Accession ID: MIRT005885 [miRNA, hsa-miR-155-5p :: SKI, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-155LinkOut: [miRBase ]
Description Homo sapiens miR-155 stem-loop
Comment Human mir-155 is predicted based on homology to a cloned miR from mouse (MIR:MI0000177) .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-155-5p
Mature Sequence 4| UUAAUGCUAAUCGUGAUAGGGGU |26
Evidence Experimental
Experiments Cloned
Putative hsa-miR-155-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SKI LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms SKV
Description v-ski sarcoma viral oncogene homolog (avian)
Transcript NM_0030    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SKI LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SKI
(miRNA target sites are highlighted)
>SKI|NM_0030|3'UTR
   1 CGGGCCCGCCCCGAGGCTGCGGGCAGCGAGGGCGCTGCGGAGCTGGAGCCGTAGATTCCGTGCCTGCCGCCGCAGCGCCG
  81 CCGACAACGCGGGTGCAGGGGGGCGCGGCTGGGCGGTGCAGCTCCGCCCGGCTCCGCCCCTGCAGCCCACACAGCACAAC
 161 GTCTTACCGTGCCTATTACCAAGCGAGTGTTTGTAACCATGTAGTTTTGGAACCCACTGCAAAATTTTCTACTGGCCAAG
 241 TTCAAGTGAGTAAGCCGCGTCCCCCAACTACAGCTGGAGACGGGGCCAGCTCGGCGGCCTGCTGGTCCTCTGCTTGCTGG
 321 AACATTCTAACATTTACACTTTTGTTATAAGCTATTTAAAACCAGTAAGGAGACTTGAAATTCAGAAAATCAACACATTT
 401 TTAAATGACTAACTTCTAAAAGCCCCAACACATGACGCCATCTGAAGACCCGCAACGGAGTGGGGGTGGCGGCCGCCCCA
 481 CCCTCCCCACCCGGGGAAGCCATCACAGCTCATCTGCCCGCGGCTGCGTGAGGACAGCAGGGGTTTTTCTTCAGAGTCTA
 561 TTTTTTCAGCGACAAGGACCCAGGTCTTCCTGCTGCTGCCAGGGAGAGCAGGGACAGTGCCGCGTGCGAGATGAGCTCGA
 641 ACACTGCCCGCCTTACTGCCGCCTACCCCGCCCGCCACGCCGCCGTCGATGCCAGCGCTGTCCCCACGGGTACCAGGAAG
 721 TGCAGAGCCGCACAGGAGCTGCCCCGGAGCTGAGGGGACGGTCTTCGGCTCCTCTGCACCCCGTGATTCTGCCCACGCTC
 801 CTCCACCACGAGGCACTGACCTGCGTCGGGTGGTGACCGTGGCTGGCGGTCACGCCCTCAGCCCCTCCGGGCACACGTGC
 881 CGCCTGACCGGGCGACCCTTTTCAGTTCGGCAAACGTCGCTCCCTTCATTTTGGGACTGAGGCTGCAGCATTGGAACAAA
 961 AGAGCATTATTTCAATTTTTCTTTCTTTTTTTTTGTTCGTTCATTTAAACGTATATTTAGAACTGCACTTTGTCCACAAC
1041 CTTCCCTTCTCTTTCTATTCCCCAGTGAACTGAGGTTTTTACCGATTTATAGAGCAGTCAAATCCGAAGTGCTCGAGTGC
1121 TTAGAAACCCCCTCTGGTGCTTGGTTGAACAAGGGAATCACAAGAAAACGAAAATGCAAAAACTGAACTTCGGGGGTCGT
1201 TCTGTGCCTTCCAGCATCTTGTACAGCAAATCCTGACTCGTGTCTTTTTACCCCCAAGATATCTGTCTTCAGTAGCGACT
1281 GAATCTGCCACTCTCAGAATAAGTTCCTTGCATTTATTCCAAATAATCTCGTTTACTCTCACCTGTTTATGCAAATTGTA
1361 TAAGGTTTCTTATGCCCAAGCTTGAAAAATGATTTCCCAGTAGACAAGAGGCGGCTACCTATCCTACAGTTACGGTATTT
1441 ATTTACATAAGAAGATCTTACAGGAGTTCTTTGCTTGAATCCGTTCTAACACCCGCGGCAGCTGCACGCGCTCACAGAAG
1521 GTGGAGGTTACTTGCCCAGGTACAGACGACCTCGGGGCAGTGACGAGCAAAGACCAGAGACTGCTGAGCCCTCGCATCTG
1601 GGTGGCGGAATTGCCTGCGGGGTTTTGCCCTTGGTTTACTGAGGGGGGTCTTGGTTGCTGCTGAAGCCCCCCACCCCTTC
1681 TAAAGTGCAATGCAAAAGGGACATCATGTATATGCAGCGTTTGTTTGGAATTTTCTTTGCTTTTGTTTTCTTTGCGGTTG
1761 TTCTGTGTGCATGGATTCCACACCTCTGCCGTAGGTAGATCCGTCAGCGGGCATTATTACCGTGTCTTGTAAAGGGTCGG
1841 TTTTGTTATGCAACATGCAGAATGCTGTTTTTAGCCTTGTTTTACCAGAGTTGTTTTTTTTTTCAGTTATTTCTTCAAGG
1921 GAAACTAAATGATTTAGTTGGAGCAAAGCTTTAAGTGTGTTGGCGTGCTTCTGTGTGGCTGTCCTGTGTCGCCAGGTCGA
2001 AGATCACAGTGAGGTAGAGGCCCTGCCCCATCCCCAGGGCCGCCAGGCTTGCTCCGTTTGCTTTGAGTTTTTAGACCCCA
2081 GAGGGAGATGAGCTTTTCCAAGCTGTGTCTGGGCCAGAGCCTCTCCTTGCCCTTGCTCCATCCCGACGGTCACCGTTGGG
2161 TCCACGCCTCCACCGCCCCATCTTGCCCCAAACGGAAAGCGCTGTATCTGCAGTGGCAGCCCTTCCCCACTTCGGCTCTG
2241 GGAGGGTCCAGCCAGTGTCACCTGGGCCCACCCTTTCCTGCAGCTGCCAGGCCCGTGCGGTCAGTGGGACCCGGACGTGG
2321 GCAGGCGAGCTCGGGACCCTCCCAGGCAGTTCCCACAGCTCTTGCCTCGGCTCACCAGGGTCACTTCCACTGTCAGGGGC
2401 CTGAGGGGGCAGCTGTGGCTGCAGGGCTGCTCTGGACTGAGGGGTCCCAGGCCCCGAGGGGTGCACGCCTGGCTCCCCTT
2481 GGCACAGGTGCGAGTCCGTTTCTTTTCAGCAGAAGGGGGAAGAGGTGTCCGCTGTGTGGGCTGCTGACTCCTCTGTGTGT
2561 GAGGCCCTTCATCTAAGTGATTGTGTATTCAGTTTAATTCTCATTATATTTCTATACTGAAAGAAGATTTTTAACGAAGG
2641 GAAAAACAACAGCAATAACATTCATATCTCTGGAGCAGCTAACTCATACACGTAATGTCTGCTTTTCGTACAGAACTAGC
2721 CAATGTAAAAACAGTTCACCTGTAAATACTTTTTCCTTTTTCACCGTTGTATTATACATGTATATGCTGGGTCCTTTTTC
2801 AGAAACTCTTTTCTTACCTGAGAGTTGTCTTGTTTTCTGGGCTGTTTTTAACTGAGGAAAAAAAAAATGCTTTCCTGCCG
2881 GGGGGCAGGGGAGACGGAGAAACCCATGTGCGTTTCCCATGTGACCCCCTCCTCCCTGTGGGTCTGAGCCCCGGCCCCCC
2961 CCACCTCCTCCTCCCTGTGGGTCCGAACCCCGGCCCCCCCACCCCCTCCTCCCTGTGGGTCCGAACCCCGGCCCCCCCAC
3041 CCCCTCCTCCCTGTGGGTCCGATCCCCGGCCCCCCCCACCCCCTCCTCCCTGTGGGTCCGAACCCCGGCCCCCCCCCCAC
3121 CCCCTCCTCCCTGTGGGTCCGAACCCCGGCCCCCCCACCCCTCCCTCAGCCCACCAGGGTCCAGGGAGATGTTCGTTCTC
3201 GCTTTAAGTCAGGAGTCACAAATGACTTTTTTTTTTCAATTAAGGAAAAAGCTCCATCTCTACCTTTAACATCACCCAGA
3281 CCCCCGCCCCTGCCCGTGCCCCACGCTGCTGCTAACGACAGTATGATGCTTACTCTGCTACTCGGAAACTATTTTTATGT
3361 AATTAATGTATGCTTTCTTGTTTATAAATGCCTGATTTAAAAAGAAAAGAGCTTGGCATATTTATCTATTTCGCTGTGTA
3441 CCTGTTAGTCCTTCCCCGACCCCGAAACAGATGACATTGTACAATAAAGGACTTTGAGAGGA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-155-5p :: SKI    [ Functional MTI ]
Validation Method Immunohistochemistry , Luciferase reporter assay , Northern blot , qRT-PCR , Western blot
Conditions HEK 293-T , U2932
Disease diffuse large B-cell lymphoma
Location of target site 3'UTR
Tools used in this research miRBase Target Database , miRNAviewer , miRTar , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-155 targets SKI ...

