Accession ID: MIRT005902 [miRNA, hsa-miR-22-3p :: MAOA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-22LinkOut: [miRBase ]
Synonyms MIRN22, hsa-mir-22, miR-22, MIR22
Description Homo sapiens miR-22 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-22-3p
Mature Sequence 53| AAGCUGCCAGUUGAAGAACUGU |74
Evidence Experimental
Experiments Cloned
Putative hsa-miR-22-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MAOA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms -
Description monoamine oxidase A
Transcript NM_0002    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MAOA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MAOA
(miRNA target sites are highlighted)
>MAOA|NM_0002|3'UTR
   1 ATGCTGATTTAAACTTCTTAACTGGCAACAGTTGGAACAGTAATCAGTTTGCTAACATATTTAAAGTCTTGAATGTTGAA
  81 GAACTCATGTGATTTACCCTTTTCAACTTTTTGGAAAACGATTTAATTTATTCTAATTAGATTAACCCTATTAATCTATG
 161 GATTGGGTATCAAAATGAATGCCAGTCCAGATGTGCCTAGACACGAAATTGGAGCTGAGGACTCTCACGATATGCAAGTT
 241 CATCCAACGTGAAGATACCATAAGCTTTTTCTCTGAACCAGAGAAATGAAAGTCAGTTTAAGAGGCTGATAGATCTTGGC
 321 CCTGTTAAGGCATCCACTTCACAGTTCTGAAGGCTGAGTCAGCCCCACTCCACAGTTAGGCCAAGAATTAGATTTTAAAA
 401 CTTCATCTGTCTGTCCCAGTTAACTGTTAAATAAGGCCTCATCCTCCACTGAAGAGTATGGATTGAAGGATTGTGAACTA
 481 TGTTTAGTGTGATTGTGAACTTGGTGCCTAATGTTCCATGTCTGAAGTTTGCCCCAGTGCTACACGTTGGAGTATACCTA
 561 TGTGTGTGCTTTGCCACTGAAGTAAGATTTTGCCTGTATGGTACTGTTTTGTTTGTTAATAAAGTGCACTGCCACCCCCA
 641 ATGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-22-3p :: MAOA    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray
Conditions HeLa , SH-SY5Y
Disease panic disorder
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan
Original Description (Extracted from the article) ... miR-22 was the miRNA with highest number of functional targets, with four genes being potentially repressed by this miRNA: the neurotrophic factor BDNF, the serotonin receptor HTR2C, monoamine oxidase A-MAOA- and the regulator of g protein signalling RGS2 ...

- Muinos-Gimeno, M. Espinosa-Parrilla, Y. et al., 2011, Biological Psychiatry.

Article - Muinos-Gimeno, M. Espinosa-Parrilla, Y. et al.
- Biological Psychiatry, 2011
BACKGROUND: The involvement of microRNAs (miRNAs) in neuronal differentiation and synaptic plasticity suggests a role for miRNAs in psychiatric disorders; association analyses and functional approaches were used to evaluate the implication of miRNAs in the susceptibility for panic disorder. METHODS: Case-control studies for 712 single-nucleotide polymorphisms (SNPs) tagging 325 human miRNA regions were performed in 203 Spanish patients with panic disorder and 341 control subjects. A sample of 321 anxiety patients and 642 control subjects from Finland and 102 panic disorder patients and 829 control subjects from Estonia was used as a replica. Reporter-gene assays and miRNA overexpression experiments in neuroblastoma cells were used to functionally evaluate the spectrum of genes regulated by the associated miRNAs. RESULTS: Two SNPs associated with panic disorder: rs6502892 tagging miR-22 (p < .0002), and rs11763020 tagging miR-339 (p < .00008). Other SNPs tagging miR-138-2, miR-488, miR-491, and miR-148a regions associated with different panic disorder phenotypes. Replication in the north-European sample supported several of these associations, although they did not pass correction for multiple testing. Functional studies revealed that miR-138-2, miR-148a, and miR-488 repress (30%-60%) several candidate genes for panic disorder-GABRA6, CCKBR and POMC, respectively-and that miR-22 regulates four other candidate genes: BDNF, HTR2C, MAOA, and RGS2. Transcriptome analysis of neuroblastoma cells transfected with miR-22 and miR-488 showed altered expression of a subset of predicted target genes for these miRNAs and of genes that might be affecting physiological pathways related to anxiety. CONCLUSIONS: This work represents the first report of a possible implication of miRNAs in the etiology of panic disorder.
