Accession ID: MIRT005785 [miRNA, hsa-miR-221-3p :: TP53, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-221LinkOut: [miRBase ]
Synonyms MIRN221, miRNA221, mir-221, MIR221
Description Homo sapiens miR-221 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-221-3p
Mature Sequence 65| AGCUACAUUGUCUGCUGGGUUUC |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-221-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TP53 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BCC7, LFS1, P53, TRP53
Description tumor protein p53
Transcript NM_001126114    LinkOut: [ RefSeq ]
Other Transcripts NM_001126112 , NM_000546 , NM_001126113 , NM_001126115 , NM_001126116 , NM_001126117   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TP53 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TP53
(miRNA target sites are highlighted)
>TP53|NM_001126114|3'UTR
   1 AGAGAGCATGAAAATGGTTCTATGACTTTGCCTGATACAGATGCTACTTGACTTACGATGGTGTTACTTCCTGATAAACT
  81 CGTCGTAAGTTGAAAATATTATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAG
 161 GATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTC
 241 CCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTGTTCCCCACTGACAGC
 321 CTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTCAGA
 401 AGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGGAGG
 481 AGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGTTCT
 561 TGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTCCCT
 641 CACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGCATTTGCACCTACCTCACAGAGTGCATTGTG
 721 AGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGAACTTGACCCCCTTGAGGGT
 801 GCTTGTTCCCTCTCCCTGTTGGTCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTCAAG
 881 TCTCTGCTGGCCCAGCCAAACCCTGTCTGACAACCTCTTGGTGAACCTTAGTACCTAAAAGGAAATCTCACCCCATCCCA
 961 CACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATTTCTTTT
1041 TTCTTTTTTTTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTGATC
1121 TTGGCTTACTGCAGCCTTTGCCTCCCCGGCTCGAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTCATG
1201 CCACCATGGCCAGCCAACTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTTGCCCAGGCTGGTCTCAAACTCCTGG
1281 GCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACAATTGTGAGCCACCACGTCCAGCTGGAAGGGTCA
1361 ACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTTTTA
1441 TATCGATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cuuuGGGUCGUCUGUUACAUCGa 5'
              |:||||   |:: ||||| 
Target 5' ctgcCTCAGCCTCCGGAGTAGCt 3'
1161 - 1183 115.00 -16.40
2
miRNA  3' cuuuggGUCGUCUGUUACAUCga 5'
                |||| |:: | ||||  
Target 5' gttgggCAGCTGGTTAGGTAGag 3'
846 - 868 109.00 -11.50
3
miRNA  3' cuuugggucgucUGUUACAUCGa 5'
                      |||:||| || 
Target 5' agatggggtctcACAGTGTTGCc 3'
1236 - 1258 107.00 -10.20
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: TP53    [ Non-Functional MTI ]
Validation Method Western blot
Conditions 293T , OECM-1
Disease oral squamous cell carcinoma
Original Description (Extracted from the article) ... Western blot analysis indicated that there was remark- able downregulation of p27 and p57 in OECM-1-miR-221/miR-222 and SAS-miR-222 cells. However, only a slight downregulation of p27 and p57 in SAS-miR-221 cells was noted. Furthermore, p21 was downregulated in SAS-miR-221 and SAS-miR-222 cells relative to the controls. However, ectopic miR-221/miR-222 expression did not change p53 expression (Fig. 3). ...

- Yang, C. J. Shen, W. G. Liu, C. J. Chen, Y. et al., 2011, Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology.

Article - Yang, C. J. Shen, W. G. Liu, C. J. Chen, Y. et al.
- Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 2011
J Oral Pathol Med (2011) Backgrounds: MicroRNAs are small noncoding RNAs involved in posttranscriptional gene regulation, which play an important role in both physiological functioning and pathological progression. The miR-221/miR-222 microRNA family has been shown to be related to the neoplastic process in a number of different types of cancers; nevertheless, its function in oral squamous cell carcinoma (OSCC) remained uncertain. Materials and Methods: Paired OSCC and matched noncancerous oral mucosa were examined for miR-221/miR-222 expression using quantitative reverse-transcription PCR. Ectopic expression of miR-221/miR-222 by lentiviral infection was investigated to explore its in vitro and in vivo impact on the oncogenic phenotype and the expression of various target genes. The expression of Cip/Kip cell cycle regulator p27 in tumors was analyzed with immunohistochemistry. Results: The expression levels of miR-221 and miR-222 were highly correlated in OSCC. Increased miR-221/miR-222 expression was found in 40% of OSCC tissues. The ectopic expression of miR-221 or of miR-222 increased growth and anchorage-independent colony formation of OSCC cell lines. It also resulted in an increase in the tumorigenesis of an OSCC cell line in nude mice. Western blot analysis suggested that p27 and p57 might be the targets of miR-221/miR-222. p27 expression was reversely associated with the miR-221 and miR-222 expression level in OSCC tissues. Conclusions: Our findings suggested that increased miR-221/miR-222 expression was associated with the OSCC cell growth.
LinkOut: [PMID: 21226887]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
357 hsa-miR-221-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000137 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 6 30
MIRT000140 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 4
MIRT000141 BMF Bcl2 modifying factor 4 1
MIRT000434 FOXO3 forkhead box O3 4 1
MIRT001780 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 5 12
MIRT001971 HOXB5 homeobox B5 1 1
MIRT002272 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 5 5
MIRT002335 TMED7 transmembrane emp24 protein transport domain containing 7 4 9
MIRT003358 DDIT4 DNA-damage-inducible transcript 4 6 2
MIRT003359 BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 5 1
MIRT003360 TBK1 TANK-binding kinase 1 4 1
MIRT003361 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 2 1
MIRT003362 DKK2 dickkopf 2 homolog (Xenopus laevis) 2 1
MIRT003363 CREBZF CREB/ATF bZIP transcription factor 2 1
MIRT003364 BRAP BRCA1 associated protein 2 1
MIRT003365 USP18 ubiquitin specific peptidase 18 2 1
MIRT003366 ARIH2 ariadne homolog 2 (Drosophila) 2 1
MIRT003367 BBC3 BCL2 binding component 3 5 4
MIRT003368 HMGXB4 HMG box domain containing 4 2 1
MIRT003452 TIMP3 TIMP metallopeptidase inhibitor 3 3 5
MIRT003757 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 2 1
MIRT004430 ICAM1 intercellular adhesion molecule 1 3 2
MIRT004484 FOS FBJ murine osteosarcoma viral oncogene homolog 5 3
MIRT004753 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 5 1
MIRT005295 NAIP NLR family, apoptosis inhibitory protein 2 1
MIRT005320 ESR1 estrogen receptor 1 4 1
MIRT005475 TICAM1 toll-like receptor adaptor molecule 1 4 1
MIRT005585 PTEN phosphatase and tensin homolog 4 4
MIRT005714 SELE selectin E 1 1
MIRT005785 TP53 tumor protein p53 1 1
MIRT005787 CORO1A coronin, actin binding protein, 1A 2 2
MIRT005789 TCEAL1 transcription elongation factor A (SII)-like 1 1 1
MIRT006018 DIRAS3 DIRAS family, GTP-binding RAS-like 3 3 2
MIRT006063 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 1
MIRT006376 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006841 TRPS1 trichorhinophalangeal syndrome I 4 1
MIRT006917 CERS2 ceramide synthase 2 3 1
MIRT007377 FMR1 fragile X mental retardation 1 1 1
MIRT024137 PDIK1L PDLIM1 interacting kinase 1 like 1 2
MIRT024138 ABHD3 abhydrolase domain containing 3 1 1
MIRT024139 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT024140 SPTSSA serine palmitoyltransferase, small subunit A 1 1
MIRT024141 CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant 1 2
MIRT024142 NR2C2AP nuclear receptor 2C2-associated protein 1 1
MIRT024143 APOL2 apolipoprotein L, 2 1 1