- Imig, J. Motsch, N. Zhu, J. Y. Barth, S. et al., 2011, Nucleic acids research.

Article - Imig, J. Motsch, N. Zhu, J. Y. Barth, S. et al.
- Nucleic acids research, 2011
The Epstein-Barr virus (EBV) is an oncogenic human Herpes virus found in approximately 15% of diffuse large B-cell lymphoma (DLBCL). EBV encodes miRNAs and induces changes in the cellular miRNA profile of infected cells. MiRNAs are small, non-coding RNAs of approximately 19-26 nt which suppress protein synthesis by inducing translational arrest or mRNA degradation. Here, we report a comprehensive miRNA-profiling study and show that hsa-miR-424, -223, -199a-3p, -199a-5p, -27b, -378, -26b, -23a, -23b were upregulated and hsa-miR-155, -20b, -221, -151-3p, -222, -29b/c, -106a were downregulated more than 2-fold due to EBV-infection of DLBCL. All known EBV miRNAs with the exception of the BHRF1 cluster as well as EBV-miR-BART15 and -20 were present. A computational analysis indicated potential targets such as c-MYB, LATS2, c-SKI and SIAH1. We show that c-MYB is targeted by miR-155 and miR-424, that the tumor suppressor SIAH1 is targeted by miR-424, and that c-SKI is potentially regulated by miR-155. Downregulation of SIAH1 protein in DLBCL was demonstrated by immunohistochemistry. The inhibition of SIAH1 is in line with the notion that EBV impedes various pro-apoptotic pathways during tumorigenesis. The down-modulation of the oncogenic c-MYB protein, although counter-intuitive, might be explained by its tight regulation in developmental processes.
LinkOut: [PMID: 21062812]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-155-5p :: SKI    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions SK-MEL-28 , WM-266-4 , GL-Mel , 397-Mel , CH-Mel , DR-Mel , SN-Mel
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-155 interacts with the 3¢UTR of SKI mRNA ...

- Levati, L. Pagani, E. Romani, S. Castiglia, et al., 2011, Pigment cell & melanoma research.

Article - Levati, L. Pagani, E. Romani, S. Castiglia, et al.
- Pigment cell & melanoma research, 2011
The SKI protein is a transcriptional co-regulator over-expressed in melanoma. Experimentally induced down-regulation of SKI inhibits melanoma cell growth in vitro and in vivo. Micro-RNAs (miRNAs) negatively modulate gene expression, and have been implicated in oncogenesis. We previously showed that microRNA-155 (miR-155) is down-regulated in melanoma cells as compared with normal melanocytes, and that its ectopic expression impairs proliferation and induces apoptosis. Here, we investigated whether miR-155 could mediate melanoma growth inhibition via SKI gene silencing. Luciferase reporter assays demonstrated that miR-155 interacted with SKI 3'UTR and impaired gene expression. Transfection of melanoma cells with miR-155 reduced SKI levels, while inhibition of endogenous miR-155 up-regulated SKI expression. Specifically designed small interfering RNAs reduced SKI expression and inhibited proliferation. However, melanoma cells over-expressing a 3'UTR-deleted SKI were still susceptible to the antiproliferative effect of miR-155. Our data demonstrate for the first time that SKI is a target of miR-155 in melanoma. However, impairment of SKI expression is not the leading mechanism involved in the growth-suppressive effect of miR-155 found in this malignancy.
LinkOut: [PMID: 21466664]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
763 hsa-miR-155-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000287 MEIS1 Meis homeobox 1 4 2
MIRT000289 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 5 6
MIRT000442 MECP2 methyl CpG binding protein 2 (Rett syndrome) 5 2
MIRT000456 SOCS1 suppressor of cytokine signaling 1 4 6
MIRT000459 MSH6 mutS homolog 6 (E. coli) 3 1
MIRT000460 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 3 1
MIRT000461 MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 3 1
MIRT000631 INPP5D inositol polyphosphate-5-phosphatase, 145kDa 4 6
MIRT000972 DET1 de-etiolated homolog 1 (Arabidopsis) 2 2
MIRT000973 SMAD5 SMAD family member 5 4 4
MIRT000974 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 4 3
MIRT000975 ZNF652 zinc finger protein 652 2 2
MIRT000976 ZIC3 Zic family member 3 (odd-paired homolog, Drosophila) 2 4
MIRT001043 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 5 6
MIRT001044 Arntl protein-coding 3 2
MIRT001045 Sla src-like adaptor 2 1
MIRT001046 Hif1a hypoxia inducible factor 1, alpha subunit 3 1
MIRT001047 Csf1r colony stimulating factor 1 receptor 3 3
MIRT001048 Jarid2 jumonji, AT rich interactive domain 2 2 1
MIRT001049 Cebpb CCAAT/enhancer binding protein (C/EBP), beta 4 1
MIRT001050 Picalm phosphatidylinositol binding clathrin assembly protein 4 1
MIRT001075 JARID2 jumonji, AT rich interactive domain 2 3 3
MIRT001207 APC adenomatous polyposis coli 3 2
MIRT001486 WDFY1 WD repeat and FYVE domain containing 1 2 1
MIRT001487 VAMP3 vesicle-associated membrane protein 3 (cellubrevin) 2 1
MIRT001488 UBE2J1 ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) 2 1
MIRT001489 TXNRD1 thioredoxin reductase 1 2 1
MIRT001490 TXNDC12 thioredoxin domain containing 12 (endoplasmic reticulum) 2 1
MIRT001491 TRIP13 thyroid hormone receptor interactor 13 3 2
MIRT001492 TRIM32 tripartite motif-containing 32 2 1
MIRT001493 TRAM1 translocation associated membrane protein 1 2 1
MIRT001494 TNFRSF10A tumor necrosis factor receptor superfamily, member 10a 2 1
MIRT001495 TBCA tubulin folding cofactor A 3 2
MIRT001496 TACSTD2 tumor-associated calcium signal transducer 2 2 1
MIRT001497 SYPL1 synaptophysin-like 1 2 1
MIRT001498 SYNE2 spectrin repeat containing, nuclear envelope 2 2 1
MIRT001499 SNAP29 synaptosomal-associated protein, 29kDa 2 1
MIRT001500 SMAD1 SMAD family member 1 5 2
MIRT001501 SLC30A1 solute carrier family 30 (zinc transporter), member 1 2 1
MIRT001502 SH3BP4 SH3-domain binding protein 4 2 1
MIRT001503 SDCBP syndecan binding protein (syntenin) 3 2
MIRT001504 SCAMP1 secretory carrier membrane protein 1 2 1
MIRT001505 RHEB Ras homolog enriched in brain 3 2
MIRT001506 RCOR1 REST corepressor 1 2 1
MIRT001507 RCN2 reticulocalbin 2, EF-hand calcium binding domain 2 1
MIRT001508 RAI14 retinoic acid induced 14 2 1
MIRT001509 RAB6A RAB6A, member RAS oncogene family 2 1
MIRT001510 RAB5C RAB5C, member RAS oncogene family 2 1
MIRT001511 RAB34 RAB34, member RAS oncogene family 2 1
MIRT001512 RAB27B RAB27B, member RAS oncogene family 2 1
MIRT001513 RAB23 RAB23, member RAS oncogene family 2 1
MIRT001514 PTPRJ protein tyrosine phosphatase, receptor type, J 2 1
MIRT001515 PRKCI protein kinase C, iota 2 1
MIRT001516 PRAF2 PRA1 domain family, member 2 1 1
MIRT001518 PPP5C protein phosphatase 5, catalytic subunit 2 2
