 2 1
MIRT001406 TMEM43 transmembrane protein 43 3 2
MIRT001407 TMEM109 transmembrane protein 109 2 1
MIRT001408 SRPRB signal recognition particle receptor, B subunit 2 1
MIRT001409 SRPR signal recognition particle receptor (docking protein) 2 1
MIRT001410 SQSTM1 sequestosome 1 2 1
MIRT001411 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 2 1
MIRT001412 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 2 1
MIRT001413 SLC38A5 solute carrier family 38, member 5 2 1
MIRT001414 SLC38A1 solute carrier family 38, member 1 2 1
MIRT001415 SLC25A22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22 2 1
MIRT001416 SLC16A3 solute carrier family 16, member 3 (monocarboxylic acid transporter 4) 2 1
MIRT001417 SLC12A2 solute carrier family 12 (sodium/potassium/chloride transporters), member 2 2 1
MIRT001418 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 3 2
MIRT001419 SERPINE2 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 2 1
MIRT001420 SEC24A SEC24 family, member A (S. cerevisiae) 2 1
MIRT001421 RTN4 reticulon 4 3 2
MIRT001422 RFT1 RFT1 homolog (S. cerevisiae) 2 1
MIRT001423 RARS arginyl-tRNA synthetase 4 4
MIRT001424 RAB30 RAB30, member RAS oncogene family 2 1
MIRT001425 PURA purine-rich element binding protein A 4 3
MIRT001426 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 3 2
MIRT001427 PSAT1 phosphoserine aminotransferase 1 2 1
MIRT001428 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 2 1
MIRT001429 PPIF peptidylprolyl isomerase F 2 1
MIRT001430 PLK1 polo-like kinase 1 (Drosophila) 2 1
MIRT001431 PISD phosphatidylserine decarboxylase 1 1
MIRT001432 PHLDB2 pleckstrin homology-like domain, family B, member 2 2 1
MIRT001433 PANX1 pannexin 1 2 1
MIRT001434 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 2 1
MIRT001435 NPR3 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 2 1
MIRT001437 NOTCH2 Notch homolog 2 (Drosophila) 2 1
MIRT001439 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 2 1
MIRT001440 MRPL20 mitochondrial ribosomal protein L20 1 1
MIRT001441 MLLT11 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 2 1
MIRT001442 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT001444 LYPLA2 lysophospholipase II 2 1
MIRT001445 LUZP1 leucine zipper protein 1 3 2
MIRT001446 LAMC1 laminin, gamma 1 (formerly LAMB2) 2 1
MIRT001447 KPNA3 karyopherin alpha 3 (importin alpha 4) 2 1
MIRT001448 KCNN4 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 2 1
MIRT001449 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 3 2
MIRT001450 IPO4 importin 4 2 1
MIRT001451 IGF2R insulin-like growth factor 2 receptor 2 1
MIRT001452 IFRD2 interferon-related developmental regulator 2 2 1
MIRT001454 IFRD1 interferon-related developmental regulator 1 2 1
MIRT001455 HMOX1 heme oxygenase (decycling) 1 2 1
MIRT001456 HSPA1A heat shock 70kDa protein 1A 3 2
MIRT001457 HSPA1B heat shock 70kDa protein 1B 2 2
MIRT001458 LAMTOR5 hepatitis B virus x interacting protein 2 1
MIRT001459 HARS2 histidyl-tRNA synthetase 2, mitochondrial (putative) 2 1
MIRT001460 HARS histidyl-tRNA synthetase 2 1
MIRT001461 GSTM4 glutathione S-transferase mu 4 2 1
MIRT001462 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 2 1
MIRT001463 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 2 1
MIRT001464 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 1
MIRT001465 GFM1 G elongation factor, mitochondrial 1 2 1
MIRT001466 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 2 1
MIRT001467 FNDC3B fibronectin type III domain containing 3B 3 2
MIRT001468 FGF2 fibroblast growth factor 2 (basic) 3 2
MIRT001469 EIF4E eukaryotic translation initiation factor 4E 2 1
MIRT001470 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 2 1
MIRT001471 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 3 2
MIRT001472 CHORDC1 cysteine and histidine-rich domain (CHORD)-containing 1 2 1
MIRT001473 CDK5RAP1 CDK5 regulatory subunit associated protein 1 2 1
MIRT001474 CACNA2D1 calcium channel, voltage-dependent, alpha 2/delta subunit 1 2 1
MIRT001475 CA12 carbonic anhydrase XII 3 2
MIRT001476 ATG9A ATG9 autophagy related 9 homolog A (S. cerevisiae) 3 2
MIRT001477 SNX15 sorting nexin 15 1 1
MIRT001478 ARL2 ADP-ribosylation factor-like 2 6 2
MIRT001479 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 2 1
MIRT001480 ADSS adenylosuccinate synthase 2 1
MIRT001481 ACP2 acid phosphatase 2, lysosomal 2 1
MIRT001482 ABHD10 abhydrolase domain containing 10 2 1
MIRT001483 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 2 1
MIRT001484 F2 coagulation factor II (thrombin) 2 1
MIRT001800 BCL2 B-cell CLL/lymphoma 2 6 18
MIRT001801 CCNT2 cyclin T2 2 1
MIRT002475 CFL2 cofilin 2 (muscle) 1 1
MIRT002476 CSHL1 chorionic somatomammotropin hormone-like 1 1 1
MIRT002477 CRHBP corticotropin releasing hormone binding protein 1 1
MIRT003326 RPS6 ribosomal protein S6 1 2
MIRT003328 BRCA1 breast cancer 1, early onset 2 2
MIRT003329 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 2
MIRT003430 WNT3A wingless-type MMTV integration site family, member 3A 3 3
MIRT003431 CCND2 cyclin D2 1 2
MIRT003890 VEGFA vascular endothelial growth factor A 4 7
MIRT004366 WIPF1 WAS/WASL interacting protein family, member 1 2 1
MIRT004367 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 2 1
MIRT004368 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 2 1
MIRT004369 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT004370 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT004371 FAM69A family with sequence similarity 69, member A 2 1
MIRT004372 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT004373 FAM122C family with sequence similarity 122C 2 1
MIRT004374 PWWP2A PWWP domain containing 2A 2 1
MIRT004375 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT004376 CCDC111 coiled-coil domain containing 111 2 1
MIRT004377 C2orf43 chromosome 2 open reading frame 43 2 1
MIRT004378 C4orf27 chromosome 4 open reading frame 27 2 1
MIRT004379 NIPAL2 NIPA-like domain containing 2 2 1
MIRT004380 TRMT13 coiled-coil domain containing 76 2 1
MIRT004381 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT004382 CADM1 cell adhesion molecule 1 3 1
MIRT004470 TPPP3 tubulin polymerization-promoting protein family member 3 2 1
MIRT004637 MYB v-myb myeloblastosis viral oncogene homolog (avian) 4 2
MIRT004742 AURKB aurora kinase B 3 2
MIRT005086 CAPRIN1 cell cycle associated protein 1 4 1
MIRT005258 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 3 2
MIRT005259 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 1
MIRT005260 TOR4A chromosome 9 open reading frame 167 2 1
MIRT005261 C9orf89 chromosome 9 open reading frame 89 2 1
MIRT005262 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 3 2
MIRT005263 NOB1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) 3 2
MIRT005264 PNPLA6 patatin-like phospholipase domain containing 6 3 2
MIRT005265 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 2 1
MIRT005266 ZNF384 zinc finger protein 384 2 1
MIRT005268 C9orf114 chromosome 9 open reading frame 114 2 1
MIRT005269 PTCD3 Pentatricopeptide repeat domain 3 2 1
MIRT005270 MCU coiled-coil domain containing 109A 2 1
MIRT005271 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 3 2
MIRT005360 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 4 1
MIRT005437 LAMTOR3 MAPK scaffold protein 1 2 1
MIRT005438 LAMTOR2 roadblock domain containing 3 2 1
MIRT005554 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005764 TP53 tumor protein p53 1 1
MIRT006528 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 1 1
MIRT006534 ZYX zyxin 3 1
MIRT006651 NCOR2 nuclear receptor corepressor 2 1 1
MIRT006657 Ccnd1 cyclin D1 1 1
MIRT006751 AXIN2 axin 2 2 2
MIRT006794 KDR kinase insert domain receptor (a type III receptor tyrosine kinase) 3 1
MIRT006795 FGFR1 fibroblast growth factor receptor 1 3 1
MIRT006804 HMGA2 high mobility group AT-hook 2 3 1