MIRT024144 TDRP chromosome 8 open reading frame 42 1 1
MIRT024145 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT024146 TMEM168 transmembrane protein 168 1 1
MIRT024147 TUB tubby homolog (mouse) 1 1
MIRT024148 ZNF652 zinc finger protein 652 1 2
MIRT024149 DVL2 dishevelled, dsh homolog 2 (Drosophila) 2 1
MIRT024150 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT024151 TNIP1 TNFAIP3 interacting protein 1 1 1
MIRT024152 KLF9 Kruppel-like factor 9 1 1
MIRT024153 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT024154 TMEM64 transmembrane protein 64 1 1
MIRT024155 GID8 GID complex subunit 8 homolog (S. cerevisiae) 1 1
MIRT024156 ZNF571 zinc finger protein 571 1 1
MIRT024157 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT024158 ATL2 atlastin GTPase 2 1 1
MIRT024159 E2F3 E2F transcription factor 3 1 1
MIRT024160 PTBP3 polypyrimidine tract binding protein 3 1 2
MIRT024161 CXorf38 chromosome X open reading frame 38 1 1
MIRT024162 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT024163 NHSL1 NHS-like 1 1 1
MIRT024164 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 1
MIRT024165 WDR61 WD repeat domain 61 1 1
MIRT024166 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 1
MIRT024167 SLC6A9 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 1 1
MIRT024168 TMEM245 transmembrane protein 245 1 1
MIRT024169 RNF20 ring finger protein 20, E3 ubiquitin protein ligase 1 1
MIRT024170 PHF12 PHD finger protein 12 1 1
MIRT024171 WEE1 WEE1 homolog (S. pombe) 4 2
MIRT024172 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT024173 LYSMD1 LysM, putative peptidoglycan-binding, domain containing 1 1 1
MIRT024174 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT024175 TIPARP TCDD-inducible poly(ADP-ribose) polymerase 1 1
MIRT024176 GPR107 G protein-coupled receptor 107 1 1
MIRT024177 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT024178 STAMBP STAM binding protein 1 1
MIRT024179 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 1 1
MIRT024180 UBE2N ubiquitin-conjugating enzyme E2N 1 1
MIRT024181 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT024182 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT024183 RNF4 ring finger protein 4 1 1
MIRT024184 ASXL3 additional sex combs like 3 (Drosophila) 1 1
MIRT024185 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT024186 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT024187 RNF44 ring finger protein 44 1 1
MIRT024188 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT024189 ZNF275 zinc finger protein 275 1 2
MIRT024190 TMEM132B transmembrane protein 132B 1 1
MIRT024191 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT024192 BRD1 bromodomain containing 1 1 1
MIRT024193 AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 1 1
MIRT024194 FBXO28 F-box protein 28 1 1
MIRT024195 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 1
MIRT024196 PANK3 pantothenate kinase 3 1 1
MIRT024197 ZKSCAN8 zinc finger protein 192 1 1
MIRT024198 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT024199 UBE2J1 ubiquitin-conjugating enzyme E2, J1 1 1
MIRT024200 MIDN midnolin 1 2
MIRT024201 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT024202 ATXN1 ataxin 1 1 2
MIRT024203 POGZ pogo transposable element with ZNF domain 1 1
MIRT024204 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT024205 HECTD2 HECT domain containing E3 ubiquitin protein ligase 2 4 2
MIRT024206 POU3F2 POU class 3 homeobox 2 1 1
MIRT024207 HOXC10 homeobox C10 1 1
MIRT024208 MEOX2 mesenchyme homeobox 2 2 1
MIRT024209 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT046837 RUNDC3B RUN domain containing 3B 1 1
MIRT046838 TRAF4 TNF receptor-associated factor 4 1 1
MIRT046839 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT046840 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT046841 RBM33 RNA binding motif protein 33 1 1
MIRT046842 CROT carnitine O-octanoyltransferase 1 1
MIRT046843 ACTB actin, beta 1 1
MIRT046844 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT046845 USP28 ubiquitin specific peptidase 28 1 1
MIRT046846 PALB2 partner and localizer of BRCA2 1 1
MIRT046847 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT046848 YY1 YY1 transcription factor 1 1
MIRT046849 PLP2 proteolipid protein 2 (colonic epithelium-enriched) 1 1
MIRT046850 PXN paxillin 1 1