MIRT001519 PPL periplakin 2 1
MIRT001520 POLE4 polymerase (DNA-directed), epsilon 4 (p12 subunit) 2 1
MIRT001521 POLE3 polymerase (DNA directed), epsilon 3 (p17 subunit) 3 2
MIRT001522 PODXL podocalyxin-like 2 1
MIRT001523 PLXND1 plexin D1 2 1
MIRT001524 PKN2 protein kinase N2 3 2
MIRT001525 PICALM phosphatidylinositol binding clathrin assembly protein 3 2
MIRT001526 PHC2 polyhomeotic homolog 2 (Drosophila) 3 2
MIRT001527 PDLIM5 PDZ and LIM domain 5 2 2
MIRT001528 PDE3A phosphodiesterase 3A, cGMP-inhibited 2 1
MIRT001529 NT5E 5'-nucleotidase, ecto (CD73) 2 1
MIRT001530 NARS asparaginyl-tRNA synthetase 3 2
MIRT001531 MYO1E myosin IE 2 1
MIRT001532 MYO10 myosin X 5 2
MIRT001533 MSI2 musashi homolog 2 (Drosophila) 2 2
MIRT001534 MPZL1 myelin protein zero-like 1 2 1
MIRT001535 MOSPD2 motile sperm domain containing 2 2 1
MIRT001536 MARC1 MOCO sulphurase C-terminal domain containing 1 2 1
MIRT001538 METTL7A methyltransferase like 7A 2 1
MIRT001539 MET met proto-oncogene (hepatocyte growth factor receptor) 1 1
MIRT001541 LY6K lymphocyte antigen 6 complex, locus K 2 1
MIRT001542 LPL lipoprotein lipase 2 1
MIRT001543 UFL1 KIAA0776 2 1
MIRT001544 HSDL1 hydroxysteroid dehydrogenase like 1 2 1
MIRT001545 HSD17B12 hydroxysteroid (17-beta) dehydrogenase 12 2 1
MIRT001546 GNA13 guanine nucleotide binding protein (G protein), alpha 13 2 1
MIRT001547 FMNL2 formin-like 2 2 1
MIRT001549 FADS1 fatty acid desaturase 1 2 1
MIRT001550 DSG2 desmoglein 2 2 1
MIRT001551 DPP7 dipeptidyl-peptidase 7 2 1
MIRT001552 DNAJC19 DnaJ (Hsp40) homolog, subfamily C, member 19 2 2
MIRT001553 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 2 1
MIRT001554 DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 3 2
MIRT001555 CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 2 1
MIRT001556 CUL4B cullin 4B 2 1
MIRT001557 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 2 1
MIRT001558 CLDN1 claudin 1 2 1
MIRT001559 CHAF1A chromatin assembly factor 1, subunit A (p150) 2 1
MIRT001560 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 6 8
MIRT001561 CDK5RAP3 CDK5 regulatory subunit associated protein 3 2 2
MIRT001562 CBFB core-binding factor, beta subunit 2 1
MIRT001563 BRPF3 bromodomain and PHD finger containing, 3 3 4
MIRT001564 BET1 blocked early in transport 1 homolog (S. cerevisiae) 2 1
MIRT001565 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 2 1
MIRT001566 ATG3 ATG3 autophagy related 3 homolog (S. cerevisiae) 2 1
MIRT001567 ARL5B ADP-ribosylation factor-like 5B 2 1
MIRT001568 ARL10 ADP-ribosylation factor-like 10 2 1
MIRT001569 ARID2 AT rich interactive domain 2 (ARID, RFX-like) 3 3
MIRT001570 ARFIP2 ADP-ribosylation factor interacting protein 2 2 1
MIRT001571 ARFIP1 ADP-ribosylation factor interacting protein 1 3 2
MIRT001572 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 1
MIRT001573 AMIGO2 adhesion molecule with Ig-like domain 2 2 1
MIRT001803 TM6SF1 transmembrane 6 superfamily member 1 2 1
MIRT001804 MATR3 matrin 3 2 1
MIRT001805 LDOC1 leucine zipper, down-regulated in cancer 1 2 1
MIRT001806 PHF17 PHD finger protein 17 2 1
MIRT001961 RHOA ras homolog gene family, member A 4 1
MIRT002006 AGTR1 angiotensin II receptor, type 1 4 7
MIRT003007 TP53INP1 tumor protein p53 inducible nuclear protein 1 5 3
MIRT003482 FGF7 fibroblast growth factor 7 (keratinocyte growth factor) 2 4
MIRT003484 IKBKE inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon 4 4
MIRT004056 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 2 1
MIRT004087 CUX1 cut-like homeobox 1 3 2
MIRT004088 BCAT1 branched chain amino-acid transaminase 1, cytosolic 2 1
MIRT004282 SPI1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 2 3
MIRT004286 Inpp5d inositol polyphosphate-5-phosphatase D 3 1
MIRT004323 Cux1 cut-like homeobox 1 3 1
MIRT004324 Sfpi1 SFFV proviral integration 1 3 1
MIRT004436 CTLA4 cytotoxic T-lymphocyte-associated protein 4 2 1
MIRT004455 EDN1 endothelin 1 2 1
MIRT004495 FOXO3 forkhead box O3 5 4
MIRT004507 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 2 1
MIRT004604 TSHZ3 teashirt zinc finger homeobox 3 2 2
MIRT004707 RUNX2 runt-related transcription factor 2 4 1
MIRT005032 IFNGR1 interferon gamma receptor 1 2 1
MIRT005091 ZNF236 zinc finger protein 236 2 1
MIRT005092 LAT2 linker for activation of T cells family, member 2 2 1
MIRT005093 PAPOLA poly(A) polymerase alpha 2 1
MIRT005094 EHD1 EH-domain containing 1 2 1
MIRT005095 SERTAD2 SERTA domain containing 2 2 1
MIRT005096 PELI1 pellino homolog 1 (Drosophila) 2 2
MIRT005097 KBTBD2 kelch repeat and BTB (POZ) domain containing 2 3 2
MIRT005098 HNRNPA3P1 heterogeneous nuclear ribonucleoprotein A3 pseudogene 1 2 1
MIRT005099 SLC39A10 solute carrier family 39 (zinc transporter), member 10 2 1
MIRT005100 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 4 3
MIRT005101 CAMTA1 calmodulin binding transcription activator 1 2 2
MIRT005102 NAMPT nicotinamide phosphoribosyltransferase 2 1
MIRT005103 CREBRF chromosome 5 open reading frame 41 2 1
MIRT005104 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 5 4
MIRT005105 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 3 2
MIRT005244 FAR1 fatty acyl CoA reductase 1 2 1
MIRT005245 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 2 1
MIRT005246 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 2 2
MIRT005247 C3orf58 chromosome 3 open reading frame 58 2 1
MIRT005248 SLC25A40 solute carrier family 25, member 40 2 1
MIRT005249 PSMG1 proteasome (prosome, macropain) assembly chaperone 1 2 1
MIRT005251 IKBIP IKBKB interacting protein 2 2
MIRT005252 LCLAT1 lysocardiolipin acyltransferase 1 2 1
MIRT005253 VEZF1 vascular endothelial zinc finger 1 2 1
MIRT005254 SACM1L SAC1 suppressor of actin mutations 1-like (yeast) 2 1
MIRT005255 DCAF7 DDB1 and CUL4 associated factor 7 2 1
MIRT005256 ERMP1 endoplasmic reticulum metallopeptidase 1 2 1
MIRT005257 KRT80 keratin 80 2 1
MIRT005349 FLI1 Friend leukemia virus integration 1 2 2
MIRT005411 DOCK4 dedicator of cytokinesis 4 2 1
MIRT005484 CYR61 cysteine-rich, angiogenic inducer, 61 4 2
MIRT005709 ICAM1 intercellular adhesion molecule 1 2 2
MIRT005713 SELE selectin E 1 1
MIRT005872 SMAD2 SMAD family member 2 4 3
MIRT005884 MYB v-myb myeloblastosis viral oncogene homolog (avian) 3 2
MIRT005885 SKI v-ski sarcoma viral oncogene homolog (avian) 3 2
MIRT006008 LOC150786 RAB6C-like 1 1
MIRT006102 RNF123 ring finger protein 123 3 1
MIRT006103 CSF1R colony stimulating factor 1 receptor 4 2
MIRT006113 SOX6 SRY (sex determining region Y)-box 6 3 1
MIRT006116 CKAP5 cytoskeleton associated protein 5 4 2
MIRT006208 JUN jun oncogene 3 1
MIRT006214 PKIA protein kinase (cAMP-dependent, catalytic) inhibitor alpha 3 1