MIRT006870 PIM1 pim-1 oncogene 1 1
MIRT006912 IFNG interferon, gamma 2 1
MIRT007301 UNG uracil-DNA glycosylase 1 1
MIRT031372 SRP68 signal recognition particle 68kDa 1 1
MIRT031373 RECK reversion-inducing-cysteine-rich protein with kazal motifs 2 2
MIRT031374 DSP desmoplakin 1 1
MIRT031375 RPL10 ribosomal protein L10 2 2
MIRT031376 SEC11A SEC11 homolog A (S. cerevisiae) 1 1
MIRT031377 SELRC1 chromosome 1 open reading frame 163 1 1
MIRT031378 RPS27 ribosomal protein S27 1 1
MIRT031379 YTHDC1 YTH domain containing 1 1 1
MIRT031380 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT031381 PPAN peter pan homolog (Drosophila) 1 1
MIRT031382 NT5C3A 5'-nucleotidase, cytosolic III 1 1
MIRT031383 TRMT10C RNA (guanine-9-) methyltransferase domain containing 1 1 1
MIRT031384 SMAD1 SMAD family member 1 1 1
MIRT031385 TRIM32 tripartite motif-containing 32 1 1
MIRT031386 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT031387 RPL4 ribosomal protein L4 1 1
MIRT031388 NOC4L nucleolar complex associated 4 homolog (S. cerevisiae) 1 1
MIRT031389 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT031390 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT031391 PON2 paraoxonase 2 1 1
MIRT031392 EMC6 transmembrane protein 93 1 1
MIRT031393 PTRH1 peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) 1 1
MIRT031394 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT031395 EEF1G eukaryotic translation elongation factor 1 gamma 1 1
MIRT031396 LSM10 LSM10, U7 small nuclear RNA associated 1 1
MIRT031397 YBX3 cold shock domain protein A 1 1
MIRT031398 INTS5 integrator complex subunit 5 1 1
MIRT031399 MRPS31 mitochondrial ribosomal protein S31 1 1
MIRT031400 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT031401 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT031402 RPL12 ribosomal protein L12 1 1
MIRT031403 MRPL1 mitochondrial ribosomal protein L1 1 1
MIRT031404 ACOT8 acyl-CoA thioesterase 8 1 1
MIRT031405 SLC27A4 solute carrier family 27 (fatty acid transporter), member 4 1 1
MIRT031406 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT031407 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT031408 METAP2 methionyl aminopeptidase 2 1 1
MIRT031409 CD44 CD44 molecule (Indian blood group) 1 1
MIRT031410 SARS seryl-tRNA synthetase 1 1
MIRT031411 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 1
MIRT031412 RPL27A ribosomal protein L27a 1 1
MIRT031413 AUP1 ancient ubiquitous protein 1 2 2
MIRT031414 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 2 2
MIRT031415 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT031416 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT031417 DHX36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 1 1
MIRT031418 HEATR2 HEAT repeat containing 2 2 2
MIRT031419 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 1
MIRT031420 UGT8 UDP glycosyltransferase 8 1 1
MIRT031421 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT031422 TNPO3 transportin 3 2 2
MIRT031423 SMPD4 sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3) 1 1
MIRT031424 WDR18 WD repeat domain 18 1 1
MIRT031425 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT031426 GPATCH4 G patch domain containing 4 1 1
MIRT031427 DDX52 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 1 1
MIRT031428 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT031429 ELP3 elongation protein 3 homolog (S. cerevisiae) 1 1
MIRT031430 XKR8 XK, Kell blood group complex subunit-related family, member 8 1 1
MIRT031431 GRB2 growth factor receptor-bound protein 2 1 1
MIRT031432 SNRPB2 small nuclear ribonucleoprotein polypeptide B' 1 1
MIRT031433 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT031434 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT031435 FNTA farnesyltransferase, CAAX box, alpha 1 1
MIRT031436 TMEM126A transmembrane protein 126A 1 1
MIRT031437 WBP11 WW domain binding protein 11 1 1
MIRT031438 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 1 1
MIRT031439 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT031440 RBM6 RNA binding motif protein 6 1 1
MIRT031441 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT031442 DDHD2 DDHD domain containing 2 1 1
MIRT031443 NIN ninein (GSK3B interacting protein) 1 1
MIRT031444 FLCN folliculin 1 1
MIRT031445 ATF7 activating transcription factor 7 1 1
MIRT031446 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT031447 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT031448 BFAR bifunctional apoptosis regulator 1 1
MIRT031449 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT031450 ZNRF3 zinc and ring finger 3 1 1
MIRT031451 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT031452 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) 1 1
MIRT031453 N4BP1 NEDD4 binding protein 1 1 1
MIRT031454 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A 1 1
MIRT031455 TIMM10B fracture callus 1 homolog (rat) 2 2
MIRT031456 KIF5B kinesin family member 5B 2 3
MIRT031457 CALR calreticulin 1 1
MIRT031458 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT031459 RHOF ras homolog gene family, member F (in filopodia) 1 1
MIRT031460 TNFRSF12A tumor necrosis factor receptor superfamily, member 12A 1 1
MIRT031461 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT031462 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT031463 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT031464 TACO1 translational activator of mitochondrially encoded cytochrome c oxidase I 1 1
MIRT031465 RPL9 ribosomal protein L9 1 1
MIRT031466 CYCS cytochrome c, somatic 1 1
MIRT031467 TUBB tubulin, beta 2 2
MIRT031468 PDF peptide deformylase (mitochondrial) 1 1
MIRT031469 LUC7L LUC7-like (S. cerevisiae) 1 1
MIRT031470 EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa 1 1
MIRT031471 NAA10 N(alpha)-acetyltransferase 10, NatA catalytic subunit 1 1
MIRT031472 TUBB4B tubulin, beta 2C 1 1
MIRT031473 STX4 syntaxin 4 1 1
MIRT031474 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 1 1
MIRT031475 EIF3E eukaryotic translation initiation factor 3, subunit E 1 1
MIRT031476 INF2 inverted formin, FH2 and WH2 domain containing 1 1
MIRT031477 LMF2 lipase maturation factor 2 1 1
MIRT031478 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT031479 BAG6 HLA-B associated transcript 3 1 1
MIRT031480 VMP1 transmembrane protein 49 1 1
MIRT031481 SYF2 SYF2 homolog, RNA splicing factor (S. cerevisiae) 1 1
MIRT031482 NARS2 asparaginyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT031483 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT031484 ENY2 enhancer of yellow 2 homolog (Drosophila) 1 1
MIRT031485 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT031486 STEAP3 STEAP family member 3 1 1
MIRT031487 WDR43 WD repeat domain 43 1 1
MIRT031488 TRMT1 TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) 1 1
MIRT031489 SNX12 sorting nexin 12 1 1
MIRT031490 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT031491 SNX6 sorting nexin 6 1 1
MIRT031492 PHIP pleckstrin homology domain interacting protein 1 1
MIRT031493 LAMTOR1 chromosome 11 open reading frame 59 1 1
MIRT031494 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT031495 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT031496 DNAJA4 DnaJ (Hsp40) homolog, subfamily A, member 4 1 1
MIRT031497 MDN1 MDN1, midasin homolog (yeast) 1 1
MIRT031498 DNAJA2 DnaJ (Hsp40) homolog, subfamily A, member 2 1 1
MIRT031499 USP9X ubiquitin specific peptidase 9, X-linked 1 1
MIRT031500 C8orf44 chromosome 8 open reading frame 44 1 1
MIRT031501 TMEM168 transmembrane protein 168 1 1
MIRT031502 LPHN1 latrophilin 1 1 1
MIRT031503 NCKAP5L NCK-associated protein 5-like 1 1
MIRT031504 SGK3 serum/glucocorticoid regulated kinase family, member 3 1 1
MIRT031505 ZRANB1 zinc finger, RAN-binding domain containing 1 1 1
MIRT031506 TRIM44 tripartite motif-containing 44 1 1