MIRT046851 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT046852 RPS24 ribosomal protein S24 1 1
MIRT046853 TSN translin 1 1
MIRT046854 HIST1H3D histone cluster 1, H3d 1 1
MIRT046855 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT046856 PSMD4 proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 1 1
MIRT046857 PELO pelota homolog (Drosophila) 1 1
MIRT046858 LGTN ligatin 1 1
MIRT046859 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT046860 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT046861 HIST2H3D histone cluster 2, H3d 1 1
MIRT046862 MTSS1L metastasis suppressor 1-like 1 1
MIRT046863 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046864 NOP58 NOP58 ribonucleoprotein homolog (yeast) 1 1
MIRT046865 TUBA1C tubulin, alpha 1c 1 1
MIRT046866 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT046867 TMEM248 transmembrane protein 248 1 1
MIRT046868 RAB5C RAB5C, member RAS oncogene family 1 1
MIRT046869 RPL15 ribosomal protein L15 1 1
MIRT046870 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT046871 LPHN2 latrophilin 2 1 1
MIRT046872 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT046873 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT046874 ASXL2 additional sex combs like 2 (Drosophila) 1 1
MIRT046875 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT046876 B4GALT2 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 1 1
MIRT046877 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT046878 PEX19 peroxisomal biogenesis factor 19 1 1
MIRT046879 PITPNM1 phosphatidylinositol transfer protein, membrane-associated 1 1 1
MIRT046880 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT046881 KIF16B kinesin family member 16B 1 1
MIRT046882 SEPHS1 selenophosphate synthetase 1 1 1
MIRT046883 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT046884 SF1 splicing factor 1 1 1
MIRT046885 RHOA ras homolog family member A 1 1
MIRT046886 RBM39 RNA binding motif protein 39 1 1
MIRT046887 HIST1H2AE histone cluster 1, H2ae 1 1
MIRT046888 FLNA filamin A, alpha 1 1
MIRT046889 CCDC142 coiled-coil domain containing 142 1 1
MIRT046890 ZYX zyxin 1 1
MIRT046891 KLHL8 kelch-like 8 (Drosophila) 1 1
MIRT046892 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT046893 MDFIC MyoD family inhibitor domain containing 1 1
MIRT046894 NME2 NME/NM23 nucleoside diphosphate kinase 2 1 1
MIRT046895 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT046896 UBC ubiquitin C 1 1
MIRT046897 UQCR10 ubiquinol-cytochrome c reductase, complex III subunit X 1 1
MIRT046898 ADD1 adducin 1 (alpha) 1 1
MIRT046899 HECTD1 HECT domain containing E3 ubiquitin protein ligase 1 1 1
MIRT046900 FUS fused in sarcoma 1 1
MIRT046901 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT046902 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT046903 RPL21 ribosomal protein L21 1 1
MIRT046904 WDR34 WD repeat domain 34 1 1
MIRT046905 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT046906 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT046907 AP3B1 adaptor-related protein complex 3, beta 1 subunit 1 1
MIRT046908 EVL Enah/Vasp-like 1 1
MIRT046909 NCL nucleolin 1 1
MIRT046910 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT046911 PEG10 paternally expressed 10 1 1
MIRT046912 ANKRD28 ankyrin repeat domain 28 1 1
MIRT046913 TMEM183A transmembrane protein 183A 1 1
MIRT046914 LDHB lactate dehydrogenase B 1 1
MIRT046915 TRIM28 tripartite motif containing 28 1 1
MIRT046916 NUP210 nucleoporin 210kDa 1 1
MIRT046917 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 1
MIRT046918 PEX1 peroxisomal biogenesis factor 1 1 1
MIRT046919 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT046920 SRP68 signal recognition particle 68kDa 1 1
MIRT046921 NUF2 NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT046922 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT046923 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 1 1
MIRT046924 CLIC1 chloride intracellular channel 1 1 1
MIRT046925 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT046926 NFYC nuclear transcription factor Y, gamma 1 1
MIRT046927 PHF21A PHD finger protein 21A 1 1
MIRT046928 TSC22D2 TSC22 domain family, member 2 1 1
MIRT046929 PKM pyruvate kinase, muscle 1 1
MIRT046930 CENPT centromere protein T 1 1
MIRT046931 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1 1