MIRT006267 CSNK1A1 casein kinase 1, alpha 1 2 3
MIRT006285 GCSAM germinal center expressed transcript 2 2 1
MIRT006439 KDM3A lysine (K)-specific demethylase 3A 4 1
MIRT006517 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 2 1
MIRT006687 IL13RA1 interleukin 13 receptor, alpha 1 1 1
MIRT006848 FADD Fas (TNFRSF6)-associated via death domain 5 2
MIRT006927 BCL6 B-cell CLL/lymphoma 6 1 1
MIRT006969 MITF microphthalmia-associated transcription factor 1 1
MIRT007103 MAP3K10 mitogen-activated protein kinase kinase kinase 10 2 3
MIRT007181 NOS3 nitric oxide synthase 3 (endothelial cell) 3 1
MIRT020486 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT020487 C9orf142 chromosome 9 open reading frame 142 1 1
MIRT020488 MECR mitochondrial trans-2-enoyl-CoA reductase 1 1
MIRT020489 LUC7L2 LUC7-like 2 (S. cerevisiae) 1 1
MIRT020490 TCEA1 transcription elongation factor A (SII), 1 1 1
MIRT020491 ZC2HC1C family with sequence similarity 164, member C 1 1
MIRT020492 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT020493 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT020494 SLC27A2 solute carrier family 27 (fatty acid transporter), member 2 1 1
MIRT020495 XPC xeroderma pigmentosum, complementation group C 1 1
MIRT020496 EIF3G eukaryotic translation initiation factor 3, subunit G 1 1
MIRT020497 EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa 1 1
MIRT020498 UBA3 ubiquitin-like modifier activating enzyme 3 1 1
MIRT020499 EIF3E eukaryotic translation initiation factor 3, subunit E 1 1
MIRT020500 PCYOX1 prenylcysteine oxidase 1 1 1
MIRT020501 EXOC7 exocyst complex component 7 1 1
MIRT020502 QPCTL glutaminyl-peptide cyclotransferase-like 1 1
MIRT020503 DYNC2H1 dynein, cytoplasmic 2, heavy chain 1 1 1
MIRT020504 GLIPR2 GLI pathogenesis-related 2 1 1
MIRT020505 HEATR2 HEAT repeat containing 2 1 1
MIRT020506 UGT8 UDP glycosyltransferase 8 1 1
MIRT020507 HSPB11 heat shock protein family B (small), member 11 1 1
MIRT020508 CCDC137 coiled-coil domain containing 137 1 1
MIRT020509 GLB1 galactosidase, beta 1 1 1
MIRT020510 LRRC40 leucine rich repeat containing 40 1 1
MIRT020511 VBP1 von Hippel-Lindau binding protein 1 1 1
MIRT020512 MGST2 microsomal glutathione S-transferase 2 1 1
MIRT020513 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 1 1
MIRT020514 JUP junction plakoglobin 1 1
MIRT020515 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT020516 GOLPH3 golgi phosphoprotein 3 (coat-protein) 1 1
MIRT020517 DRAP1 DR1-associated protein 1 (negative cofactor 2 alpha) 1 1
MIRT020518 NOB1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) 1 1
MIRT020519 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT020520 RAB14 RAB14, member RAS oncogene family 1 1
MIRT020521 YBX3 cold shock domain protein A 1 1
MIRT020522 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT020523 UBE2J2 ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast) 1 1
MIRT020524 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT020525 CAB39L calcium binding protein 39-like 1 1
MIRT020526 MYLK myosin light chain kinase 1 1
MIRT020527 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT020528 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 1 1
MIRT020529 RTN3 reticulon 3 1 1
MIRT020530 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT020531 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT020532 CDC42BPB CDC42 binding protein kinase beta (DMPK-like) 1 1
MIRT020533 MYD88 myeloid differentiation primary response gene (88) 2 2
MIRT020534 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT020535 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT020536 QRICH1 glutamine-rich 1 1 1
MIRT020537 CYFIP1 cytoplasmic FMR1 interacting protein 1 1 1
MIRT020538 PSIP1 PC4 and SFRS1 interacting protein 1 1 1
MIRT020539 SIN3A SIN3 homolog A, transcription regulator (yeast) 1 1
MIRT020540 STK24 serine/threonine kinase 24 (STE20 homolog, yeast) 1 1
MIRT020541 AGL amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase 1 1
MIRT020542 METAP2 methionyl aminopeptidase 2 1 1
MIRT020543 SPIN1 spindlin 1 1 1
MIRT020544 FAM98B family with sequence similarity 98, member B 1 1
MIRT020545 ERI1 exoribonuclease 1 1 1
MIRT020546 COLGALT1 glycosyltransferase 25 domain containing 1 1 1
MIRT020547 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT020548 KIAA1715 KIAA1715 1 1
MIRT020549 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT020550 PALLD palladin, cytoskeletal associated protein 1 1
MIRT020551 MUT methylmalonyl CoA mutase 1 1
MIRT020552 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT020553 BAG5 BCL2-associated athanogene 5 1 1
MIRT020554 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT020555 LRP1B low density lipoprotein receptor-related protein 1B 1 1
MIRT020556 GCFC2 chromosome 2 open reading frame 3 2 1
MIRT020557 EXOSC2 exosome component 2 2 1
MIRT020558 LNX2 ligand of numb-protein X 2 2 1
MIRT020559 ZNF248 zinc finger protein 248 2 1
MIRT020560 CHD9 chromodomain helicase DNA binding protein 9 2 1
MIRT020561 MEF2A myocyte enhancer factor 2A 2 1
MIRT020562 CAB39 calcium binding protein 39 2 1
MIRT020563 CLUAP1 clusterin associated protein 1 2 1
MIRT020564 CARD11 caspase recruitment domain family, member 11 2 1
MIRT020565 PCDH9 protocadherin 9 2 1
MIRT020566 ZNF561 zinc finger protein 561 2 1
MIRT020567 CARHSP1 calcium regulated heat stable protein 1, 24kDa 2 1
MIRT020568 C16orf62 chromosome 16 open reading frame 62 2 2
MIRT020569 LIN7C lin-7 homolog C (C. elegans) 2 2
MIRT020570 CBR4 carbonyl reductase 4 2 2
MIRT020571 ECI1 dodecenoyl-CoA isomerase 1 1
MIRT020572 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT020573 EIF4E2 eukaryotic translation initiation factor 4E family member 2 1 1
MIRT020574 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT020575 SLC9A3R2 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2 1 1
MIRT020576 CHAF1B chromatin assembly factor 1, subunit B (p60) 1 1
MIRT020577 PPFIBP1 PTPRF interacting protein, binding protein 1 (liprin beta 1) 1 1
MIRT020578 UBXN1 UBX domain protein 1 1 1
MIRT020579 ESRRA estrogen-related receptor alpha 1 1
MIRT020580 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT020581 CTAGE5 CTAGE family, member 5 1 1
MIRT020582 RBM42 RNA binding motif protein 42 1 1
MIRT020583 MFF mitochondrial fission factor 1 1
MIRT020584 NEU1 sialidase 1 (lysosomal sialidase) 1 1
MIRT020585 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT020586 UBE2D2 ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) 1 1
MIRT020587 OVCA2 ovarian tumor suppressor candidate 2 1 1
MIRT020588 EIF3CL eukaryotic translation initiation factor 3, subunit C-like 1 1
MIRT020589 AURKA aurora kinase A 1 1
MIRT020590 LEPREL2 leprecan-like 2 1 1