MIRT031507 TEX15 testis expressed 15 1 1
MIRT031508 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 2
MIRT031509 RIMS3 regulating synaptic membrane exocytosis 3 1 1
MIRT031510 CEP55 centrosomal protein 55kDa 1 1
MIRT031511 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT031512 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 1
MIRT031513 CAAP1 chromosome 9 open reading frame 82 1 1
MIRT031514 LATS1 LATS, large tumor suppressor, homolog 1 (Drosophila) 1 1
MIRT031515 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 2
MIRT031516 SLC39A10 solute carrier family 39 (zinc transporter), member 10 1 1
MIRT031517 ATP13A3 ATPase type 13A3 1 1
MIRT031518 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT031519 TMEM100 transmembrane protein 100 1 1
MIRT031520 SIPA1L2 signal-induced proliferation-associated 1 like 2 1 1
MIRT031521 SMAD7 SMAD family member 7 1 1
MIRT031522 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT031523 SALL1 sal-like 1 (Drosophila) 1 1
MIRT031524 PRDM4 PR domain containing 4 1 1
MIRT031525 FTL ferritin, light polypeptide 1 1
MIRT031526 BCAS2 breast carcinoma amplified sequence 2 1 1
MIRT031527 YBX1 Y box binding protein 1 1 1
MIRT031528 NDUFA9 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa 1 1
MIRT031529 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT031530 CCPG1 cell cycle progression 1 1 1
MIRT031531 MICU2 EF-hand domain family, member A1 1 1
MIRT031532 BCCIP BRCA2 and CDKN1A interacting protein 1 1
MIRT031533 WDR3 WD repeat domain 3 1 1
MIRT031534 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 1
MIRT031535 DIABLO diablo homolog (Drosophila) 1 1
MIRT031536 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 1 1
MIRT031537 UTP23 UTP23, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT031538 PYGB phosphorylase, glycogen; brain 1 1
MIRT031539 NOC3L nucleolar complex associated 3 homolog (S. cerevisiae) 1 1
MIRT031540 DDX41 DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 1 1
MIRT031541 PHLDA2 pleckstrin homology-like domain, family A, member 2 1 1
MIRT031542 SGTA small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha 1 1
MIRT031543 RRP12 ribosomal RNA processing 12 homolog (S. cerevisiae) 1 1
MIRT031544 RPL10L ribosomal protein L10-like 1 1
MIRT031545 EIF3CL eukaryotic translation initiation factor 3, subunit C-like 1 1
MIRT031546 FASTKD2 FAST kinase domains 2 1 1
MIRT031547 C2orf47 chromosome 2 open reading frame 47 1 1
MIRT031548 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT031549 PLRG1 pleiotropic regulator 1 (PRL1 homolog, Arabidopsis) 1 1
MIRT031550 VMA21 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) 1 1
MIRT031551 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT031552 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 1 1
MIRT031553 KIAA0368 KIAA0368 1 1
MIRT031554 AGK acylglycerol kinase 1 1
MIRT031555 FDXR ferredoxin reductase 1 1
MIRT031556 EIF3M eukaryotic translation initiation factor 3, subunit M 1 1
MIRT031557 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT031558 MALSU1 chromosome 7 open reading frame 30 1 1
MIRT031559 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT031560 USP7 ubiquitin specific peptidase 7 (herpes virus-associated) 1 1
MIRT031561 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT031562 SRP72 signal recognition particle 72kDa 1 1
MIRT031563 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT031564 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT031565 DLD dihydrolipoamide dehydrogenase 1 1
MIRT031566 KDSR 3-ketodihydrosphingosine reductase 1 1
MIRT031567 TERF2IP telomeric repeat binding factor 2, interacting protein 1 1
MIRT031568 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT031569 USP42 ubiquitin specific peptidase 42 1 1
MIRT031570 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT031571 LAMP2 lysosomal-associated membrane protein 2 1 1
MIRT031572 KCNG3 potassium voltage-gated channel, subfamily G, member 3 1 1
MIRT031573 HIST2H2BE histone cluster 2, H2be 1 1
MIRT031574 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT031575 ONECUT2 one cut homeobox 2 1 1
MIRT031576 OIP5 Opa interacting protein 5 1 1
MIRT031577 SP1 Sp1 transcription factor 1 1
MIRT031578 CYB561A3 cytochrome b, ascorbate dependent 3 1 1
MIRT031579 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) 1 1
MIRT031580 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT031581 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT031582 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT031583 TMEM55B transmembrane protein 55B 1 1
MIRT031584 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT031585 PLSCR4 phospholipid scramblase 4 1 1
MIRT031586 SEH1L SEH1-like (S. cerevisiae) 1 1
MIRT031587 UBN2 ubinuclein 2 1 1
MIRT031588 DESI1 PPPDE peptidase domain containing 2 1 1
MIRT031589 CDK17 cyclin-dependent kinase 17 1 1
MIRT031590 TLK1 tousled-like kinase 1 1 2
MIRT031591 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT031592 TBRG4 transforming growth factor beta regulator 4 1 1
MIRT031593 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT031594 GLTSCR2 glioma tumor suppressor candidate region gene 2 1 1
MIRT031595 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT031596 RBM15B RNA binding motif protein 15B 1 1
MIRT031597 RRP15 ribosomal RNA processing 15 homolog (S. cerevisiae) 1 1
MIRT031598 NAMPT nicotinamide phosphoribosyltransferase 1 1
MIRT031599 CD97 CD97 molecule 1 1
MIRT031600 COMMD10 COMM domain containing 10 1 1
MIRT031601 NRP1 neuropilin 1 1 1
MIRT031602 GEMIN5 gem (nuclear organelle) associated protein 5 1 1
MIRT031603 EPHA2 EPH receptor A2 1 1
MIRT031604 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT031605 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT031606 PLAUR plasminogen activator, urokinase receptor 1 1
MIRT031607 C1orf56 chromosome 1 open reading frame 56 1 1
MIRT031608 HSPA9 heat shock 70kDa protein 9 (mortalin) 1 1
MIRT031609 SLC25A6 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 1 1
MIRT031610 AIMP1 aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 1 1
MIRT031611 CLNS1A chloride channel, nucleotide-sensitive, 1A 1 1
MIRT031612 RNMTL1 RNA methyltransferase like 1 1 1
MIRT031613 MRPL3 mitochondrial ribosomal protein L3 1 1
MIRT031614 HSPBP1 HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 1 1
MIRT031615 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT031616 PSMD12 proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 1 1
MIRT031617 PLCXD2 phosphatidylinositol-specific phospholipase C, X domain containing 2 1 1
MIRT031618 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 2 2
MIRT031619 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT031620 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 1 1
MIRT031621 ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 1 1
MIRT031622 LY6K lymphocyte antigen 6 complex, locus K 1 1
MIRT031623 NOL11 nucleolar protein 11 1 1
MIRT031624 MRPS10 mitochondrial ribosomal protein S10 1 1
MIRT031625 CCDC58 coiled-coil domain containing 58 1 1
MIRT031626 LARP4 La ribonucleoprotein domain family, member 4 1 1
MIRT031627 MEPCE methylphosphate capping enzyme 1 1
MIRT031628 DCUN1D5 DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) 1 1
MIRT031629 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 1 1
MIRT031630 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT031631 RPL5 ribosomal protein L5 1 1
MIRT031632 MRPL10 mitochondrial ribosomal protein L10 1 1
MIRT031633 AHCYL1 adenosylhomocysteinase-like 1 1 1
MIRT031634 CLASP1 cytoplasmic linker associated protein 1 1 1
MIRT031635 EIF5B eukaryotic translation initiation factor 5B 1 1
MIRT031636 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT031637 SMAD5 SMAD family member 5 1 1
MIRT031638 NARF nuclear prelamin A recognition factor 1 1
MIRT031639 MAP7 microtubule-associated protein 7 1 1