MIRT046932 LAMTOR5 late endosomal/lysosomal adaptor, MAPK and MTOR activator 5 1 1
MIRT046933 MIEN1 migration and invasion enhancer 1 1 1
MIRT046934 RPS7 ribosomal protein S7 1 1
MIRT046935 NABP2 nucleic acid binding protein 2 1 1
MIRT046936 IQCE IQ motif containing E 1 1
MIRT046937 RPLP0 ribosomal protein, large, P0 1 1
MIRT046938 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT046939 CDC25C cell division cycle 25 homolog C (S. pombe) 1 1
MIRT046940 TOB2 transducer of ERBB2, 2 1 1
MIRT046941 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT046942 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT046943 SPAG5 sperm associated antigen 5 1 1
MIRT046944 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT046945 SGTA small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha 1 1
MIRT046946 SAPCD2 suppressor APC domain containing 2 1 1
MIRT046947 NFYA nuclear transcription factor Y, alpha 1 1
MIRT046948 KHSRP KH-type splicing regulatory protein 1 1
MIRT046949 AMOT angiomotin 1 1
MIRT046950 POLG polymerase (DNA directed), gamma 1 1
MIRT046951 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT046952 FBN3 fibrillin 3 1 1
MIRT046953 SPRYD3 SPRY domain containing 3 1 1
MIRT046954 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT046955 BAG3 BCL2-associated athanogene 3 1 1
MIRT046956 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 1 1
MIRT046957 PRDM16 PR domain containing 16 1 1
MIRT046958 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT046959 UNC13B unc-13 homolog B (C. elegans) 1 1
MIRT046960 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT046961 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT046962 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT046963 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT046964 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT046965 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT046966 RBM6 RNA binding motif protein 6 1 1
MIRT046967 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT046968 CNRIP1 cannabinoid receptor interacting protein 1 1 1
MIRT046969 NUP205 nucleoporin 205kDa 1 1
MIRT046970 DENR density-regulated protein 1 1
MIRT046971 ACTG1 actin, gamma 1 1 1
MIRT046972 ZNF35 zinc finger protein 35 1 1
MIRT046973 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT046974 NDUFS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) 1 1
MIRT046975 CABYR calcium binding tyrosine-(Y)-phosphorylation regulated 1 1
MIRT046976 MFN2 mitofusin 2 1 1
MIRT046977 ARHGAP42 Rho GTPase activating protein 42 1 3
MIRT046978 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT052943 GJA1 gap junction protein, alpha 1, 43kDa 2 1
MIRT053145 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 2 1
MIRT053311 ASZ1 ankyrin repeat, SAM and basic leucine zipper domain containing 1 4 1
MIRT053702 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT053703 CAMKK1 calcium/calmodulin-dependent protein kinase kinase 1, alpha 1 1
MIRT053704 ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) 1 1
MIRT053706 PCDHA1 protocadherin alpha 1 1 1
MIRT053711 PCDHA6 protocadherin alpha 6 1 1
MIRT053712 PCDHA7 protocadherin alpha 7 1 1
MIRT053713 PCDHA8 protocadherin alpha 8 1 1
MIRT053714 PCDHAC1 protocadherin alpha subfamily C, 1 1 1
MIRT053715 PCDHAC2 protocadherin alpha subfamily C, 2 1 1
MIRT053716 PCDHA10 protocadherin alpha 10 1 1
MIRT053717 PCDHA11 protocadherin alpha 11 1 1
MIRT053718 PCDHA12 protocadherin alpha 12 1 1
MIRT053719 PCDHA13 protocadherin alpha 13 1 1
MIRT053720 PCDHA2 protocadherin alpha 2 1 1
MIRT053721 PCDHA3 protocadherin alpha 3 1 1
MIRT053722 PCDHA4 protocadherin alpha 4 1 1
MIRT053723 PCDHA5 protocadherin alpha 5 1 1
MIRT053724 PDGFA platelet-derived growth factor alpha polypeptide 1 1
MIRT053725 SOX11 SRY (sex determining region Y)-box 11 1 1
MIRT053726 ACVR2B activin A receptor, type IIB 1 1
MIRT053727 MAPK10 mitogen-activated protein kinase 10 1 1
MIRT053728 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT054352 RB1 retinoblastoma 1 3 1
MIRT054353 APAF1 apoptotic peptidase activating factor 1 3 1
MIRT054354 ANXA1 annexin A1 3 1
MIRT054355 CTCF CCCTC-binding factor (zinc finger protein) 3 1
MIRT054586 RAB1A RAB1A, member RAS oncogene family 3 1
MIRT054649 RECK reversion-inducing-cysteine-rich protein with kazal motifs 3 1