MIRT020591 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT020592 RETSAT retinol saturase (all-trans-retinol 13,14-reductase) 1 1
MIRT020593 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT020594 KIAA0368 KIAA0368 1 1
MIRT020595 NES nestin 1 1
MIRT020596 KIF22 kinesin family member 22 1 1
MIRT020597 PACSIN2 protein kinase C and casein kinase substrate in neurons 2 1 1
MIRT020598 SLC25A19 solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 1 1
MIRT020599 IPO8 importin 8 1 1
MIRT020600 GPT2 glutamic pyruvate transaminase (alanine aminotransferase) 2 1 1
MIRT020601 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT020602 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 1
MIRT020603 TRMT1 TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) 1 1
MIRT020604 MCAM melanoma cell adhesion molecule 1 1
MIRT020605 INA internexin neuronal intermediate filament protein, alpha 1 1
MIRT020606 SNX6 sorting nexin 6 1 1
MIRT020607 PDAP1 PDGFA associated protein 1 1 1
MIRT020608 PCNT pericentrin 1 1
MIRT020609 FIP1L1 FIP1 like 1 (S. cerevisiae) 1 1
MIRT020610 MTAP methylthioadenosine phosphorylase 1 1
MIRT020611 CEP55 centrosomal protein 55kDa 1 1
MIRT020612 AIFM1 apoptosis-inducing factor, mitochondrion-associated, 1 1 1
MIRT020613 PPM1G protein phosphatase, Mg2+/Mn2+ dependent, 1G 1 1
MIRT020614 PAM16 mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction 1 1
MIRT020615 PLK1 polo-like kinase 1 (Drosophila) 1 1
MIRT020616 AURKB aurora kinase B 1 1
MIRT020617 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT020618 NUPL2 nucleoporin like 2 1 1
MIRT020619 NCKAP1 NCK-associated protein 1 1 1
MIRT020620 EXOC2 exocyst complex component 2 1 1
MIRT020621 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT020622 RRM2 ribonucleotide reductase M2 1 1
MIRT020623 GRPEL1 GrpE-like 1, mitochondrial (E. coli) 1 1
MIRT020624 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT020625 ZNF257 zinc finger protein 257 1 1
MIRT020626 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 1
MIRT020627 LUZP1 leucine zipper protein 1 1 1
MIRT020628 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT020629 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 1
MIRT020630 RP2 retinitis pigmentosa 2 (X-linked recessive) 1 1
MIRT020631 NUP155 nucleoporin 155kDa 1 1
MIRT020632 FAM105B family with sequence similarity 105, member B 1 1
MIRT020633 TMX3 thioredoxin-related transmembrane protein 3 1 1
MIRT020634 ERGIC1 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 1 1
MIRT020635 TRAPPC13 chromosome 5 open reading frame 44 1 1
MIRT020636 NFYC nuclear transcription factor Y, gamma 1 1
MIRT020637 UBE2D3 ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) 1 1
MIRT020638 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT020639 GLIPR1 GLI pathogenesis-related 1 1 1
MIRT020640 GPM6B glycoprotein M6B 1 1
MIRT020641 LRIF1 chromosome 1 open reading frame 103 2 1
MIRT020642 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 2 1
MIRT020643 HERC4 hect domain and RLD 4 2 1
MIRT020644 MORC3 MORC family CW-type zinc finger 3 2 1
MIRT020645 MBNL3 muscleblind-like 3 (Drosophila) 2 1
MIRT020646 UPF2 UPF2 regulator of nonsense transcripts homolog (yeast) 2 2
MIRT020647 KRT6B keratin 6B 1 1
MIRT020648 FLNA filamin A, alpha 1 1
MIRT020649 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT020650 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 1 1
MIRT020651 BUD31 BUD31 homolog (S. cerevisiae) 1 1
MIRT020652 CUTA cutA divalent cation tolerance homolog (E. coli) 1 1
MIRT020653 STIM1 stromal interaction molecule 1 1 1
MIRT020654 EOGT chromosome 3 open reading frame 64 1 1
MIRT020655 GEMIN5 gem (nuclear organelle) associated protein 5 1 1
MIRT020656 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 1 1
MIRT020657 STXBP2 syntaxin binding protein 2 1 1
MIRT020658 PCCB propionyl CoA carboxylase, beta polypeptide 1 1
MIRT020659 EIF3J eukaryotic translation initiation factor 3, subunit J 1 1
MIRT020660 CHRAC1 chromatin accessibility complex 1 1 1
MIRT020661 PLAUR plasminogen activator, urokinase receptor 1 1
MIRT020662 CISD2 CDGSH iron sulfur domain 2 1 1
MIRT020663 BCL7C B-cell CLL/lymphoma 7C 1 1
MIRT020664 TICAM2 toll-like receptor adaptor molecule 2 1 1
MIRT020665 KDM1A lysine (K)-specific demethylase 1A 1 1
MIRT020666 PSEN1 presenilin 1 1 1
MIRT020667 STRN striatin, calmodulin binding protein 1 1
MIRT020668 SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 1 1
MIRT020669 RARS arginyl-tRNA synthetase 1 1
MIRT020670 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 1
MIRT020671 LARS leucyl-tRNA synthetase 1 1
MIRT020672 ALDH1A2 aldehyde dehydrogenase 1 family, member A2 1 1
MIRT020673 CNOT10 CCR4-NOT transcription complex, subunit 10 1 1
MIRT020674 UBE2H ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) 1 1
MIRT020675 TNKS1BP1 tankyrase 1 binding protein 1, 182kDa 1 1
MIRT020676 PUS7 pseudouridylate synthase 7 homolog (S. cerevisiae) 1 1
MIRT020677 RPL39 ribosomal protein L39 1 1
MIRT020678 CTSA cathepsin A 1 1
MIRT020679 MBLAC2 metallo-beta-lactamase domain containing 2 1 1
MIRT020680 GAR1 GAR1 ribonucleoprotein homolog (yeast) 1 1
MIRT020681 RAD1 RAD1 homolog (S. pombe) 1 1
MIRT020682 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT020683 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT020684 KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 1 1
MIRT020685 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT020686 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT020687 PNPLA4 patatin-like phospholipase domain containing 4 1 1
MIRT020688 BCORL1 BCL6 corepressor-like 1 1 1
MIRT020689 GHITM growth hormone inducible transmembrane protein 1 1
MIRT020690 FAM3C family with sequence similarity 3, member C 1 1
MIRT020691 PGRMC2 progesterone receptor membrane component 2 1 1
MIRT020692 RPAP1 RNA polymerase II associated protein 1 1 1
MIRT020693 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT020694 PDE12 phosphodiesterase 12 1 1
MIRT020695 TFCP2 transcription factor CP2 1 1
MIRT020696 CARD10 caspase recruitment domain family, member 10 1 1
MIRT020697 NKX3-1 NK3 homeobox 1 1 1
MIRT020698 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 1
MIRT020699 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 1
MIRT020700 ARL5A ADP-ribosylation factor-like 5A 1 1
MIRT020701 CD109 CD109 molecule 1 1
MIRT020702 TOMM34 translocase of outer mitochondrial membrane 34 1 1
MIRT020703 CFL2 cofilin 2 (muscle) 1 1
MIRT020704 AIMP1 aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 1 1
MIRT020705 MIDN midnolin 1 1
MIRT020706 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT020707 TRIO triple functional domain (PTPRF interacting) 1 1
