Accession ID: MIRT005869 [miRNA, hsa-miR-144-3p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-144LinkOut: [miRBase ]
Description Homo sapiens miR-144 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-144-3p
Mature Sequence 52| UACAGUAUAGAUGAUGUACU |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-144-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_017617    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_017617|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucAUGUAGUAGAUAUGACAu 5'
            ||: |:|| |:|||||| 
Target 5' ttTAT-TTATATGTACTGTt 3'
189 - 207 145.00 -8.40
2
miRNA  3' ucaUGUAG-UAGAUAUGACAu 5'
             |::|: ||:| |||||| 
Target 5' aagATGTTGATTTTTACTGTg 3'
1480 - 1500 129.00 -8.20
3
miRNA  3' ucauguAGUAGAUAUGACau 5'
                |:|||||| |||  
Target 5' aaacttTTATCTATTCTGag 3'
226 - 245 114.00 -9.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-144-3p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions AsPC-1 , BxPC3
Disease pancreatic carcinoma
Location of target site 3'UTR
Tools used in this research microRNA.org
Original Description (Extracted from the article) ... Taken together, these data strongly suggest that Notch-1 is a downstream target of miR-144 miRNA and that DCAMKL-1 regulates posttranscriptional control of Notch-1. ...

- Sureban, S. M. May, R. Lightfoot, S. A. et al., 2011, Cancer research.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ucAUGUAGUAGAUAUGACAu 5'
            ||: |:|| |:|||||| 
Target 5' uuUAU-UUAUAUGUACUGUu 3'
1 - 19
Article - Sureban, S. M. May, R. Lightfoot, S. A. et al.
- Cancer research, 2011
Pancreatic cancer is an exceptionally aggressive disease in great need of more effective therapeutic options. Epithelial-mesenchymal transition (EMT) plays a key role in cancer invasion and metastasis, and there is a gain of stem cell properties during EMT. Here we report increased expression of the putative pancreatic stem cell marker DCAMKL-1 in an established KRAS transgenic mouse model of pancreatic cancer and in human pancreatic adenocarcinoma. Colocalization of DCAMKL-1 with vimentin, a marker of mesenchymal lineage, along with 14-3-3 sigma was observed within premalignant PanIN lesions that arise in the mouse model. siRNA-mediated knockdown of DCAMKL-1 in human pancreatic cancer cells induced microRNA miR-200a, an EMT inhibitor, along with downregulation of EMT-associated transcription factors ZEB1, ZEB2, Snail, Slug, and Twist. Furthermore, DCAMKL-1 knockdown resulted in downregulation of c-Myc and KRAS through a let-7a microRNA-dependent mechanism, and downregulation of Notch-1 through a miR-144 microRNA-dependent mechanism. These findings illustrate direct regulatory links between DCAMKL-1, microRNAs, and EMT in pancreatic cancer. Moreover, they demonstrate a functional role for DCAMKL-1 in pancreatic cancer. Together, our results rationalize DCAMKL-1 as a therapeutic target for eradicating pancreatic cancers. Cancer Res; 71(6); 2328-38. (c)2011 AACR.
LinkOut: [PMID: 21285251]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-144-3p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions HCT116
Disease colorectal cancer
Location of target site 3'UTR
Tools used in this research microRNA.org
Original Description (Extracted from the article) ... Notch-1 is a downstream target of miR-144 miRNA and that DCAMKL-1 regulates posttranscriptional control of Notch-1 ...

- Sureban, S. M. May, R. Mondalek, F. G. Qu, et al., 2011, Journal of nanobiotechnology.

Article - Sureban, S. M. May, R. Mondalek, F. G. Qu, et al.
