Accession ID: MIRT005908 [miRNA, hsa-miR-29a-3p :: RET, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29aLinkOut: [miRBase ]
Synonyms MIRN29, MIRN29A, hsa-mir-29, hsa-mir-29a, miRNA29A, MIR29A
Description Homo sapiens miR-29a stem-loop
Comment miR-29a was previously know as miR-29 here and in .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29a-3p
Mature Sequence 42| UAGCACCAUCUGAAAUCGGUUA |63
Evidence Experimental
Experiments Northern
Putative hsa-miR-29a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol RET LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDHF12, CDHR16, HSCR1, MEN2A, MEN2B, MTC1, PTC, RET-ELE1, RET51
Description ret proto-oncogene
Transcript NM_0209    LinkOut: [ RefSeq ]
Other Transcripts NM_0206   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on RET LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of RET
(miRNA target sites are highlighted)
>RET|NM_0209|3'UTR
   1 TAACATTTCTTTGTGAAAGGTAATGGACTCACAAGGGGAAGAAACATGCTGAGAATGGAAAGTCTACCGGCCCTTTCTTT
  81 GTGAACGTCACATTGGCCGAGCCGTGTTCAGTTCCCAGGTGGCAGACTCGTTTTTGGTAGTTTGTTTTAACTTCCAAGGT
 161 GGTTTTACTTCTGATAGCCGGTGATTTTCCCTCCTAGCAGACATGCCACACCGGGTAAGAGCTCTGAGTCTTAGTGGTTA
 241 AGCATTCCTTTCTCTTCAGTGCCCAGCAGCACCCAGTGTTGGTCTGTGTCCATCAGTGACCACCAACATTCTGTGTTCAC
 321 ATGTGTGGGTCCAACACTTACTACCTGGTGTATGAAATTGGACCTGAACTGTTGGATTTTTCTAGTTGCCGCCAAACAAG
 401 GCAAAAAAATTTAAACATGAAGCACACACACAAAAAAGGCAGTAGGAAAAATGCTGGCCCTGATGACCTGTCCTTATTCA
 481 GAATGAGAGACTGCGGGGGGGGCCTGGGGGTAGTGTCAATGCCCCTCCAGGGCTGGAGGGGAAGAGGGGCCCCGAGGATG
 561 GGCCTGGGCTCAGCATTCGAGATCTTGAGAATGATTTTTTTTTAATCATGCAACCTTTCCTTAGGAAGACATTTGGTTTT
 641 CATCATGATTAAGATGATTCCTAGATTTAGCACAATGGAGAGATTCCATGCCATCTTTACTATGTGGATGGTGGTATCAG
 721 GGAAGAGGGCTCACAAGACACATTTGTCCCCCGGGCCCACCACATCATCCTCACGTGTTCGGTACTGAGCAGCCACTACC
 801 CCTGATGAGAACAGTATGAAGAAAGGGGGCTGTTGGAGTCCCAGAATTGCTGACAGCAGAGGCTTTGCTGCTGTGAATCC
 881 CACCTGCCACCAGCCTGCAGCACACCCCACAGCCAAGTAGAGGCGAAAGCAGTGGCTCATCCTACCTGTTAGGAGCAGGT
 961 AGGGCTTGTACTCACTTTAATTTGAATCTTATCAACTTACTCATAAAGGGACAGGCTAGCTAGCTGTGTTAGAAGTAGCA
1041 ATGACAATGACCAAGGACTGCTACACCTCTGATTACAATTCTGATGTGAAAAAGATGGTGTTTGGCTCTTATAGAGCCTG
1121 TGTGAAAGGCCCATGGATCAGCTCTTCCTGTGTTTGTAATTTAATGCTGCTACAAGATGTTTCTGTTTCTTAGATTCTGA
1201 CCATGACTCATAAGCTTCTTGTCATTCTTCATTGCTTGTTTGTGGTCACAGATGCACAACACTCCTCCAGTCTTGTGGGG
1281 GCAGCTTTTGGGAAGTCTCAGCAGCTCTTCTGGCTGTGTTGTCAGCACTGTAACTTCGCAGAAAAGAGTCGGATTACCAA
1361 AACACTGCCTGCTCTTCAGACTTAAAGCACTGATAGGACTTAAAATAGTCTCATTCAAATACTGTATTTTATATAGGCAT