LinkOut: [PMID: 21168126]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
74 hsa-miR-22-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002000 BMP7 bone morphogenetic protein 7 4 1
MIRT002473 PPARA peroxisome proliferator-activated receptor alpha 4 3
MIRT002474 ESR1 estrogen receptor 1 4 2
MIRT004035 HDAC4 histone deacetylase 4 4 2
MIRT004538 TFRC transferrin receptor (p90, CD71) 1 1
MIRT005505 MYCBP c-myc binding protein 3 1
MIRT005779 ACVR1C activin A receptor, type IC 2 1
MIRT005900 BDNF brain-derived neurotrophic factor 2 1
MIRT005901 HTR2C 5-hydroxytryptamine (serotonin) receptor 2C 2 1
MIRT005902 MAOA monoamine oxidase A 2 1
MIRT005903 RGS2 regulator of G-protein signaling 2, 24kDa 2 2
MIRT006106 NCOA1 nuclear receptor coactivator 1 2 1
MIRT006195 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 4 1
MIRT006210 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 3 1
MIRT006444 TCEAL1 transcription elongation factor A (SII)-like 1 3 2
MIRT006467 PTMS parathymosin 4 1
MIRT006621 Ogn osteoglycin 2 1
MIRT006745 PTEN phosphatase and tensin homolog 1 1
MIRT007157 HMGB1 high-mobility group box 1 3 1
MIRT007158 IRF5 interferon regulatory factor 5 3 1
MIRT007220 RCOR1 REST corepressor 1 1 1
MIRT007329 SP1 Sp1 transcription factor 1 2
MIRT030633 MAX MYC associated factor X 1 1
MIRT030634 BTF3 basic transcription factor 3 1 1
MIRT030635 PRKACA protein kinase, cAMP-dependent, catalytic, alpha 1 1
MIRT030636 ZFYVE20 zinc finger, FYVE domain containing 20 1 1
MIRT030637 TBC1D12 TBC1 domain family, member 12 1 1
MIRT030638 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT030639 TBX3 T-box 3 1 1
MIRT030640 MIS18BP1 chromosome 14 open reading frame 106 1 1
MIRT030641 FOXP1 forkhead box P1 1 1
MIRT030642 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT030643 CCNT2 cyclin T2 1 1
MIRT030644 LEMD3 LEM domain containing 3 1 1
MIRT030645 ZNF217 zinc finger protein 217 1 1
MIRT030646 SRSF7 splicing factor, arginine/serine-rich 7, 35kDa 1 1
MIRT030647 PDHA1 pyruvate dehydrogenase (lipoamide) alpha 1 1 1
MIRT030648 E2F2 E2F transcription factor 2 1 1
MIRT030649 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT030650 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT030651 TSC22D4 TSC22 domain family, member 4 1 1
MIRT030652 SOGA1 chromosome 20 open reading frame 117 1 1
MIRT030653 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT030654 CDK6 cyclin-dependent kinase 6 1 1
MIRT030655 PIK3C2A phosphoinositide-3-kinase, class 2, alpha polypeptide 1 1
MIRT030656 C5orf24 chromosome 5 open reading frame 24 1 1
MIRT030657 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT030658 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 1
MIRT030659 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT030660 LRRC1 leucine rich repeat containing 1 1 1
MIRT050450 LBP lipopolysaccharide binding protein 1 1
MIRT050451 CLPTM1L CLPTM1-like 1 1
MIRT050452 RPS2 ribosomal protein S2 1 1
MIRT050453 RPS4X ribosomal protein S4, X-linked 1 1
MIRT050454 RPL24 ribosomal protein L24 1 1
MIRT050455 BUB1B budding uninhibited by benzimidazoles 1 homolog beta (yeast) 1 1
MIRT050456 FKBP5 FK506 binding protein 5 1 1
MIRT050457 ALMS1 Alstrom syndrome 1 1 1
MIRT050458 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT050459 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT050460 RPL35A ribosomal protein L35a 1 1
MIRT050461 VAPB VAMP (vesicle-associated membrane protein)-associated protein B and C 1 1
MIRT050462 MYO6 myosin VI 1 1
MIRT050463 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT050464 NUP214 nucleoporin 214kDa 1 1
MIRT050465 SPG11 spastic paraplegia 11 (autosomal recessive) 1 1
MIRT050466 ELP5 chromosome 17 open reading frame 81 1 1
MIRT050467 DNHD1 dynein heavy chain domain 1 1 1
MIRT050468 GLIS2 GLIS family zinc finger 2 1 1
MIRT050469 PEX5 peroxisomal biogenesis factor 5 1 1
MIRT050470 SFXN1 sideroflexin 1 1 1
MIRT050471 RBM39 RNA binding motif protein 39 1 1
MIRT050472 RPSA ribosomal protein SA 1 1
MIRT050473 STX4 syntaxin 4 1 1