- Journal of nanobiotechnology, 2011
ABSTRACT: BACKGROUND: The development of effective drug delivery systems capable of transporting small interfering RNA (siRNA) has been elusive. We have previously reported that colorectal cancer tumor xenograft growth was arrested following treatment with liposomal preparation of siDCAMKL-1. In this report, we have utilized Nanoparticle (NP) technology to deliver DCAMKL-1 specific siRNA to knockdown potential key cancer regulators. In this study, mRNA/miRNA were analyzed using real-time RT-PCR and protein by western blot/immunohistochemistry. siDCAMKL-1 was encapsulated in Poly(lactide-co-glycolide)-based NPs (NP-siDCAMKL-1); Tumor xenografts were generated in nude mice, treated with NP-siDCAMKL-1 and DAPT (gamma-secretase inhibitor) alone and in combination. To measure let-7a and miR-144 expression in vitro, HCT116 cells were transfected with plasmids encoding the firefly luciferase gene with let-7a and miR-144 miRNA binding sites in the 3'UTR. RESULTS: Administration of NP-siDCAMKL-1 into HCT116 xenografts resulted in tumor growth arrest, downregulation of proto-oncogene c-Myc and Notch-1 via let-7a and miR-144 miRNA-dependent mechanisms, respectively. A corresponding reduction in let-7a and miR-144 specific luciferase activity was observed in vitro. Moreover, an upregulation of EMT inhibitor miR-200a and downregulation of the EMT-associated transcription factors ZEB1, ZEB2, Snail and Slug were observed in vivo. Lastly, DAPT-mediated inhibition of Notch-1 resulted in HCT116 tumor growth arrest and down regulation of Notch-1 via a miR-144 dependent mechanism. CONCLUSIONS: These findings demonstrate that nanoparticle-based delivery of siRNAs directed at critical targets such as DCAMKL-1 may provide a novel approach to treat cancer through the regulation of endogenous miRNAs.
LinkOut: [PMID: 21929751]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
187 hsa-miR-144-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003058 PLAG1 pleiomorphic adenoma gene 1 2 1
MIRT005523 FGG fibrinogen gamma chain 2 1
MIRT005529 FGA fibrinogen alpha chain 2 1
MIRT005530 FGB fibrinogen beta chain 2 1
MIRT005869 NOTCH1 notch 1 4 2
MIRT006114 TGFB1 transforming growth factor, beta 1 2 1
MIRT006872 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT007190 PTEN phosphatase and tensin homolog 3 1
MIRT007310 NFE2L2 nuclear factor (erythroid-derived 2)-like 2 1 1
MIRT053494 ZFX zinc finger protein, X-linked 5 3
MIRT054058 CFTR cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) 2 1
MIRT054851 TTN titin 3 1
MIRT057677 LCOR ligand dependent nuclear receptor corepressor 1 4
MIRT065418 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 2
MIRT066720 CCT2 chaperonin containing TCP1, subunit 2 (beta) 1 3
MIRT066784 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT067387 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 2
MIRT068846 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT069645 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 1 1
MIRT069657 PABPN1 poly(A) binding protein, nuclear 1 1 1
MIRT071717 CCNK cyclin K 1 1
MIRT073564 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 2
MIRT080720 ZCCHC2 zinc finger, CCHC domain containing 2 1 2
MIRT090617 PLS1 plastin 1 1 1
MIRT097062 TNPO1 transportin 1 1 2
MIRT102618 UBN2 ubinuclein 2 1 2
MIRT118769 FAM217B family with sequence similarity 217, member B 1 3
MIRT147282 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 5
MIRT159513 DYNC2LI1 dynein, cytoplasmic 2, light intermediate chain 1 1 1
MIRT196438 TAOK1 TAO kinase 1 1 1
MIRT211238 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT220422 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT223668 FZD6 frizzled family receptor 6 1 3
MIRT223805 OXR1 oxidation resistance 1 1 1
MIRT238585 NLN neurolysin (metallopeptidase M3 family) 1 1
MIRT238652 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT247188 BTG2 BTG family, member 2 1 3
MIRT249185 AKIRIN1 akirin 1 1 4
MIRT252653 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 2
MIRT305624 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT315671 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 3