1441 TTCACAAAAACAGCAAAATTGTGGCATTTTGTGAGGCCAAGGCTTGGATGCGTGTGTAATAGAGCCTTGTGGTGTGTGCG
1521 CACACACCCAGAGGGAGAGTTTGAAAAATGCTTATTGGACACGTAACCTGGCTCTAATTTGGGCTGTTTTTCAGATACAC
1601 TGTGATAAGTTCTTTTACAAATATCTATAGACATGGTAAACTTTTGGTTTTCAGATATGCTTAATGATAGTCTTACTAAA
1681 TGCAGAAATAAGAATAAACTTTCTCAAATTATTAAAAATGCCTACACAGTAAGTGTGAATTGCTGCAACAGGTTTGTTCT
1761 CAGGAGGGTAAGAACTCCAGGTCTAAACAGCTGACCCAGTGATGGGGAATTTATCCTTGACCAATTTATCCTTGACCAAT
1841 AACCTAATTGTCTATTCCTGAGTTATAAAAGTCCCCATCCTTATTAGCTCTACTGGAATTTTCATACACGTAAATGCAGA
1921 AGTTACTAAGTATTAAGTATTACTGAGTATTAAGTAGTAATCTGTCAGTTATTAAAATTTGTAAAATCTATTTATGAAAG
2001 GTCATTAAACCAGATCATGTTCCTTTTTTTGTAATCAAGGTGACTAAGAAAATCAGTTGTGTAAATAAAATCATGTATCA
2081 TAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' auuGGCUAAA----GUCUACCACGAu 5'
             |:||| |     ||||||||:| 
Target 5' attCTGATGTGAAAAAGATGGTGTTt 3'
1078 - 1103 145.00 -17.90
2
miRNA  3' auUGGCUAAAGUCUACCACGAu 5'
            ||: || | :||||||| | 
Target 5' ttACT-ATGT-GGATGGTGGTa 3'
697 - 716 126.00 -11.90
3
miRNA  3' auuggcUAAAGUCUACCACGAu 5'
                | ||:| ||| |||| 
Target 5' gtttgtAATTTA-ATGCTGCTa 3'
1152 - 1172 123.00 -5.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29a-3p :: RET    [ Functional MTI ]
Validation Method
Article - Perbellini, R. Greco, S. Sarra-Ferraris, G. et al.
- Neuromuscular disorders : NMD, 2011
Myotonic Dystrophy Type-1 (DM1) is caused by the expansion of a CTG repeat with a peculiar pattern of multisystemic involvement affecting skeletal muscles, the heart, the eye, the central nervous system and the endocrine system. Since microRNA expression is disrupted in several myopathies, the expression of 24 candidate microRNAs was analyzed in skeletal muscle biopsies of 15 DM1 patients. Controls were constituted by biopsies without overt pathological features derived from 14 subjects with suspected neuromuscular disorder of undetermined nature. We found that miR-1 and miR-335 were up-regulated, whereas miR-29b and c, and miR-33 were down-regulated in DM1 biopsies compared to controls. We also found that the cellular distribution of muscle specific miR-1, miR-133b and miR-206 was severely altered in DM1 skeletal muscles. MicroRNA dysregulation was likely functionally relevant, since it impacted on the expression of the predicted miR-1, and miR-29 targets. The observed miRNA dysregulations and myslocalizations may contribute to DM1 pathogenetic mechanisms.