MIRT031640 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT031641 NUP50 nucleoporin 50kDa 2 2
MIRT031642 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT031643 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT031644 FBXL18 F-box and leucine-rich repeat protein 18 1 1
MIRT031645 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa 1 1
MIRT031646 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT031647 AADAT aminoadipate aminotransferase 1 1
MIRT031648 MTHFR methylenetetrahydrofolate reductase (NAD(P)H) 1 1
MIRT031649 SAV1 salvador homolog 1 (Drosophila) 1 1
MIRT031650 CARD10 caspase recruitment domain family, member 10 1 1
MIRT031651 KCNC4 potassium voltage-gated channel, Shaw-related subfamily, member 4 1 2
MIRT031652 SNX16 sorting nexin 16 1 1
MIRT031653 GABARAPL1 GABA(A) receptor-associated protein like 1 1 1
MIRT031654 FAM122A family with sequence similarity 122A 1 1
MIRT031655 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 1
MIRT031656 SIRT4 sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) 1 1
MIRT031657 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT031658 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT031659 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT031660 SLC35B2 solute carrier family 35, member B2 2 2
MIRT031661 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 2 2
MIRT031662 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT031663 TUBA1C tubulin, alpha 1c 1 1
MIRT031664 TUBB3 tubulin, beta 3 1 1
MIRT031665 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT031666 HYAL3 hyaluronoglucosaminidase 3 1 1
MIRT031667 DNAJC1 DnaJ (Hsp40) homolog, subfamily C, member 1 1 1
MIRT031668 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 1
MIRT031669 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT031670 TNFRSF10A tumor necrosis factor receptor superfamily, member 10a 1 1
MIRT031671 RPS2 ribosomal protein S2 1 1
MIRT031672 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT031673 RMDN1 family with sequence similarity 82, member B 1 1
MIRT031674 SPATA5 spermatogenesis associated 5 1 1
MIRT031675 EARS2 glutamyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT031676 CCT6B chaperonin containing TCP1, subunit 6B (zeta 2) 1 1
MIRT031677 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT031678 STRAP serine/threonine kinase receptor associated protein 1 1
MIRT031679 COMT catechol-O-methyltransferase 2 2
MIRT031680 SLIRP chromosome 14 open reading frame 156 1 1
MIRT031681 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT031682 PRPSAP1 phosphoribosyl pyrophosphate synthetase-associated protein 1 2 2
MIRT031683 DNAJC15 DnaJ (Hsp40) homolog, subfamily C, member 15 1 1
MIRT031684 ANKLE2 ankyrin repeat and LEM domain containing 2 1 1
MIRT031685 PRNP prion protein 1 1
MIRT031686 SLC38A2 solute carrier family 38, member 2 1 1
MIRT031687 ZNF598 zinc finger protein 598 1 1
MIRT031688 GTPBP8 GTP-binding protein 8 (putative) 1 1
MIRT031689 KIDINS220 kinase D-interacting substrate, 220kDa 1 1
MIRT031690 VIM vimentin 1 1
MIRT031691 DMAP1 DNA methyltransferase 1 associated protein 1 1 1
MIRT031692 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT031693 ELOVL1 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 1 1
MIRT031694 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 'protein-coding 1 1
MIRT031695 COPS5 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) 1 1
MIRT031696 CDK9 cyclin-dependent kinase 9 1 1
MIRT031697 ASB6 ankyrin repeat and SOCS box-containing 6 1 1
MIRT031698 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT031699 RBMS3 RNA binding motif, single stranded interacting protein 3 1 1
MIRT031700 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT031701 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT031702 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT031703 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT031704 SACM1L SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT031705 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT031706 TMEM87A transmembrane protein 87A 1 1
MIRT031707 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT031708 RPLP0 ribosomal protein, large, P0 2 2
MIRT031709 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT031710 EIF4B eukaryotic translation initiation factor 4B 2 2
MIRT031711 SRPK1 SFRS protein kinase 1 1 1
MIRT031712 DOCK5 dedicator of cytokinesis 5 1 1
MIRT031713 SPRYD3 SPRY domain containing 3 1 1
MIRT031714 ATL2 atlastin GTPase 2 1 1
MIRT031715 CDV3 CDV3 homolog (mouse) 1 1
MIRT031716 CXorf38 chromosome X open reading frame 38 1 1
MIRT031717 FAM89A family with sequence similarity 89, member A 1 1
MIRT031718 SLC25A39 solute carrier family 25, member 39 1 1
MIRT031719 GLRX glutaredoxin (thioltransferase) 1 1
MIRT031720 DLC1 deleted in liver cancer 1 1 1
MIRT031721 HOXA3 homeobox A3 1 1
MIRT031722 CCNE2 cyclin E2 1 1
MIRT031723 ARL3 ADP-ribosylation factor-like 3 1 1
MIRT031724 MYO5A myosin VA (heavy chain 12, myoxin) 1 1
MIRT031725 VEZT vezatin, adherens junctions transmembrane protein 1 1
MIRT031726 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 1
MIRT031727 DMTF1 cyclin D binding myb-like transcription factor 1 1 1
MIRT031728 HELZ helicase with zinc finger 1 1
MIRT031729 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT031730 RAB1B RAB1B, member RAS oncogene family 2 2
MIRT031731 PNP purine nucleoside phosphorylase 2 2
MIRT031732 KPNA1 karyopherin alpha 1 (importin alpha 5) 2 3
MIRT031733 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 2 2
MIRT031734 SON SON DNA binding protein 2 2
MIRT031735 HSD17B8 hydroxysteroid (17-beta) dehydrogenase 8 1 1
MIRT031736 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT031737 DCAF13 DDB1 and CUL4 associated factor 13 1 1
MIRT031738 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT031739 DAP3 death associated protein 3 2 2
MIRT031740 NTHL1 nth endonuclease III-like 1 (E. coli) 1 1
MIRT031741 PEX14 peroxisomal biogenesis factor 14 1 1
MIRT031742 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT031743 RABGGTB Rab geranylgeranyltransferase, beta subunit 1 1
MIRT031744 IDH3A isocitrate dehydrogenase 3 (NAD+) alpha 1 1
MIRT031745 THEM4 thioesterase superfamily member 4 1 1
MIRT031746 BMS1 BMS1 homolog, ribosome assembly protein (yeast) 1 1
MIRT031747 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT031748 EDC4 enhancer of mRNA decapping 4 1 1
MIRT031749 CIB1 calcium and integrin binding 1 (calmyrin) 1 1
MIRT031750 NDUFAF4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4 1 1
MIRT031751 OGDH oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 1 1
MIRT031752 EIF2A eukaryotic translation initiation factor 2A, 65kDa 1 1
MIRT031753 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT031754 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 1 1
MIRT031755 TAF9 TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa 1 1
MIRT031756 RPS12 ribosomal protein S12 2 2
MIRT031757 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 1 1
MIRT031758 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 1
MIRT031759 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT031760 CNOT7 CCR4-NOT transcription complex, subunit 7 1 1
MIRT031761 DMD dystrophin 1 1
MIRT031762 RCL1 RNA terminal phosphate cyclase-like 1 2 2
MIRT031763 SDHAF2 succinate dehydrogenase complex assembly factor 2 1 1
MIRT031764 YARS2 tyrosyl-tRNA synthetase 2, mitochondrial 1 1
MIRT031765 GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa 1 1
MIRT031766 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT031767 VAMP8 vesicle-associated membrane protein 8 (endobrevin) 1 1
MIRT031768 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 1 1
MIRT031769 DKC1 dyskeratosis congenita 1, dyskerin 1 1
MIRT031770 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT031771 LRPPRC leucine-rich PPR-motif containing 1 1