MIRT366555 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT403294 ZNF207 zinc finger protein 207 1 1
MIRT405966 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT437437 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 1
MIRT438343 MET met proto-oncogene (hepatocyte growth factor receptor) 5 1
MIRT444395 ZNF480 zinc finger protein 480 1 1
MIRT445255 SEMA5A sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A 1 1
MIRT445309 MLANA melan-A 1 1
MIRT449020 ANKRD12 ankyrin repeat domain 12 1 1
MIRT452136 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 1 1
MIRT459438 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT460471 MMS22L MMS22-like, DNA repair protein 1 1
MIRT461294 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 1
MIRT462948 ZNF800 zinc finger protein 800 1 6
MIRT463489 ZC3H11A zinc finger CCCH-type containing 11A 1 6
MIRT463846 WRN Werner syndrome, RecQ helicase-like 1 1
MIRT466183 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466882 STX16 syntaxin 16 1 1
MIRT468156 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT468259 SFXN4 sideroflexin 4 1 1
MIRT469660 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 1 5
MIRT470040 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT470552 COASY CoA synthase 1 1
MIRT472208 NGFRAP1 nerve growth factor receptor (TNFRSF16) associated protein 1 1 2
MIRT472555 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 2
MIRT473462 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT473925 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 2
MIRT474068 LMNB2 lamin B2 1 1
MIRT475079 ITSN2 intersectin 2 1 2
MIRT475286 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT475570 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT477516 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT478464 DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) 1 1
MIRT478920 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 1
MIRT479338 CERK ceramide kinase 1 1
MIRT480578 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT480915 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT481532 ARL5B ADP-ribosylation factor-like 5B 1 4
MIRT481681 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT481724 APPBP2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 1 3
MIRT481938 ANKRD11 ankyrin repeat domain 11 1 6
MIRT487099 C2orf44 chromosome 2 open reading frame 44 1 1
MIRT489294 RBM8A RNA binding motif protein 8A 1 4
MIRT492255 SLC35F5 solute carrier family 35, member F5 1 1
MIRT493268 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT494770 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 1
MIRT496257 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT497713 ZNF645 zinc finger protein 645 1 1
MIRT498027 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT499292 TSPYL1 TSPY-like 1 1 1
MIRT500105 SLC46A3 solute carrier family 46, member 3 1 1
MIRT501020 SPATA2 spermatogenesis associated 2 1 3
MIRT501816 NEURL1B neuralized homolog 1B (Drosophila) 1 1
MIRT502296 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 3
MIRT502493 FAM122B family with sequence similarity 122B 1 4
MIRT503948 MFSD6 major facilitator superfamily domain containing 6 1 3
MIRT504266 C1orf147 chromosome 1 open reading frame 147 1 2
MIRT504370 ARID1B AT rich interactive domain 1B (SWI1-like) 1 3
MIRT505125 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 2
MIRT506052 PPP6C protein phosphatase 6, catalytic subunit 1 2
MIRT506481 MYO5A myosin VA (heavy chain 12, myoxin) 1 3
MIRT506967 HOXA10 homeobox A10 1 3
MIRT507728 CLIC4 chloride intracellular channel 4 1 2
MIRT513081 IL20RB interleukin 20 receptor beta 1 3
MIRT513570 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT513631 UBE2A ubiquitin-conjugating enzyme E2A 1 2
MIRT513692 RNF111 ring finger protein 111 1 1
MIRT513764 PEX5L peroxisomal biogenesis factor 5-like 1 2
MIRT520786 TBX18 T-box 18 1 2
MIRT523402 GRIK3 glutamate receptor, ionotropic, kainate 3 1 2
MIRT525719 DCAF12L2 DDB1 and CUL4 associated factor 12-like 2 1 1
MIRT527750 NANOGNB NANOG neighbor homeobox 1 1
MIRT532823 ZNF827 zinc finger protein 827 1 1
