Accession ID: MIRT005902 [miRNA, hsa-miR-22-3p :: MAOA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-22LinkOut: [miRBase ]
Synonyms MIRN22, hsa-mir-22, miR-22, MIR22
Description Homo sapiens miR-22 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-22-3p
Mature Sequence 53| AAGCUGCCAGUUGAAGAACUGU |74
Evidence Experimental
Experiments Cloned
Putative hsa-miR-22-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MAOA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MAO-A
Description monoamine oxidase A
Transcript NM_000240    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MAOA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MAOA
(miRNA target sites are highlighted)
>MAOA|NM_000240|3'UTR
   1 ATGCTGATTTAAACTTCTTAACTGGCAACAGTTGGAACAGTAATCAGTTTGCTAACATATTTAAAGTCTTGAATGTTGAA
  81 GAACTCATGTGATTTACCCTTTTCAACTTTTTGGAAAACGATTTAATTTATTCTAATTAGATTAACCCTATTAATCTATG
 161 GATTGGGTATCAAAATGAATGCCAGTCCAGATGTGCCTAGACACGAAATTGGAGCTGAGGACTCTCACGATATGCAAGTT
 241 CATCCAACGTGAAGATACCATAAGCTTTTTCTCTGAACCAGAGAAATGAAAGTCAGTTTAAGAGGCTGATAGATCTTGGC
 321 CCTGTTAAGGCATCCACTTCACAGTTCTGAAGGCTGAGTCAGCCCCACTCCACAGTTAGGCCAAGAATTAGATTTTAAAA
 401 CTTCATCTGTCTGTCCCAGTTAACTGTTAAATAAGGCCTCATCCTCCACTGAAGAGTATGGATTGAAGGATTGTGAACTA
 481 TGTTTAGTGTGATTGTGAACTTGGTGCCTAATGTTCCATGTCTGAAGTTTGCCCCAGTGCTACACGTTGGAGTATACCTA
 561 TGTGTGTGCTTTGCCACTGAAGTAAGATTTTGCCTGTATGGTACTGTTTTGTTTGTTAATAAAGTGCACTGCCACCCCCA
 641 ATGCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugUCAAGAAGUUGACCGUCGaa 5'
            | ||||| |||||||| |  
Target 5' aaACTTCTT-AACTGGCAACag 3'
11 - 31 127.00 -12.90
2
miRNA  3' ugUCAAGAAGU-UGA--CCGUCGaa 5'
            ||||||  | :||  | ||||  
Target 5' acAGTTCTGAAGGCTGAGTCAGCcc 3'
341 - 365 110.00 -18.80
3
miRNA  3' ugucaagaagUUGACCGUCGAa 5'
                    ||:||| |||| 
Target 5' ctagacacgaAATTGG-AGCTg 3'
197 - 217 104.00 -9.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-22-3p :: MAOA    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray
Conditions HeLa , SH-SY5Y
Disease panic disorder
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan
Original Description (Extracted from the article) ... miR-22 was the miRNA with highest number of functional targets, with four genes being potentially repressed by this miRNA: the neurotrophic factor BDNF, the serotonin receptor HTR2C, monoamine oxidase A-MAOA- and the regulator of g protein signalling RGS2 ...

- Muinos-Gimeno, M. Espinosa-Parrilla, Y. et al., 2011, Biological Psychiatry.

Article - Muinos-Gimeno, M. Espinosa-Parrilla, Y. et al.
- Biological Psychiatry, 2011
BACKGROUND: The involvement of microRNAs (miRNAs) in neuronal differentiation and synaptic plasticity suggests a role for miRNAs in psychiatric disorders; association analyses and functional approaches were used to evaluate the implication of miRNAs in the susceptibility for panic disorder. METHODS: Case-control studies for 712 single-nucleotide polymorphisms (SNPs) tagging 325 human miRNA regions were performed in 203 Spanish patients with panic disorder and 341 control subjects. A sample of 321 anxiety patients and 642 control subjects from Finland and 102 panic disorder patients and 829 control subjects from Estonia was used as a replica. Reporter-gene assays and miRNA overexpression experiments in neuroblastoma cells were used to functionally evaluate the spectrum of genes regulated by the associated miRNAs. RESULTS: Two SNPs associated with panic disorder: rs6502892 tagging miR-22 (p < .0002), and rs11763020 tagging miR-339 (p < .00008). Other SNPs tagging miR-138-2, miR-488, miR-491, and miR-148a regions associated with different panic disorder phenotypes. Replication in the north-European sample supported several of these associations, although they did not pass correction for multiple testing. Functional studies revealed that miR-138-2, miR-148a, and miR-488 repress (30%-60%) several candidate genes for panic disorder-GABRA6, CCKBR and POMC, respectively-and that miR-22 regulates four other candidate genes: BDNF, HTR2C, MAOA, and RGS2. Transcriptome analysis of neuroblastoma cells transfected with miR-22 and miR-488 showed altered expression of a subset of predicted target genes for these miRNAs and of genes that might be affecting physiological pathways related to anxiety. CONCLUSIONS: This work represents the first report of a possible implication of miRNAs in the etiology of panic disorder.