MIRT031772 DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 1 1
MIRT031773 CHP1 calcium binding protein P22 1 1
MIRT031774 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT031775 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT031776 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT031777 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT031778 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT031779 SFXN1 sideroflexin 1 1 1
MIRT031780 YIPF4 Yip1 domain family, member 4 1 1
MIRT031781 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT031782 RBMS1 RNA binding motif, single stranded interacting protein 1 1 1
MIRT031783 SRSF1 splicing factor, arginine/serine-rich 1 1 1
MIRT031784 PHC3 polyhomeotic homolog 3 (Drosophila) 1 1
MIRT031785 FURIN furin (paired basic amino acid cleaving enzyme) 1 1
MIRT031786 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT031787 IFT74 intraflagellar transport 74 homolog (Chlamydomonas) 1 1
MIRT031788 FAM122B family with sequence similarity 122B 1 1
MIRT031789 ZNF207 zinc finger protein 207 1 1
MIRT031790 RNF149 ring finger protein 149 1 1
MIRT031791 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT031792 BTG2 BTG family, member 2 1 1
MIRT031793 ATG14 KIAA0831 1 1
MIRT031794 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT031795 KIAA1432 KIAA1432 1 1
MIRT031796 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT031797 XPO7 exportin 7 2 3
MIRT031798 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT031799 HSPD1 heat shock 60kDa protein 1 (chaperonin) 1 1
MIRT031800 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT031801 COA6 chromosome 1 open reading frame 31 1 1
MIRT031802 ASPH aspartate beta-hydroxylase 1 1
MIRT031803 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT031804 DTD1 D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) 1 1
MIRT031805 RRP36 chromosome 6 open reading frame 153 1 1
MIRT031806 NARS asparaginyl-tRNA synthetase 1 1
MIRT031807 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT031808 HSPH1 heat shock 105kDa/110kDa protein 1 1 1
MIRT031809 KIF23 kinesin family member 23 1 1
MIRT031810 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT031811 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 1 1
MIRT031812 TRAP1 TNF receptor-associated protein 1 2 2
MIRT031813 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT031814 VASN vasorin 1 1
MIRT031815 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 1 1
MIRT031816 DDX31 DEAD (Asp-Glu-Ala-Asp) box polypeptide 31 1 1
MIRT031817 EIF3K eukaryotic translation initiation factor 3, subunit K 1 1
MIRT031818 RPLP1 ribosomal protein, large, P1 1 1
MIRT031819 QSOX2 quiescin Q6 sulfhydryl oxidase 2 1 1
MIRT031820 MRFAP1 Mof4 family associated protein 1 1 1
MIRT031821 CUL4A cullin 4A 1 1
MIRT031822 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 1
MIRT031823 ELAC2 elaC homolog 2 (E. coli) 1 1
MIRT031824 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT031825 ALDH18A1 aldehyde dehydrogenase 18 family, member A1 1 1
MIRT031826 KDM2A lysine (K)-specific demethylase 2A 1 1
MIRT031827 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT031828 HEATR1 HEAT repeat containing 1 1 1
MIRT031829 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT031830 RPL13 ribosomal protein L13 1 1
MIRT031831 RAB1A RAB1A, member RAS oncogene family 1 1
MIRT031832 CKAP5 cytoskeleton associated protein 5 1 1
MIRT031833 SLC7A5 solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 1 1
MIRT031834 SEC61A1 Sec61 alpha 1 subunit (S. cerevisiae) 1 1
MIRT031835 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT031836 CHPT1 choline phosphotransferase 1 1 1
MIRT031837 AFG3L2 AFG3 ATPase family gene 3-like 2 (yeast) 1 1
MIRT031838 APP amyloid beta (A4) precursor protein 1 1
MIRT031839 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT031840 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 1
MIRT031841 SPTBN2 spectrin, beta, non-erythrocytic 2 1 1
MIRT031842 STXBP3 syntaxin binding protein 3 1 1
MIRT031843 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT031844 IPO7 importin 7 1 1
MIRT031845 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT031846 RAB23 RAB23, member RAS oncogene family 1 1
MIRT031847 SF3A3 splicing factor 3a, subunit 3, 60kDa 1 1
MIRT031848 FEM1C fem-1 homolog c (C. elegans) 1 1
MIRT031849 PDE4D phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) 1 1
MIRT031850 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT031851 CAMKK2 calcium/calmodulin-dependent protein kinase kinase 2, beta 1 1
MIRT031852 ATAD5 ATPase family, AAA domain containing 5 1 1
MIRT031853 GCC1 GRIP and coiled-coil domain containing 1 1 1
MIRT031854 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 1
MIRT031855 CNNM2 cyclin M2 1 1
MIRT031856 EPC1 enhancer of polycomb homolog 1 (Drosophila) 1 1
MIRT031857 ZFHX3 zinc finger homeobox 3 1 1
MIRT031858 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT031859 SLC9A6 solute carrier family 9 (sodium/hydrogen exchanger), member 6 1 1
MIRT031860 USP15 ubiquitin specific peptidase 15 1 1
MIRT031861 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT031862 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT031863 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT031864 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 2 2
MIRT031865 DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 2 2
MIRT031866 SLC35A4 solute carrier family 35, member A4 2 2
MIRT031867 ANPEP alanyl (membrane) aminopeptidase 1 1
MIRT031868 ALG2 asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT031869 PELO pelota homolog (Drosophila) 1 1
MIRT031870 NOP10 NOP10 ribonucleoprotein homolog (yeast) 1 1
MIRT031871 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT031872 UTP3 UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae) 1 1
MIRT031873 CDCA8 cell division cycle associated 8 1 1
MIRT031874 RPL30 ribosomal protein L30 1 1
MIRT031875 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like 1 1
MIRT031876 ITGB4 integrin, beta 4 1 1
MIRT031877 UXT ubiquitously-expressed transcript 1 1
MIRT031878 TPBG trophoblast glycoprotein 1 1
MIRT031879 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 1 1
MIRT031880 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 1 1
MIRT031881 CNPY3 canopy 3 homolog (zebrafish) 1 1
MIRT031882 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 2 2
MIRT031883 CXorf40B chromosome X open reading frame 40B 1 1
MIRT031884 DHX37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 1 1
MIRT031885 BYSL bystin-like 1 1
MIRT031886 RAB12 RAB12, member RAS oncogene family 1 1
MIRT031887 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT031888 KIF2A kinesin heavy chain member 2A 1 1
MIRT031889 AGRN agrin 1 1
MIRT031890 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT031891 TMEM41A transmembrane protein 41A 1 1
MIRT031892 PSMC2 proteasome (prosome, macropain) 26S subunit, ATPase, 2 1 1
MIRT031893 TTC17 tetratricopeptide repeat domain 17 1 1
MIRT031894 EML4 echinoderm microtubule associated protein like 4 1 1
MIRT031895 UTP20 UTP20, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT031896 CLUH KIAA0664 1 1
MIRT031897 XPOT exportin, tRNA (nuclear export receptor for tRNAs) 1 1
MIRT031898 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 2 2
MIRT031899 NEMF serologically defined colon cancer antigen 1 1 1
MIRT031900 HSPA5 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) 1 1
MIRT031901 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT031902 MRRF mitochondrial ribosome recycling factor 1 1
MIRT031903 ERLIN2 ER lipid raft associated 2 1 1
MIRT031904 NUP160 nucleoporin 160kDa 1 1
MIRT031905 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT031906 MFN2 mitofusin 2 1 1
MIRT031907 LMO7 LIM domain 7 1 1