MIRT534603 RORA RAR-related orphan receptor A 1 1
MIRT535762 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 1 1
MIRT536346 LEFTY1 left-right determination factor 1 1 1
MIRT543081 APP amyloid beta (A4) precursor protein 1 1
MIRT544064 KIAA1462 KIAA1462 1 1
MIRT545424 SLC39A6 solute carrier family 39 (zinc transporter), member 6 1 1
MIRT546238 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 1 2
MIRT546324 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547361 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT547539 MAML3 mastermind-like 3 (Drosophila) 1 1
MIRT548062 GOLGA7 golgin A7 1 1
MIRT549248 ATXN1L ataxin 1-like 1 2
MIRT549250 ATXN1 ataxin 1 1 1
MIRT549467 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT549937 RPL7L1 ribosomal protein L7-like 1 1 2
MIRT551489 TMEM192 transmembrane protein 192 1 2
MIRT552564 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 2
MIRT553688 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 1 2
MIRT553951 STAMBP STAM binding protein 1 1
MIRT554163 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 2
MIRT554477 SAMD12 sterile alpha motif domain containing 12 1 1
MIRT554918 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT555003 RAB39B RAB39B, member RAS oncogene family 1 1
MIRT555109 PURB purine-rich element binding protein B 1 1
MIRT555445 NT5C3A 5'-nucleotidase, cytosolic III 1 1
MIRT555535 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT556092 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT556571 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT556936 INO80D INO80 complex subunit D 1 2
MIRT558176 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT558368 DIDO1 death inducer-obliterator 1 1 2
MIRT558464 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 1 1
MIRT559236 BICD2 bicaudal D homolog 2 (Drosophila) 1 2
MIRT560099 ERCC8 excision repair cross-complementing rodent repair deficiency, complementation group 8 1 1
MIRT560725 ZNF749 zinc finger protein 749 1 1
MIRT561142 SPAG1 sperm associated antigen 1 1 1
MIRT561721 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT562484 CHORDC1 cysteine and histidine-rich domain (CHORD) containing 1 1 1
MIRT562681 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT564997 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT565068 USP25 ubiquitin specific peptidase 25 1 1
MIRT565184 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT565946 RREB1 ras responsive element binding protein 1 1 1
MIRT566315 POU2F1 POU class 2 homeobox 1 1 1
MIRT566435 PHF3 PHD finger protein 3 1 1
MIRT566485 PCCB propionyl CoA carboxylase, beta polypeptide 1 1
MIRT566612 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT566761 MOB4 MOB family member 4, phocein 1 1
MIRT566867 LRRC1 leucine rich repeat containing 1 1 1
MIRT567232 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 1
MIRT567245 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT567292 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT568426 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT570705 FAM69A family with sequence similarity 69, member A 1 1
MIRT570931 ZNF284 zinc finger protein 284 1 1
MIRT571631 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT571647 SIX4 SIX homeobox 4 1 1
MIRT574274 ZNF350 zinc finger protein 350 1 1
MIRT574304 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT574614 LZIC leucine zipper and CTNNBIP1 domain containing 1 1
MIRT574843 CADM1 cell adhesion molecule 1 1 1
MIRT608128 TSC22D2 TSC22 domain family, member 2 1 1
MIRT648849 WNT7A wingless-type MMTV integration site family, member 7A 1 1
MIRT687559 MLEC malectin 1 1
MIRT696548 HIST1H3B histone cluster 1, H3b 1 1
MIRT697517 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT701146 PANK1 pantothenate kinase 1 1 1
MIRT704284 DENND5B DENN/MADD domain containing 5B 1 1
MIRT704541 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 1
MIRT707687 GPR50 G protein-coupled receptor 50 1 1
MIRT707810 TSPAN6 tetraspanin 6 1 1
MIRT710019 KCNQ5 potassium voltage-gated channel, KQT-like subfamily, member 5 1 1
MIRT712705 TEX9 testis expressed 9 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*