LinkOut: [PMID: 21168126]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
138 hsa-miR-22-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002000 BMP7 bone morphogenetic protein 7 4 2
MIRT002473 PPARA peroxisome proliferator-activated receptor alpha 4 3
MIRT002474 ESR1 estrogen receptor 1 4 2
MIRT004035 HDAC4 histone deacetylase 4 4 2
MIRT004538 TFRC transferrin receptor (p90, CD71) 1 1
MIRT005505 MYCBP c-myc binding protein 3 1
MIRT005779 ACVR1C activin A receptor, type IC 2 1
MIRT005900 BDNF brain-derived neurotrophic factor 2 1
MIRT005901 HTR2C 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled 2 1
MIRT005902 MAOA monoamine oxidase A 2 1
MIRT005903 RGS2 regulator of G-protein signaling 2, 24kDa 2 2
MIRT006106 NCOA1 nuclear receptor coactivator 1 2 1
MIRT006195 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 4 1
MIRT006210 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 3 1
MIRT006444 TCEAL1 transcription elongation factor A (SII)-like 1 3 2
MIRT006467 PTMS parathymosin 4 1
MIRT006621 Ogn osteoglycin 2 1
MIRT006745 PTEN phosphatase and tensin homolog 1 1
MIRT007157 HMGB1 high mobility group box 1 3 1
MIRT007158 IRF5 interferon regulatory factor 5 3 1
MIRT007220 RCOR1 REST corepressor 1 1 1
MIRT007329 SP1 Sp1 transcription factor 1 2
MIRT030633 MAX MYC associated factor X 2 2
MIRT030634 BTF3 basic transcription factor 3 1 1
MIRT030635 PRKACA protein kinase, cAMP-dependent, catalytic, alpha 1 1
MIRT030636 ZFYVE20 zinc finger, FYVE domain containing 20 1 1
MIRT030637 TBC1D12 TBC1 domain family, member 12 1 1
MIRT030638 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT030639 TBX3 T-box 3 1 1
MIRT030640 MIS18BP1 MIS18 binding protein 1 1 1
MIRT030641 FOXP1 forkhead box P1 1 1
MIRT030642 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT030643 CCNT2 cyclin T2 1 2
MIRT030644 LEMD3 LEM domain containing 3 1 1
MIRT030645 ZNF217 zinc finger protein 217 1 1
MIRT030646 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT030647 PDHA1 pyruvate dehydrogenase (lipoamide) alpha 1 1 1
MIRT030648 E2F2 E2F transcription factor 2 1 1
MIRT030649 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT030650 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT030651 TSC22D4 TSC22 domain family, member 4 1 1
MIRT030652 SOGA1 suppressor of glucose, autophagy associated 1 1 1
MIRT030653 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT030654 CDK6 cyclin-dependent kinase 6 1 1
MIRT030655 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha 1 1
MIRT030656 C5orf24 chromosome 5 open reading frame 24 1 5
MIRT030657 RAB5B RAB5B, member RAS oncogene family 1 2
MIRT030658 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 2
MIRT030659 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT030660 LRRC1 leucine rich repeat containing 1 1 1
MIRT050450 LBP lipopolysaccharide binding protein 1 1
MIRT050451 CLPTM1L CLPTM1-like 1 1
MIRT050452 RPS2 ribosomal protein S2 1 1
MIRT050453 RPS4X ribosomal protein S4, X-linked 1 1
MIRT050454 RPL24 ribosomal protein L24 1 1
MIRT050455 BUB1B budding uninhibited by benzimidazoles 1 homolog beta (yeast) 1 1
MIRT050456 FKBP5 FK506 binding protein 5 1 1
MIRT050457 ALMS1 Alstrom syndrome 1 1 1
MIRT050458 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT050459 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT050460 RPL35A ribosomal protein L35a 1 1
MIRT050461 VAPB VAMP (vesicle-associated membrane protein)-associated protein B and C 1 1
MIRT050462 MYO6 myosin VI 1 1
MIRT050463 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT050464 NUP214 nucleoporin 214kDa 1 1
MIRT050465 SPG11 spastic paraplegia 11 (autosomal recessive) 1 1
MIRT050466 ELP5 elongator acetyltransferase complex subunit 5 1 1
MIRT050467 DNHD1 dynein heavy chain domain 1 1 1
MIRT050468 GLIS2 GLIS family zinc finger 2 1 1
MIRT050469 PEX5 peroxisomal biogenesis factor 5 1 1