MIRT020708 PAXBP1 GC-rich sequence DNA-binding factor 1 1 2
MIRT020709 TSPAN14 tetraspanin 14 2 1
MIRT020710 INTS6 integrator complex subunit 6 2 1
MIRT020711 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 2 1
MIRT020712 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 2 1
MIRT020713 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 2 1
MIRT020714 FAM199X family with sequence similarity 199, X-linked 2 1
MIRT020715 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 2 1
MIRT020716 PLS1 plastin 1 2 1
MIRT020717 SAP30L SAP30-like 2 1
MIRT020718 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT020719 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 1 1
MIRT020720 JUNB jun B proto-oncogene 1 1
MIRT020721 SPCS1 signal peptidase complex subunit 1 homolog (S. cerevisiae) 1 1
MIRT020722 CTNNA1 catenin (cadherin-associated protein), alpha 1, 102kDa 1 1
MIRT020723 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT020724 H2AFY H2A histone family, member Y 1 1
MIRT020725 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT020726 AXL AXL receptor tyrosine kinase 1 1
MIRT020727 RING1 ring finger protein 1 1 1
MIRT020728 CLTA clathrin, light chain A 1 1
MIRT020729 COL4A2 collagen, type IV, alpha 2 1 1
MIRT020730 CNNM3 cyclin M3 1 1
MIRT020731 CTNNBL1 catenin, beta like 1 1 1
MIRT020732 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT020733 ATL2 atlastin GTPase 2 1 1
MIRT020734 CDK5 cyclin-dependent kinase 5 1 1
MIRT020735 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT020736 THOC7 THO complex 7 homolog (Drosophila) 1 1
MIRT020737 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT020738 MRPL16 mitochondrial ribosomal protein L16 1 1
MIRT020739 RAB6C RAB6C, member RAS oncogene family 1 1
MIRT020740 HAX1 HCLS1 associated protein X-1 1 1
MIRT020741 ABHD16A HLA-B associated transcript 5 1 1
MIRT020742 ASB6 ankyrin repeat and SOCS box-containing 6 1 1
MIRT020743 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT020744 CECR5 cat eye syndrome chromosome region, candidate 5 1 1
MIRT020745 WDR11 WD repeat domain 11 1 1
MIRT020746 NMD3 NMD3 homolog (S. cerevisiae) 1 1
MIRT020747 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT020748 ACOT7 acyl-CoA thioesterase 7 1 1
MIRT020749 RRAGA Ras-related GTP binding A 1 1
MIRT020750 INTS7 integrator complex subunit 7 1 1
MIRT020751 YARS tyrosyl-tRNA synthetase 1 1
MIRT020752 FLNB filamin B, beta 1 1
MIRT020753 CORO1B coronin, actin binding protein, 1B 1 1
MIRT020754 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT020755 KANK2 KN motif and ankyrin repeat domains 2 1 1
MIRT020756 DIAPH3 diaphanous homolog 3 (Drosophila) 1 1
MIRT020757 FASTKD1 FAST kinase domains 1 1 1
MIRT020758 NSA2 NSA2 ribosome biogenesis homolog (S. cerevisiae) 1 1
MIRT020759 FMNL3 formin-like 3 1 1
MIRT020760 CHTOP chromosome 1 open reading frame 77 1 1
MIRT020761 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT020762 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT020763 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 1
MIRT020764 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT020765 CD3EAP CD3e molecule, epsilon associated protein 1 1
MIRT020766 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT020767 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT020768 DEGS1 degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) 1 1
MIRT020769 OXCT1 3-oxoacid CoA transferase 1 1 1
MIRT020770 PDK1 pyruvate dehydrogenase kinase, isozyme 1 1 1
MIRT020771 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT020772 GMPS guanine monphosphate synthetase 1 1
MIRT020773 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT020774 SMAD4 SMAD family member 4 1 1
MIRT020775 CD68 CD68 molecule 1 1
MIRT020776 FLT1 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) 1 1
MIRT020777 CEP41 testis specific, 14 2 1
MIRT020778 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 1
MIRT020779 CCDC82 coiled-coil domain containing 82 2 1
MIRT020780 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 2 1
MIRT020781 TRAK1 trafficking protein, kinesin binding 1 2 1
MIRT020782 CYP2U1 cytochrome P450, family 2, subfamily U, polypeptide 1 2 1
MIRT020783 SLC35F2 solute carrier family 35, member F2 2 1
MIRT020784 ZNF493 zinc finger protein 493 2 1
MIRT020785 HAL histidine ammonia-lyase 2 1
MIRT020786 IL17RB interleukin 17 receptor B 2 1
MIRT020787 TBC1D14 TBC1 domain family, member 14 2 1
MIRT020788 ZNF254 zinc finger protein 254 2 1
MIRT020789 GABARAPL1 GABA(A) receptor-associated protein like 1 2 1
MIRT020790 IGJ immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides 2 1
MIRT020791 RAPGEF2 Rap guanine nucleotide exchange factor (GEF) 2 2 1
MIRT020792 WBP1L chromosome 10 open reading frame 26 2 1
MIRT020793 PBRM1 polybromo 1 2 2
MIRT020794 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 1 1
MIRT020795 SPECC1 cytospin B 1 1
MIRT020796 MAT2B methionine adenosyltransferase II, beta 1 1
MIRT020797 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT020798 EXOC3 exocyst complex component 3 1 1
MIRT020799 PFDN4 prefoldin subunit 4 1 1
MIRT020800 HK2 hexokinase 2 1 1
MIRT020801 TYSND1 trypsin domain containing 1 1 1
MIRT020802 C12orf10 chromosome 12 open reading frame 10 1 1
MIRT020803 CRAT carnitine O-acetyltransferase 1 1
MIRT020804 PLEKHA5 pleckstrin homology domain containing, family A member 5 1 1
MIRT020805 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT020806 F5 coagulation factor V (proaccelerin, labile factor) 1 1
MIRT020807 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 1 1
MIRT020808 CD81 CD81 molecule 1 1
MIRT020809 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT020810 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT020811 OBSCN obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF 1 1
MIRT020812 MAVS mitochondrial antiviral signaling protein 1 1
MIRT020813 DMD dystrophin 1 1
MIRT020814 CARS2 cysteinyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT020815 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 1 1
MIRT020816 MRPS34 mitochondrial ribosomal protein S34 1 1
MIRT020817 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT020818 KDELC1 KDEL (Lys-Asp-Glu-Leu) containing 1 1 1
MIRT020819 PDCD10 programmed cell death 10 1 1
MIRT020820 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT020821 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT020822 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 1 1
MIRT020823 FUBP3 far upstream element (FUSE) binding protein 3 1 1
MIRT020824 MYO6 myosin VI 1 1
MIRT020825 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT020826 MARC2 MOCO sulphurase C-terminal domain containing 2 1 1