LinkOut: [PMID: 21169019]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
76 hsa-miR-29a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000682 CDK6 cyclin-dependent kinase 6 4 2
MIRT001196 RAN RAN, member RAS oncogene family 3 1
MIRT001766 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT003021 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 4
MIRT003027 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 3
MIRT003220 COL4A2 collagen, type IV, alpha 2 4 2
MIRT003221 COL4A1 collagen, type IV, alpha 1 4 1
MIRT003286 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 5 5
MIRT003291 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT003343 CD276 CD276 molecule 3 2
MIRT003607 SFRP2 secreted frizzled-related protein 2 4 1
MIRT003609 DKK1 dickkopf homolog 1 (Xenopus laevis) 4 1
MIRT003735 S100B S100 calcium binding protein B 3 1
MIRT003737 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 2 1
MIRT004021 GLUL glutamate-ammonia ligase 4 1
MIRT004044 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 5 1
MIRT004103 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 4 2
MIRT004420 TET1 tet oncogene 1 2 1
MIRT004564 KREMEN2 kringle containing transmembrane protein 2 4 1
MIRT004630 ZFP36 zinc finger protein 36, C3H type, homolog (mouse) 1 2
MIRT005521 FGG fibrinogen gamma chain 2 1
MIRT005531 FGA fibrinogen alpha chain 2 1
MIRT005532 FGB fibrinogen beta chain 2 1
MIRT005584 LPL lipoprotein lipase 4 1
MIRT005591 CPEB3 cytoplasmic polyadenylation element binding protein 3 3 1
MIRT005592 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 1
MIRT005668 ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 4 1
MIRT005675 ITGA11 integrin, alpha 11 4 1
MIRT005906 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT005907 DIABLO diablo homolog (Drosophila) 1 1
MIRT005908 RET ret proto-oncogene 1 1
MIRT005909 TRIM63 tripartite motif-containing 63 1 1
MIRT005910 TGFB3 transforming growth factor, beta 3 1 1
MIRT006111 SAPCD2 chromosome 9 open reading frame 140 3 1
MIRT006135 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 2
MIRT006175 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 5 3
MIRT006182 SERPINB9 serpin peptidase inhibitor, clade B (ovalbumin), member 9 4 1
MIRT006250 NASP nuclear autoantigenic sperm protein (histone-binding) 2 2
MIRT006379 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006380 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT006485 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 2 1
MIRT006490 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 3 1
MIRT006549 NAV3 neuron navigator 3 1 1
MIRT006551 PXDN peroxidasin homolog (Drosophila) 2 1
MIRT006552 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT006553 ITIH5 inter-alpha (globulin) inhibitor H5 1 1
MIRT006873 C1QTNF6 C1q and tumor necrosis factor related protein 6 1 1
MIRT007028 PTEN phosphatase and tensin homolog 1 2
MIRT007197 ABL1 c-abl oncogene 1, receptor tyrosine kinase 1 1
MIRT028683 COL3A1 collagen, type III, alpha 1 1 1
MIRT035539 HBP1 HMG-box transcription factor 1 1 1
MIRT049964 ZFP91 zinc finger protein 91 homolog (mouse) 1 1
MIRT049965 CYTB cytochrome b 1 1
MIRT049966 CCDC14 coiled-coil domain containing 14 1 1
MIRT049967 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT049968 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT049969 EIF3E eukaryotic translation initiation factor 3, subunit E 1 1
MIRT049970 POLD3 polymerase (DNA-directed), delta 3, accessory subunit 1 1
MIRT049971 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT049972 FAM133A family with sequence similarity 133, member A 1 1
MIRT049973 BCAP31 B-cell receptor-associated protein 31 1 1
MIRT049974 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT049975 RRAGC Ras-related GTP binding C 1 1
MIRT049976 GAREML family with sequence similarity 59, member B 1 1
MIRT049977 RPS4X ribosomal protein S4, X-linked 1 1
MIRT049978 SUV420H2 suppressor of variegation 4-20 homolog 2 (Drosophila) 1 1
MIRT049979 CCT4 chaperonin containing TCP1, subunit 4 (delta) 1 1
MIRT049980 SARS seryl-tRNA synthetase 1 1
MIRT049981 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT049982 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT049983 SP2 Sp2 transcription factor 1 1
MIRT049984 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT049985 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT049986 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT049987 FAM109B family with sequence similarity 109, member B 1 1
MIRT049988 PAN2 PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) 1 1