MIRT050470 SFXN1 sideroflexin 1 1 1
MIRT050471 RBM39 RNA binding motif protein 39 1 1
MIRT050472 RPSA ribosomal protein SA 1 1
MIRT050473 STX4 syntaxin 4 1 1
MIRT052981 HDAC6 histone deacetylase 6 3 1
MIRT053224 TET2 tet methylcytosine dioxygenase 2 3 2
MIRT053319 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 2
MIRT053534 WNT1 wingless-type MMTV integration site family, member 1 4 1
MIRT053753 CD151 CD151 molecule (Raph blood group) 3 1
MIRT054848 CYR61 cysteine-rich, angiogenic inducer, 61 3 1
MIRT066400 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT110212 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT143443 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT245557 DDIT4 DNA-damage-inducible transcript 4 1 2
MIRT258110 INSIG1 insulin induced gene 1 1 1
MIRT303923 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT437402 LGALS1 lectin, galactoside-binding, soluble, 1 2 1
MIRT437403 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 2 1
MIRT438122 BSG basigin (Ok blood group) 1 1
MIRT438232 CSF1R colony stimulating factor 1 receptor 2 1
MIRT438479 BMPR1B bone morphogenetic protein receptor, type IB 1 1
MIRT438480 BMP6 bone morphogenetic protein 6 1 1
MIRT438530 NET1 neuroepithelial cell transforming 1 3 1
MIRT438887 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT438921 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT442704 ZNF646 zinc finger protein 646 1 2
MIRT456847 ZNF460 zinc finger protein 460 1 1
MIRT457536 ZMAT5 zinc finger, matrin-type 5 1 1
MIRT465391 TPD52L2 tumor protein D52-like 2 1 1
MIRT474969 KCTD10 potassium channel tetramerisation domain containing 10 1 2
MIRT494485 BRWD3 bromodomain and WD repeat domain containing 3 1 1
MIRT498344 PRELID2 PRELI domain containing 2 1 1
MIRT500532 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 3
MIRT500782 TMED4 transmembrane emp24 protein transport domain containing 4 1 3
MIRT505736 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT518132 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT524308 CTC1 CTS telomere maintenance complex component 1 1 2
MIRT530326 TNFRSF10D tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain 1 1
MIRT532406 RAB44 RAB44, member RAS oncogene family 1 1
MIRT533138 WWC1 WW and C2 domain containing 1 1 1
MIRT538116 DDX6 DEAD (Asp-Glu-Ala-Asp) box helicase 6 1 1
MIRT552906 VSNL1 visinin-like 1 1 3
MIRT568735 ZNF662 zinc finger protein 662 1 1
MIRT572224 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT572706 SRPK1 SRSF protein kinase 1 1 1
MIRT572719 RBL1 retinoblastoma-like 1 (p107) 1 1
MIRT572795 IFT140 intraflagellar transport 140 homolog (Chlamydomonas) 1 1
MIRT575089 Ddit4 DNA-damage-inducible transcript 4 1 1
MIRT576120 Klf6 Kruppel-like factor 6 1 1
MIRT576177 Hmox1 heme oxygenase (decycling) 1 1 1
MIRT616391 C1orf87 chromosome 1 open reading frame 87 1 1
MIRT616770 LONP2 lon peptidase 2, peroxisomal 1 1
MIRT646366 PIGP phosphatidylinositol glycan anchor biosynthesis, class P 1 1
MIRT652495 TMEM178B transmembrane protein 178B 1 1
MIRT668845 CYCS cytochrome c, somatic 1 1
MIRT677708 GINS2 GINS complex subunit 2 (Psf2 homolog) 1 1
MIRT682771 TMEM120B transmembrane protein 120B 1 1
MIRT688566 DCAF16 DDB1 and CUL4 associated factor 16 1 1
MIRT699417 SLC2A1 solute carrier family 2 (facilitated glucose transporter), member 1 1 1
MIRT700249 RCC2 regulator of chromosome condensation 2 1 1
MIRT700281 RAP2B RAP2B, member of RAS oncogene family 1 1
MIRT705019 CAMK2N1 calcium/calmodulin-dependent protein kinase II inhibitor 1 1 1
MIRT714521 VASN vasorin 1 1
MIRT716840 EFR3B EFR3 homolog B (S. cerevisiae) 1 1
MIRT717316 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT718160 TTC33 tetratricopeptide repeat domain 33 1 1
MIRT722900 LRRC20 leucine rich repeat containing 20 1 1
MIRT725426 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*