MIRT020827 RIOK2 RIO kinase 2 (yeast) 1 1
MIRT020828 OSBPL9 oxysterol binding protein-like 9 1 1
MIRT020829 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT020830 ATXN10 ataxin 10 1 1
MIRT020831 RAB30 RAB30, member RAS oncogene family 1 1
MIRT020832 DEK DEK oncogene 1 1
MIRT020833 PHF6 PHD finger protein 6 1 1
MIRT020834 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT020835 LEMD3 LEM domain containing 3 1 1
MIRT020836 ZNF207 zinc finger protein 207 1 1
MIRT020837 CSE1L CSE1 chromosome segregation 1-like (yeast) 1 1
MIRT020838 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT020839 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT020840 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT020841 RICTOR RPTOR independent companion of MTOR, complex 2 1 1
MIRT020842 IMPAD1 inositol monophosphatase domain containing 1 1 1
MIRT020843 VPS4B vacuolar protein sorting 4 homolog B (S. cerevisiae) 1 1
MIRT020844 CLINT1 clathrin interactor 1 1 1
MIRT020845 XAF1 XIAP associated factor 1 1 1
MIRT020846 UBQLN2 ubiquilin 2 1 1
MIRT020847 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT020848 PNPT1 polyribonucleotide nucleotidyltransferase 1 1 1
MIRT020849 MRPL18 mitochondrial ribosomal protein L18 2 1
MIRT020850 MAP3K14 mitogen-activated protein kinase kinase kinase 14 1 1
MIRT020851 ARMC2 armadillo repeat containing 2 2 1
MIRT020852 LCORL ligand dependent nuclear receptor corepressor-like 2 1
MIRT020853 APAF1 apoptotic peptidase activating factor 1 2 1
MIRT020854 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 2 1
MIRT020855 RAB11FIP2 RAB11 family interacting protein 2 (class I) 2 1
MIRT020856 NOVA1 neuro-oncological ventral antigen 1 2 1
MIRT020857 RBAK RB-associated KRAB zinc finger 2 1
MIRT020858 ARL15 ADP-ribosylation factor-like 15 2 2
MIRT020859 MYO1D myosin ID 2 1
MIRT020860 LRRC59 leucine rich repeat containing 59 2 2
MIRT020861 CMSS1 chromosome 3 open reading frame 26 1 1
MIRT020862 LONP2 lon peptidase 2, peroxisomal 1 1
MIRT020863 MUS81 MUS81 endonuclease homolog (S. cerevisiae) 1 1
MIRT020864 ITGB4 integrin, beta 4 1 1
MIRT020865 DDB2 damage-specific DNA binding protein 2, 48kDa 1 1
MIRT020866 CAT catalase 1 1
MIRT020867 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 1 1
MIRT020868 TPBG trophoblast glycoprotein 1 1
MIRT020869 INTS4 integrator complex subunit 4 1 1
MIRT020870 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT020871 RBM22 RNA binding motif protein 22 1 1
MIRT020872 MTFMT mitochondrial methionyl-tRNA formyltransferase 1 1
MIRT020873 WRB tryptophan rich basic protein 1 1
MIRT020874 DDRGK1 DDRGK domain containing 1 1 1
MIRT020875 GMPPA GDP-mannose pyrophosphorylase A 1 1
MIRT020876 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT020877 RDH13 retinol dehydrogenase 13 (all-trans/9-cis) 1 1
MIRT020878 CLTC clathrin, heavy chain (Hc) 1 1
MIRT020879 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT020880 CARS cysteinyl-tRNA synthetase 1 1
MIRT020881 PTMS parathymosin 1 1
MIRT020882 CSNK1A1L casein kinase 1, alpha 1-like 1 1
MIRT020883 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT020884 TJP1 tight junction protein 1 (zona occludens 1) 1 1
MIRT020885 FDFT1 farnesyl-diphosphate farnesyltransferase 1 1 1
MIRT020886 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT020887 AKR1C3 aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) 1 1
MIRT020888 PNPLA8 patatin-like phospholipase domain containing 8 1 1
MIRT020889 S100A11 S100 calcium binding protein A11 1 1
MIRT020890 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT020891 FSTL1 follistatin-like 1 1 1
MIRT020892 SLC38A5 solute carrier family 38, member 5 1 1
MIRT020893 ATP6V1H ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H 1 1
MIRT020894 ITGB5 integrin, beta 5 1 1
MIRT020895 SRSF2 splicing factor, arginine/serine-rich 2 1 1
MIRT020896 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1 1
MIRT020897 ANXA2 annexin A2 1 1
MIRT020898 DDX17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 1 1
MIRT020899 RAB2A RAB2A, member RAS oncogene family 1 1
MIRT020900 FOXK1 forkhead box K1 1 1
MIRT020901 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT020902 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT020903 ZNF384 zinc finger protein 384 1 1
MIRT020904 GNAS GNAS complex locus 1 1
MIRT020905 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT020906 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT020907 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT020908 ASPH aspartate beta-hydroxylase 1 1
MIRT020909 INTS8 integrator complex subunit 8 1 1
MIRT020910 CPD carboxypeptidase D 1 1
MIRT020911 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 1 1
MIRT020912 SRPK2 SFRS protein kinase 2 1 1
MIRT020913 STAG2 stromal antigen 2 1 1
MIRT020914 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT020915 TPRKB TP53RK binding protein 1 1
MIRT020916 VPS36 vacuolar protein sorting 36 homolog (S. cerevisiae) 1 1
MIRT020917 VCAM1 vascular cell adhesion molecule 1 1 1
MIRT020918 SMAD3 SMAD family member 3 1 1
MIRT020919 TTF1 transcription termination factor, RNA polymerase I 2 1
MIRT020920 FAM91A1 family with sequence similarity 91, member A1 2 1
MIRT020921 CCDC41 coiled-coil domain containing 41 2 1
MIRT020922 KIAA0430 KIAA0430 2 1
MIRT020923 CDC40 cell division cycle 40 homolog (S. cerevisiae) 2 1
MIRT020924 DCUN1D2 DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) 2 1
MIRT020925 KLHL5 kelch-like 5 (Drosophila) 2 1
MIRT020926 AGO4 eukaryotic translation initiation factor 2C, 4 2 1
MIRT020927 HBP1 HMG-box transcription factor 1 2 1
MIRT020928 WWC1 WW and C2 domain containing 1 2 1
MIRT020929 WEE1 WEE1 homolog (S. pombe) 2 1
MIRT020930 GOLT1B golgi transport 1 homolog B (S. cerevisiae) 2 2
MIRT020931 PALD1 KIAA1274 2 2
MIRT020932 THBS1 thrombospondin 1 1 1
MIRT020933 PPAT phosphoribosyl pyrophosphate amidotransferase 1 1
MIRT020934 DBN1 drebrin 1 1 1
MIRT020935 ATAD2 ATPase family, AAA domain containing 2 1 1
MIRT020936 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT020937 HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 1 1
MIRT020938 NSUN5 NOP2/Sun domain family, member 5 1 1
MIRT020939 TPP2 tripeptidyl peptidase II 1 1
MIRT020940 UAP1 UDP-N-acteylglucosamine pyrophosphorylase 1 1 1
MIRT020941 MYO19 myosin XIX 1 1
MIRT020942 OXNAD1 oxidoreductase NAD-binding domain containing 1 1 1
MIRT020943 SSSCA1 Sjogren syndrome/scleroderma autoantigen 1 1 1
MIRT020944 EEF1E1 eukaryotic translation elongation factor 1 epsilon 1 1 1
MIRT020945 PHGDH phosphoglycerate dehydrogenase 1 1
MIRT020946 CCND1 cyclin D1 1 1
MIRT020947 ALDH3A2 aldehyde dehydrogenase 3 family, member A2 1 1
