Accession ID: MIRT005869 [miRNA, hsa-miR-144-3p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-144LinkOut: [miRBase ]
Description Homo sapiens miR-144 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-144-3p
Mature Sequence 52| UACAGUAUAGAUGAUGUACU |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-144-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description Notch homolog 1, translocation-associated (Drosophila)
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 TAAACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCC
  81 GACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTAT
 161 GTACTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCT
 241 ATTCTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATAT
 321 AAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGA
 401 AGGGAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCA
 481 AGCCAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCT
 561 CACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTT
 641 AGATGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCAT
 721 GAATCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCC
 801 CCCTGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACA
 881 CGGAGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACA
 961 GTGTCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTC
1041 CCGTGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCC
1121 CGCAGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTT
1201 GGGAGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTT
1281 TGTTTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCC
1361 TTAGCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGG
1441 CCGCGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTG
1521 TAGTTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACT
1601 GATTTGCAATAAAAATGATACTGATGGTGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-144-3p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions AsPC-1 , BxPC3
Disease pancreatic carcinoma
Location of target site 3'UTR
Tools used in this research microRNA.org
Original Description (Extracted from the article) ... Taken together, these data strongly suggest that Notch-1 is a downstream target of miR-144 miRNA and that DCAMKL-1 regulates posttranscriptional control of Notch-1. ...

- Sureban, S. M. May, R. Lightfoot, S. A. et al., 2011, Cancer research.

Article - Sureban, S. M. May, R. Lightfoot, S. A. et al.
- Cancer research, 2011
Pancreatic cancer is an exceptionally aggressive disease in great need of more effective therapeutic options. Epithelial-mesenchymal transition (EMT) plays a key role in cancer invasion and metastasis, and there is a gain of stem cell properties during EMT. Here we report increased expression of the putative pancreatic stem cell marker DCAMKL-1 in an established KRAS transgenic mouse model of pancreatic cancer and in human pancreatic adenocarcinoma. Colocalization of DCAMKL-1 with vimentin, a marker of mesenchymal lineage, along with 14-3-3 sigma was observed within premalignant PanIN lesions that arise in the mouse model. siRNA-mediated knockdown of DCAMKL-1 in human pancreatic cancer cells induced microRNA miR-200a, an EMT inhibitor, along with downregulation of EMT-associated transcription factors ZEB1, ZEB2, Snail, Slug, and Twist. Furthermore, DCAMKL-1 knockdown resulted in downregulation of c-Myc and KRAS through a let-7a microRNA-dependent mechanism, and downregulation of Notch-1 through a miR-144 microRNA-dependent mechanism. These findings illustrate direct regulatory links between DCAMKL-1, microRNAs, and EMT in pancreatic cancer. Moreover, they demonstrate a functional role for DCAMKL-1 in pancreatic cancer. Together, our results rationalize DCAMKL-1 as a therapeutic target for eradicating pancreatic cancers. Cancer Res; 71(6); 2328-38. (c)2011 AACR.
LinkOut: [PMID: 21285251]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-144-3p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions HCT116
Disease colorectal cancer
Location of target site 3'UTR
Tools used in this research microRNA.org
Original Description (Extracted from the article) ... Notch-1 is a downstream target of miR-144 miRNA and that DCAMKL-1 regulates posttranscriptional control of Notch-1 ...

- Sureban, S. M. May, R. Mondalek, F. G. Qu, et al., 2011, Journal of nanobiotechnology.

Article - Sureban, S. M. May, R. Mondalek, F. G. Qu, et al.
- Journal of nanobiotechnology, 2011
ABSTRACT: BACKGROUND: The development of effective drug delivery systems capable of transporting small interfering RNA (siRNA) has been elusive. We have previously reported that colorectal cancer tumor xenograft growth was arrested following treatment with liposomal preparation of siDCAMKL-1. In this report, we have utilized Nanoparticle (NP) technology to deliver DCAMKL-1 specific siRNA to knockdown potential key cancer regulators. In this study, mRNA/miRNA were analyzed using real-time RT-PCR and protein by western blot/immunohistochemistry. siDCAMKL-1 was encapsulated in Poly(lactide-co-glycolide)-based NPs (NP-siDCAMKL-1); Tumor xenografts were generated in nude mice, treated with NP-siDCAMKL-1 and DAPT (gamma-secretase inhibitor) alone and in combination. To measure let-7a and miR-144 expression in vitro, HCT116 cells were transfected with plasmids encoding the firefly luciferase gene with let-7a and miR-144 miRNA binding sites in the 3'UTR. RESULTS: Administration of NP-siDCAMKL-1 into HCT116 xenografts resulted in tumor growth arrest, downregulation of proto-oncogene c-Myc and Notch-1 via let-7a and miR-144 miRNA-dependent mechanisms, respectively. A corresponding reduction in let-7a and miR-144 specific luciferase activity was observed in vitro. Moreover, an upregulation of EMT inhibitor miR-200a and downregulation of the EMT-associated transcription factors ZEB1, ZEB2, Snail and Slug were observed in vivo. Lastly, DAPT-mediated inhibition of Notch-1 resulted in HCT116 tumor growth arrest and down regulation of Notch-1 via a miR-144 dependent mechanism. CONCLUSIONS: These findings demonstrate that nanoparticle-based delivery of siRNAs directed at critical targets such as DCAMKL-1 may provide a novel approach to treat cancer through the regulation of endogenous miRNAs.
LinkOut: [PMID: 21929751]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
9 hsa-miR-144-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003058 PLAG1 pleiomorphic adenoma gene 1 2 1
MIRT005523 FGG fibrinogen gamma chain 2 1
MIRT005529 FGA fibrinogen alpha chain 2 1
MIRT005530 FGB fibrinogen beta chain 2 1
MIRT005869 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 4 2
MIRT006114 TGFB1 transforming growth factor, beta 1 2 1
MIRT006872 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT007190 PTEN phosphatase and tensin homolog 3 1
MIRT007310 NFE2L2 nuclear factor (erythroid-derived 2)-like 2 1 1