MIRT031908 SYPL1 synaptophysin-like 1 1 1
MIRT031909 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT031910 ANKRD17 ankyrin repeat domain 17 1 1
MIRT031911 RNF111 ring finger protein 111 1 1
MIRT031912 EXD2 exonuclease 3'-5' domain containing 2 1 1
MIRT031913 NHLRC3 NHL repeat containing 3 1 1
MIRT031914 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT031915 OSBPL3 oxysterol binding protein-like 3 1 2
MIRT031916 GPR180 G protein-coupled receptor 180 1 1
MIRT031917 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT031918 PAPOLG poly(A) polymerase gamma 1 1
MIRT031919 STK38 serine/threonine kinase 38 1 1
MIRT031920 CD274 CD274 molecule 1 1
MIRT031921 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT031922 GTPBP1 GTP binding protein 1 1 1
MIRT031923 MED13 mediator complex subunit 13 1 2
MIRT031924 SETD1B SET domain containing 1B 1 1
MIRT031925 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 1
MIRT031926 SYNJ1 synaptojanin 1 1 1
MIRT031927 RNF217 ring finger protein 217 1 1
MIRT031928 RNF144B ring finger protein 144B 1 1
MIRT031929 RFK riboflavin kinase 1 1
MIRT031930 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT031931 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 1 1
MIRT031932 MIB1 mindbomb homolog 1 (Drosophila) 1 1
MIRT031933 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT031934 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT031935 CDCA4 cell division cycle associated 4 1 1
MIRT031936 MAP4 microtubule-associated protein 4 2 2
MIRT031937 GOLT1B golgi transport 1 homolog B (S. cerevisiae) 2 2
MIRT031938 PPP6C protein phosphatase 6, catalytic subunit 2 2
MIRT031939 LAMB3 laminin, beta 3 1 1
MIRT031940 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT031941 POLDIP2 polymerase (DNA-directed), delta interacting protein 2 1 1
MIRT031942 RPS25 ribosomal protein S25 1 1
MIRT031943 WARS tryptophanyl-tRNA synthetase 1 1
MIRT031944 GLT8D1 glycosyltransferase 8 domain containing 1 1 1
MIRT031945 RPL3 ribosomal protein L3 1 1
MIRT031946 EIF3H eukaryotic translation initiation factor 3, subunit H 1 1
MIRT031947 LYAR Ly1 antibody reactive homolog (mouse) 1 1
MIRT031948 DUSP14 dual specificity phosphatase 14 1 1
MIRT031949 SSU72 SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) 1 1
MIRT031950 OXNAD1 oxidoreductase NAD-binding domain containing 1 1 1
MIRT031951 FTH1 ferritin, heavy polypeptide 1 1 1
MIRT031952 RBM28 RNA binding motif protein 28 1 1
MIRT031953 SSSCA1 Sjogren syndrome/scleroderma autoantigen 1 1 1
MIRT031954 RPL21 ribosomal protein L21 1 1
MIRT031955 RRP9 ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT031956 MINA MYC induced nuclear antigen 1 1
MIRT031957 ACTG1 actin, gamma 1 2 2
MIRT031958 PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) 1 1
MIRT031959 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT031960 LSG1 large subunit GTPase 1 homolog (S. cerevisiae) 1 1
MIRT031961 SLC25A32 solute carrier family 25, member 32 1 1
MIRT031962 AAAS achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) 1 1
MIRT031963 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT031964 MARS methionyl-tRNA synthetase 1 1
MIRT031965 MERTK c-mer proto-oncogene tyrosine kinase 1 1
MIRT031966 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT031967 SRP19 signal recognition particle 19kDa 1 1
MIRT031968 C11orf83 chromosome 11 open reading frame 83 1 1
MIRT031969 WNT5A wingless-type MMTV integration site family, member 5A 1 1
MIRT031970 GTF3C3 general transcription factor IIIC, polypeptide 3, 102kDa 1 1
MIRT031971 IWS1 IWS1 homolog (S. cerevisiae) 1 1
MIRT031972 TTLL12 tubulin tyrosine ligase-like family, member 12 2 2
MIRT031973 PVR poliovirus receptor 1 1
MIRT031974 KIF2C kinesin family member 2C 1 1
MIRT031975 TBL3 transducin (beta)-like 3 1 1
MIRT031976 CAMK2G calcium/calmodulin-dependent protein kinase II gamma 1 1
MIRT031977 ATXN2L ataxin 2-like 2 2
MIRT031978 RPSA ribosomal protein SA 1 1
MIRT031979 TSPAN3 tetraspanin 3 2 2
MIRT031980 SCAF4 splicing factor, arginine/serine-rich 15 2 2
MIRT031981 COPS7B COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) 1 1
MIRT031982 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 1
MIRT031983 C17orf75 chromosome 17 open reading frame 75 1 1
MIRT031984 WDR75 WD repeat domain 75 1 1
MIRT031985 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT031986 BTF3 basic transcription factor 3 1 1
MIRT031987 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT031988 KIF1B kinesin family member 1B 1 1
MIRT031989 CASK calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT031990 RPL14 ribosomal protein L14 1 1
MIRT031991 CDC37 cell division cycle 37 homolog (S. cerevisiae) 1 1
MIRT031992 SOWAHC ankyrin repeat domain 57 1 1
MIRT031993 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT031994 SPATA2 spermatogenesis associated 2 1 1
MIRT031995 PRR3 proline rich 3 1 1
MIRT031996 UFC1 ubiquitin-fold modifier conjugating enzyme 1 1 1
MIRT031997 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 1
MIRT031998 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT031999 FAT3 FAT tumor suppressor homolog 3 (Drosophila) 1 1
MIRT032000 SZRD1 chromosome 1 open reading frame 144 1 1
MIRT032001 EN2 engrailed homeobox 2 1 1
MIRT032002 MYO5B myosin VB 1 1
MIRT032003 PDK4 pyruvate dehydrogenase kinase, isozyme 4 1 1
MIRT032004 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT032005 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT032006 FBXW7 F-box and WD repeat domain containing 7 1 1
MIRT032007 STK33 serine/threonine kinase 33 1 1
MIRT032008 DIEXF chromosome 1 open reading frame 107 2 2
MIRT032009 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT032010 AK2 adenylate kinase 2 1 1
MIRT032011 PAK1IP1 PAK1 interacting protein 1 1 1
MIRT032012 PSPH phosphoserine phosphatase 1 1
MIRT032013 RPL31 ribosomal protein L31 1 1
MIRT032014 FAM96B family with sequence similarity 96, member B 1 1
MIRT032015 ARG2 arginase, type II 1 1
MIRT032016 STIP1 stress-induced-phosphoprotein 1 1 1
MIRT032017 ARPC5L actin related protein 2/3 complex, subunit 5-like 1 1
MIRT032018 EIF3F eukaryotic translation initiation factor 3, subunit F 1 1
MIRT032019 IPO11 importin 11 1 1
MIRT032020 RPS3A ribosomal protein S3A 1 1
MIRT032021 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT032022 SLC4A1AP solute carrier family 4 (anion exchanger), member 1, adaptor protein 1 1
MIRT032023 MRPL21 mitochondrial ribosomal protein L21 1 1
MIRT032024 LAMTOR4 chromosome 7 open reading frame 59 1 1
MIRT032025 RPL6 ribosomal protein L6 1 1
MIRT032026 KIN KIN, antigenic determinant of recA protein homolog (mouse) 1 1
MIRT032027 POLR1C polymerase (RNA) I polypeptide C, 30kDa 1 1
MIRT032028 HTRA1 HtrA serine peptidase 1 1 1
MIRT032029 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT032030 GEMIN4 gem (nuclear organelle) associated protein 4 1 1
MIRT032031 GARS glycyl-tRNA synthetase 1 1
MIRT032032 TTF2 transcription termination factor, RNA polymerase II 1 1
MIRT032033 NACA nascent polypeptide-associated complex alpha subunit 1 1
MIRT032034 ZRANB2 zinc finger, RAN-binding domain containing 2 1 1
MIRT032035 PDLIM5 PDZ and LIM domain 5 1 1
MIRT032036 L1CAM L1 cell adhesion molecule 1 1
MIRT032037 TELO2 TEL2, telomere maintenance 2, homolog (S. cerevisiae) 1 1
MIRT032038 KIF14 kinesin family member 14 1 1
MIRT032039 MORF4L1 mortality factor 4 like 1 1 1
MIRT032040 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT032041 SCAMP3 secretory carrier membrane protein 3 1 1
MIRT032042 FAM129B family with sequence similarity 129, member B 1 1
MIRT032043 PLEC plectin 1 1
MIRT032044 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT032045 ATP8A2 ATPase, aminophospholipid transporter, class I, type 8A, member 2 1 1
MIRT032046 IARS isoleucyl-tRNA synthetase 1 1
MIRT032047 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 1