MIRT020948 CDK2 cyclin-dependent kinase 2 1 1
MIRT020949 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT020950 PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) 1 1
MIRT020951 NDNL2 necdin-like 2 1 1
MIRT020952 TSPAN3 tetraspanin 3 1 1
MIRT020953 MARS methionyl-tRNA synthetase 1 1
MIRT020954 CYB5A cytochrome b5 type A (microsomal) 1 1
MIRT020955 ANPEP alanyl (membrane) aminopeptidase 1 1
MIRT020956 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT020957 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT020958 AGRN agrin 1 1
MIRT020959 TMEM41A transmembrane protein 41A 1 1
MIRT020960 EEFSEC eukaryotic elongation factor, selenocysteine-tRNA-specific 1 1
MIRT020961 EML4 echinoderm microtubule associated protein like 4 1 1
MIRT020962 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT020963 VANGL1 vang-like 1 (van gogh, Drosophila) 1 1
MIRT020964 RTFDC1 chromosome 20 open reading frame 43 1 1
MIRT020965 WNT5A wingless-type MMTV integration site family, member 5A 1 1
MIRT020966 TMEM167A transmembrane protein 167A 1 1
MIRT020967 CLIC4 chloride intracellular channel 4 1 1
MIRT020968 MEST mesoderm specific transcript homolog (mouse) 1 1
MIRT020969 TRIM24 tripartite motif-containing 24 1 1
MIRT020970 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 1 1
MIRT020971 MMS22L chromosome 6 open reading frame 167 1 1
MIRT020972 SKIV2L2 superkiller viralicidic activity 2-like 2 (S. cerevisiae) 1 1
MIRT020973 CCR9 chemokine (C-C motif) receptor 9 1 2
MIRT020974 DR1 down-regulator of transcription 1, TBP-binding (negative cofactor 2) 1 1
MIRT020975 RSF1 remodeling and spacing factor 1 1 1
MIRT020976 ANTXR1 anthrax toxin receptor 1 1 2
MIRT020977 SEPT11 septin 11 1 2
MIRT020978 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 3
MIRT020979 IL8 interleukin 8 1 1
MIRT020980 ZNF83 zinc finger protein 83 2 1
MIRT020981 PHF14 PHD finger protein 14 2 1
MIRT020982 TBC1D8B TBC1 domain family, member 8B (with GRAM domain) 2 1
MIRT020983 INPP5F inositol polyphosphate-5-phosphatase F 2 1
MIRT020984 ARPC3 actin related protein 2/3 complex, subunit 3, 21kDa 2 1
MIRT020985 KRCC1 lysine-rich coiled-coil 1 2 1
MIRT020986 FAM177A1 family with sequence similarity 177, member A1 2 1
MIRT020987 UBTD2 ubiquitin domain containing 2 2 1
MIRT020988 SECISBP2 SECIS binding protein 2 2 1
MIRT020989 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 2 1
MIRT020990 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 2 1
MIRT020991 ZNF28 zinc finger protein 28 2 1
MIRT020992 MCM8 minichromosome maintenance complex component 8 2 1
MIRT020993 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 2 1
MIRT020994 TCF12 transcription factor 12 2 1
MIRT020995 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 2 1
MIRT020996 UBQLN1 ubiquilin 1 2 2
MIRT020997 KYNU kynureninase (L-kynurenine hydrolase) 1 1
MIRT020998 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 1 1
MIRT020999 MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 1 1
MIRT021000 FAM120A family with sequence similarity 120A 1 1
MIRT021001 FAM96B family with sequence similarity 96, member B 1 1
MIRT021002 FKBP3 FK506 binding protein 3, 25kDa 1 1
MIRT021003 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 1 1
MIRT021004 NEUROG1 neurogenin 1 1 1
MIRT021005 EPRS glutamyl-prolyl-tRNA synthetase 1 1
MIRT021006 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT021007 CDH13 cadherin 13, H-cadherin (heart) 1 1
MIRT021008 ATP13A1 ATPase type 13A1 1 1
MIRT021009 EIF3F eukaryotic translation initiation factor 3, subunit F 1 1
MIRT021010 C14orf1 chromosome 14 open reading frame 1 1 1
MIRT021011 NUP62 nucleoporin 62kDa 1 1
MIRT021012 GCLC glutamate-cysteine ligase, catalytic subunit 1 1
MIRT021013 NDUFAF2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2 1 1
MIRT021014 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT021015 HTRA1 HtrA serine peptidase 1 1 1
MIRT021016 CDK4 cyclin-dependent kinase 4 1 1
MIRT021017 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT021018 COG2 component of oligomeric golgi complex 2 1 1
MIRT021019 CCT2 chaperonin containing TCP1, subunit 2 (beta) 1 1
MIRT021020 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT021021 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT021022 PRSS21 protease, serine, 21 (testisin) 1 1
MIRT021023 INTS10 integrator complex subunit 10 1 1
MIRT021024 STX5 syntaxin 5 1 1
MIRT021025 CIAO1 cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) 1 1
MIRT021026 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT021027 GLG1 golgi glycoprotein 1 1 1
MIRT021028 TROVE2 TROVE domain family, member 2 1 1
MIRT021029 ARGLU1 arginine and glutamate rich 1 1 1
MIRT021030 CALU calumenin 1 1
MIRT021031 BRI3BP BRI3 binding protein 1 1
MIRT021032 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT021033 PYGL phosphorylase, glycogen, liver 1 1
MIRT021034 MRS2 MRS2 magnesium homeostasis factor homolog (S. cerevisiae) 1 1
MIRT021035 CLGN calmegin 1 1
MIRT021036 KIF14 kinesin family member 14 1 1
MIRT021037 POLR2C polymerase (RNA) II (DNA directed) polypeptide C, 33kDa 1 1
MIRT021038 TPD52 tumor protein D52 1 1
MIRT021039 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT021040 RNF2 ring finger protein 2 1 1
MIRT021041 LTN1 ring finger protein 160 1 1
MIRT021042 TMEM33 transmembrane protein 33 1 1
MIRT021043 TNPO1 transportin 1 1 1
MIRT021044 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT021045 ADAM10 ADAM metallopeptidase domain 10 1 1
MIRT021046 ERBB2IP erbb2 interacting protein 1 1
MIRT021047 CCL2 chemokine (C-C motif) ligand 2 1 1
MIRT021048 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 1 1
MIRT021049 IL6 interleukin 6 (interferon, beta 2) 1 2
MIRT021050 CD36 CD36 molecule (thrombospondin receptor) 1 1
MIRT021051 RREB1 ras responsive element binding protein 1 1 1
MIRT021052 ZKSCAN5 zinc finger with KRAB and SCAN domains 5 1 1
MIRT021053 ZNF611 zinc finger protein 611 1 1
MIRT021054 ZNF273 zinc finger protein 273 1 1
MIRT021055 MED13L mediator complex subunit 13-like 1 1
MIRT021056 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT021057 VPS18 vacuolar protein sorting 18 homolog (S. cerevisiae) 1 1
MIRT021058 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 2 1
MIRT021059 MASTL microtubule associated serine/threonine kinase-like 2 2
MIRT021060 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 2 2
MIRT021061 GATM glycine amidinotransferase (L-arginine:glycine amidinotransferase) 2 2
MIRT021062 E2F2 E2F transcription factor 2 2 2
MIRT021063 FAM135A family with sequence similarity 135, member A 2 2
MIRT021064 C3orf18 chromosome 3 open reading frame 18 3 2
MIRT021065 ARL6IP5 ADP-ribosylation-like factor 6 interacting protein 5 2 2