MIRT054771 SIRT1 sirtuin 1 3 1
MIRT054901 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 1 1
MIRT057259 FAM35A family with sequence similarity 35, member A 1 1
MIRT099153 MYLIP myosin regulatory light chain interacting protein 1 2
MIRT243224 MAT2A methionine adenosyltransferase II, alpha 1 4
MIRT256500 PAIP2 poly(A) binding protein interacting protein 2 1 1
MIRT264769 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 1
MIRT320129 TSPAN13 tetraspanin 13 1 2
MIRT322524 HMBOX1 homeobox containing 1 1 1
MIRT438218 RUNX1 runt-related transcription factor 1 2 1
MIRT438219 ARNT aryl hydrocarbon receptor nuclear translocator 2 1
MIRT438230 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 4 6
MIRT438233 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT438234 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 1 1
MIRT438253 ADAM1A ADAM metallopeptidase domain 1A, pseudogene 1 1
MIRT438254 STAT5A signal transducer and activator of transcription 5A 1 1
MIRT438294 MGMT O-6-methylguanine-DNA methyltransferase 2 1
MIRT438546 SOCS3 suppressor of cytokine signaling 3 2 1
MIRT438547 SOCS1 suppressor of cytokine signaling 1 2 1
MIRT438601 RAD51 RAD51 homolog (S. cerevisiae) 1 1
MIRT441688 ABLIM1 actin binding LIM protein 1 1 3
MIRT442657 OIP5 Opa interacting protein 5 1 3
MIRT451543 CIAPIN1 cytokine induced apoptosis inhibitor 1 1 1
MIRT461460 SLC19A3 solute carrier family 19, member 3 1 1
MIRT464592 UBN2 ubinuclein 2 1 2
MIRT474332 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 5
MIRT477807 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478192 DDX6 DEAD (Asp-Glu-Ala-Asp) box helicase 6 1 3
MIRT480336 C5orf51 chromosome 5 open reading frame 51 1 1
MIRT481490 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT495910 TRAT1 T cell receptor associated transmembrane adaptor 1 1 1
MIRT497808 FAM84A family with sequence similarity 84, member A 1 1
MIRT512976 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 2
MIRT519357 OBFC1 oligonucleotide/oligosaccharide-binding fold containing 1 1 2
MIRT520906 STMN1 stathmin 1 1 2
MIRT525162 PGPEP1 pyroglutamyl-peptidase I 1 1
MIRT529457 MKKS McKusick-Kaufman syndrome 1 1
MIRT530966 EXO5 exonuclease 5 1 2
MIRT533031 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT533057 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT533274 VANGL1 vang-like 1 (van gogh, Drosophila) 1 1
MIRT534224 SLC25A36 solute carrier family 25 (pyrimidine nucleotide carrier ), member 36 1 1
MIRT537265 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT538435 COG5 component of oligomeric golgi complex 5 1 1
MIRT543197 FICD FIC domain containing 1 1
MIRT546722 RNPS1 RNA binding protein S1, serine-rich domain 1 2
MIRT546985 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT549568 C19orf12 chromosome 19 open reading frame 12 1 1
MIRT552569 ZFP30 zinc finger protein 30 homolog (mouse) 1 2
MIRT554086 SNX4 sorting nexin 4 1 1
MIRT558733 CHORDC1 cysteine and histidine-rich domain (CHORD) containing 1 1 1
MIRT559694 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT562520 CDK6 cyclin-dependent kinase 6 1 1
MIRT562674 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 1
MIRT565370 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT567968 CPSF6 cleavage and polyadenylation specific factor 6, 68kDa 1 1
MIRT568111 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT570810 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT571507 ZNF805 zinc finger protein 805 1 1
MIRT571616 SRSF2 serine/arginine-rich splicing factor 2 1 1
MIRT571798 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT572087 EXOC8 exocyst complex component 8 1 1
MIRT573871 PRPS1L1 phosphoribosyl pyrophosphate synthetase 1-like 1 1 1
MIRT638366 RBMS2 RNA binding motif, single stranded interacting protein 2 1 1
MIRT639930 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT643166 ZFP1 zinc finger protein 1 homolog (mouse) 1 1
MIRT649464 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT659058 DERL2 derlin 2 1 1
MIRT691898 FBXL18 F-box and leucine-rich repeat protein 18 1 1
MIRT698289 TMEM2 transmembrane protein 2 1 1
MIRT705231 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT719772 ZNF236 zinc finger protein 236 1 1
MIRT722077 SMC2 structural maintenance of chromosomes 2 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*