MIRT032048 EFNB2 ephrin-B2 1 1
MIRT032049 FAM189B family with sequence similarity 189, member B 2 2
MIRT032050 LAMB1 laminin, beta 1 1 1
MIRT032051 TNPO1 transportin 1 1 1
MIRT032052 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 1 1
MIRT032053 CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT032054 LMAN2L lectin, mannose-binding 2-like 1 1
MIRT032055 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT032056 PAGR1 chromosome 16 open reading frame 53 1 1
MIRT032057 TOX4 TOX high mobility group box family member 4 1 1
MIRT032058 CALU calumenin 1 1
MIRT032059 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT032060 USP53 ubiquitin specific peptidase 53 1 1
MIRT032061 FAM168A family with sequence similarity 168, member A 1 1
MIRT032062 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 1
MIRT032063 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 1
MIRT032064 UBFD1 ubiquitin family domain containing 1 1 1
MIRT032065 PAQR3 progestin and adipoQ receptor family member III 1 1
MIRT032066 C16orf72 chromosome 16 open reading frame 72 1 1
MIRT032067 TMEM255A family with sequence similarity 70, member A 1 1
MIRT032068 PHF19 PHD finger protein 19 1 1
MIRT032069 ATXN7L3 ataxin 7-like 3 1 1
MIRT032070 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT032071 E2F7 E2F transcription factor 7 1 1
MIRT032072 KIF5A kinesin family member 5A 1 1
MIRT032073 PTPN3 protein tyrosine phosphatase, non-receptor type 3 1 1
MIRT032074 CCDC19 coiled-coil domain containing 19 1 1
MIRT032075 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 2 2
MIRT032076 MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 2 2
MIRT051056 FASTKD1 FAST kinase domains 1 1 1
MIRT051057 UFSP2 UFM1-specific peptidase 2 1 1
MIRT051058 PLEKHN1 pleckstrin homology domain containing, family N member 1 1 1
MIRT051059 KLF14 Kruppel-like factor 14 1 1
MIRT051060 AKAP13 A kinase (PRKA) anchor protein 13 1 1
MIRT051061 PHEX phosphate regulating endopeptidase homolog, X-linked 1 1
MIRT051062 IL36RN interleukin 1 family, member 5 (delta) 1 1
MIRT051063 CACNB2 calcium channel, voltage-dependent, beta 2 subunit 1 1
MIRT051064 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT051065 NAV2 neuron navigator 2 1 1
MIRT051066 OTUD7B OTU domain containing 7B 1 1
MIRT051067 JAK2 Janus kinase 2 1 1
MIRT051068 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT051069 TXNL1 thioredoxin-like 1 1 1
MIRT051070 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT051071 FBXO3 F-box protein 3 1 1
MIRT051072 CPNE8 copine VIII 1 1
MIRT051073 COL4A1 collagen, type IV, alpha 1 1 1
MIRT051074 SENP6 SUMO1/sentrin specific peptidase 6 1 1
MIRT051075 PRR12 proline rich 12 1 1
MIRT051076 SERINC5 serine incorporator 5 1 1
MIRT051077 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT051078 FNBP1 formin binding protein 1 1 1
MIRT051079 FAM150B family with sequence similarity 150, member B 1 1
MIRT051080 CYP27B1 cytochrome P450, family 27, subfamily B, polypeptide 1 1 1
MIRT051081 CHD3 chromodomain helicase DNA binding protein 3 1 1
MIRT051082 LIG4 ligase IV, DNA, ATP-dependent 1 1
MIRT051083 RPS24 ribosomal protein S24 1 1
MIRT051084 S100A14 S100 calcium binding protein A14 1 1
MIRT051085 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT051086 TNK1 tyrosine kinase, non-receptor, 1 1 1
MIRT051087 FBXW11 F-box and WD repeat domain containing 11 1 1
MIRT051088 MLF2 myeloid leukemia factor 2 1 1
MIRT051089 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT051090 ZNF638 zinc finger protein 638 1 1
MIRT051091 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT051092 DIXDC1 DIX domain containing 1 1 1
MIRT051093 EEF2K eukaryotic elongation factor-2 kinase 1 1
MIRT051094 TMEM154 transmembrane protein 154 1 1
MIRT051095 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT051096 SLFN13 schlafen family member 13 1 1
MIRT051097 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 1 1
MIRT051098 COX1 cytochrome c oxidase subunit I 1 1
MIRT051099 IDS iduronate 2-sulfatase 1 1
MIRT051100 C19orf54 chromosome 19 open reading frame 54 1 1
MIRT051101 PIP4K2B phosphatidylinositol-5-phosphate 4-kinase, type II, beta 1 1
MIRT051102 OTOL1 otolin-1 1 1
MIRT051103 AGER advanced glycosylation end product-specific receptor 1 1
MIRT051104 PGLYRP1 peptidoglycan recognition protein 1 1 1
MIRT051105 ACTN4 actinin, alpha 4 1 1
MIRT051106 GLB1L3 galactosidase, beta 1-like 3 1 1
MIRT051107 FSCN2 fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) 1 1
MIRT051108 NXPH2 neurexophilin 2 1 1
MIRT051109 CABIN1 calcineurin binding protein 1 1 1
MIRT051110 MOB3C MOB1, Mps One Binder kinase activator-like 2C (yeast) 1 1
MIRT051111 ADK adenosine kinase 1 1
MIRT051112 ARL2BP ADP-ribosylation factor-like 2 binding protein 1 1
MIRT051113 RP1L1 retinitis pigmentosa 1-like 1 1 1
MIRT051114 GPR157 G protein-coupled receptor 157 1 1
MIRT051115 IRS4 insulin receptor substrate 4 1 1
MIRT051116 KLHL34 kelch-like 34 (Drosophila) 1 1
MIRT051117 HSPA8 heat shock 70kDa protein 8 1 1
MIRT051118 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 1 1
MIRT051119 FAT2 FAT tumor suppressor homolog 2 (Drosophila) 1 1
MIRT051120 RPS3 ribosomal protein S3 1 1
MIRT051121 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 1 1
MIRT051122 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT051123 SYT11 synaptotagmin XI 1 1
MIRT051124 VKORC1 vitamin K epoxide reductase complex, subunit 1 1 1
MIRT051125 GPR55 G protein-coupled receptor 55 1 1
MIRT051126 MRC2 mannose receptor, C type 2 1 1
MIRT051127 LSM5 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT051128 DDN dendrin 1 1
MIRT051129 COL4A2 collagen, type IV, alpha 2 1 1
MIRT051130 UBXN2B UBX domain protein 2B 1 1
MIRT051131 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 1
MIRT051132 ZNF644 zinc finger protein 644 1 1
MIRT051133 ROGDI rogdi homolog (Drosophila) 1 1
MIRT051134 MMP25 matrix metallopeptidase 25 1 1
MIRT051135 RIOK3 RIO kinase 3 (yeast) 1 1
MIRT051136 GSTT2B glutathione S-transferase theta 2B (gene/pseudogene) 1 1
MIRT051137 APLNR apelin receptor 1 1
MIRT051138 IGSF1 immunoglobulin superfamily, member 1 1 1
MIRT051139 CCT8 chaperonin containing TCP1, subunit 8 (theta) 1 1
MIRT051140 USMG5 up-regulated during skeletal muscle growth 5 homolog (mouse) 1 1
MIRT051141 LYPD2 LY6/PLAUR domain containing 2 1 1
MIRT051142 YIPF2 Yip1 domain family, member 2 1 1
MIRT051143 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT051144 HIST1H1C histone cluster 1, H1c 1 1
MIRT051145 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT051146 RPH3AL rabphilin 3A-like (without C2 domains) 1 1
MIRT051147 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT051148 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT051149 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT051150 POLB polymerase (DNA directed), beta 1 1
MIRT051151 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT051152 ADAD2 adenosine deaminase domain containing 2 1 1
MIRT051153 CLIP2 CAP-GLY domain containing linker protein 2 1 1
MIRT051154 IPO5 importin 5 1 1
MIRT051155 POTEF POTE ankyrin domain family, member F 1 1
MIRT051156 LIMA1 LIM domain and actin binding 1 1 1
MIRT051157 ACTN1 actinin, alpha 1 1 1
MIRT051158 FAM208A chromosome 3 open reading frame 63 1 1
MIRT051159 IRAK3 interleukin-1 receptor-associated kinase 3 1 1
MIRT051160 NGFRAP1 nerve growth factor receptor (TNFRSF16) associated protein 1 1 1
MIRT051161 TMED1 transmembrane emp24 protein transport domain containing 1 1 1
MIRT051162 BNC2 basonuclin 2 1 1
MIRT051163 WDR5B WD repeat domain 5B 1 1
MIRT051164 INO80D INO80 complex subunit D 1 1
MIRT051165 USP8 ubiquitin specific peptidase 8 1 1
MIRT051166 RPS17 ribosomal protein S17 1 1
MIRT051167 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT051168 AMOT angiomotin 1 1
MIRT051169 AMER1 family with sequence similarity 123B 1 1
MIRT051170 NEURL4 neuralized homolog 4 (Drosophila) 1 1
MIRT051171 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT051172 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT051173 RAN RAN, member RAS oncogene family 1 1
MIRT051174 MARCH6 membrane-associated ring finger (C3HC4) 6 1 1
MIRT051175 FBXO41 F-box protein 41 1 1
MIRT051176 XYLT1 xylosyltransferase I 1 1
MIRT051177 DOCK9 dedicator of cytokinesis 9 1 1
MIRT051178 LONP1 lon peptidase 1, mitochondrial 1 1
MIRT051179 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT051180 GPAA1 glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) 1 1
MIRT051181 VCL vinculin 1 1
MIRT051182 TIGD3 tigger transposable element derived 3 1 1
MIRT051183 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT051184 KANSL3 KIAA1310 1 1
MIRT051185 ZNF280C zinc finger protein 280C 1 1
MIRT051186 RUNDC3B RUN domain containing 3B 1 1
MIRT051187 E2F3 E2F transcription factor 3 1 1
MIRT051188 CECR5 cat eye syndrome chromosome region, candidate 5 1 1
MIRT051189 TDRD3 tudor domain containing 3 1 1
MIRT051190 IKZF4 IKAROS family zinc finger 4 (Eos) 1 1
MIRT051191 TES testis derived transcript (3 LIM domains) 1 1
MIRT051192 KCNS2 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 1 1
MIRT051193 SLC9A2 solute carrier family 9 (sodium/hydrogen exchanger), member 2 1 1
MIRT051194 MEGF8 multiple EGF-like-domains 8 1 1
MIRT051195 HMGN1 high-mobility group nucleosome binding domain 1 1 1
MIRT051196 THAP7 THAP domain containing 7 1 1
MIRT051197 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT051198 ZNF827 zinc finger protein 827 1 1
MIRT051199 SART1 squamous cell carcinoma antigen recognized by T cells 1 1
MIRT051200 AQP12B aquaporin 12B 1 1
MIRT051201 CLTC clathrin, heavy chain (Hc) 1 1
MIRT051202 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT051203 PSMC1 proteasome (prosome, macropain) 26S subunit, ATPase, 1 1 1
MIRT051204 BTBD2 BTB (POZ) domain containing 2 1 1
MIRT051205 PLD3 phospholipase D family, member 3 1 1
MIRT051206 EGLN2 egl nine homolog 2 (C. elegans) 1 1
MIRT051207 ZZEF1 zinc finger, ZZ-type with EF-hand domain 1 1 1
MIRT051208 GOT2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) 1 1
MIRT051209 SBF1 SET binding factor 1 1 1
MIRT051210 XPO4 exportin 4 1 1
MIRT051211 SOCS2 suppressor of cytokine signaling 2 1 1
MIRT051212 HM13 histocompatibility (minor) 13 1 1
MIRT051213 ARMCX2 armadillo repeat containing, X-linked 2 1 1
MIRT051214 FAM105B family with sequence similarity 105, member B 1 1
MIRT051215 CYB5R1 cytochrome b5 reductase 1 1 1
MIRT051216 TUBA1A tubulin, alpha 1a 1 1
MIRT051217 NSUN2 NOP2/Sun domain family, member 2 1 1
MIRT051218 FAM155B family with sequence similarity 155, member B 1 1
MIRT051219 FECH ferrochelatase 1 1
MIRT051220 CNN3 calponin 3, acidic 1 1
MIRT051221 DHX35 DEAH (Asp-Glu-Ala-His) box polypeptide 35 1 1
MIRT051222 HOXD13 homeobox D13 1 1
MIRT051223 TRIM4 tripartite motif-containing 4 1 1
MIRT051224 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT051225 TXLNG taxilin gamma 1 1
MIRT051226 NR1I2 nuclear receptor subfamily 1, group I, member 2 1 1
MIRT051227 ZFPL1 zinc finger protein-like 1 1 1
MIRT051228 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT051229 STT3B STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) 1 1
MIRT051230 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT051231 TUBGCP2 tubulin, gamma complex associated protein 2 1 1
MIRT051232 SLMO2 slowmo homolog 2 (Drosophila) 1 1
MIRT051233 NRXN1 neurexin 1 1 1
MIRT051234 TCP1 t-complex 1 1 1
MIRT051235 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT051236 PLEKHM2 pleckstrin homology domain containing, family M (with RUN domain) member 2 1 1
MIRT051237 IMPAD1 inositol monophosphatase domain containing 1 1 1
MIRT051238 PDE3B phosphodiesterase 3B, cGMP-inhibited 1 1
MIRT051239 HIST1H2BC histone cluster 1, H2bc 1 1
MIRT051240 SETD5 SET domain containing 5 1 1
MIRT051241 CREB3L2 cAMP responsive element binding protein 3-like 2 1 1
MIRT051242 ZNF791 zinc finger protein 791 1 1
MIRT051243 NMD3 NMD3 homolog (S. cerevisiae) 1 1
MIRT051244 PCDHGB4 protocadherin gamma subfamily B, 4 1 1
MIRT051245 DICER1 dicer 1, ribonuclease type III 1 1
MIRT051246 KIAA2013 KIAA2013 1 1
MIRT051247 XPO6 exportin 6 1 1
MIRT051248 BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 1 1
MIRT051249 TEP1 telomerase-associated protein 1 1 1
MIRT051250 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT051251 ACTB actin, beta 1 1
MIRT051252 TRAF4 TNF receptor-associated factor 4 1 1
MIRT051253 TFRC transferrin receptor (p90, CD71) 1 1
MIRT051254 NUP155 nucleoporin 155kDa 1 1
MIRT051255 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 1 1
MIRT051256 TOR1A torsin family 1, member A (torsin A) 1 1
MIRT051257 HTT huntingtin 1 1
MIRT051258 ZBTB2 zinc finger and BTB domain containing 2 1 1
MIRT051259 HIST1H2AJ histone cluster 1, H2aj 1 1
MIRT051260 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT051261 GTPBP4 GTP binding protein 4 1 1
MIRT051262 H2AFX H2A histone family, member X 1 1
MIRT051263 LYRM5 LYR motif containing 5 1 1
MIRT051264 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT051265 MIS12 MIS12, MIND kinetochore complex component, homolog (S. pombe) 1 1
MIRT051266 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 1 1
MIRT051267 NUP98 nucleoporin 98kDa 1 1
MIRT051268 SLC25A38 solute carrier family 25, member 38 1 1
MIRT051269 SMEK2 SMEK homolog 2, suppressor of mek1 (Dictyostelium) 1 1
MIRT051270 COQ3 coenzyme Q3 homolog, methyltransferase (S. cerevisiae) 1 1
MIRT051271 TCFL5 transcription factor-like 5 (basic helix-loop-helix) 1 1
MIRT051272 MYO19 myosin XIX 1 1
MIRT051273 HIST1H4B histone cluster 1, H4b 1 1
MIRT051274 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT051275 NPRL3 nitrogen permease regulator-like 3 (S. cerevisiae) 1 1
MIRT051276 LMTK3 lemur tyrosine kinase 3 1 1
MIRT051277 CTSD cathepsin D 1 1
MIRT051278 SND1 staphylococcal nuclease and tudor domain containing 1 1 1
MIRT051279 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
MIRT051280 CAMSAP3 KIAA1543 1 1
MIRT051281 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT051282 ABHD2 abhydrolase domain containing 2 1 1
MIRT051283 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT051284 SLC19A1 solute carrier family 19 (folate transporter), member 1 1 1
MIRT051285 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT051286 TBP TATA box binding protein 1 1
MIRT051287 NISCH nischarin 1 1
MIRT051288 FLNA filamin A, alpha 1 1
MIRT051289 BRAT1 chromosome 7 open reading frame 27 1 1
MIRT051290 PTPN18 protein tyrosine phosphatase, non-receptor type 18 (brain-derived) 1 1
MIRT051291 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT051292 IBTK inhibitor of Bruton agammaglobulinemia tyrosine kinase 1 1
MIRT051293 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT051294 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT051295 MED24 mediator complex subunit 24 1 1
MIRT051296 TGOLN2 trans-golgi network protein 2 1 1
MIRT051297 GOLGA7 golgin A7 1 1
MIRT051298 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT051299 ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 1 1
MIRT051300 SLC4A2 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) 1 1
MIRT051301 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1
MIRT051302 HEATR3 HEAT repeat containing 3 1 1
MIRT051303 DHX38 DEAH (Asp-Glu-Ala-His) box polypeptide 38 1 1
MIRT051304 BTRC beta-transducin repeat containing 1 1
MIRT051305 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT051306 CCDC59 coiled-coil domain containing 59 1 1
MIRT051307 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 1
MIRT051308 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT051309 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 1
MIRT051310 MED12 mediator complex subunit 12 1 1