Accession ID: MIRT005918 [miRNA, hsa-miR-24-3p :: TGFB1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-24-1LinkOut: [miRBase ]
Synonyms MIR189, MIRN24-1, miR-24-1, miRNA24-1, MIR24-1
Description Homo sapiens miR-24-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-24-3p
Mature Sequence 44| UGGCUCAGUUCAGCAGGAACAG |65
Evidence Experimental
Experiments Cloned
Putative hsa-miR-24-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TGFB1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CED, DPD1, LAP, TGFB, TGFbeta
Description transforming growth factor, beta 1
Transcript NM_0006    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TGFB1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TGFB1
(miRNA target sites are highlighted)
>TGFB1|NM_0006|3'UTR
   1 TGAGGTCCCGCCCCGCCCCGCCCCGCCCCGGCAGGCCCGGCCCCACCCCGCCCCGCCCCCGCTGCCTTGCCCATGGGGGC
  81 TGTATTTAAGGACACCCGTGCCCCAAGCCCACCTGGGGCCCCATTAAAGATGGAGAGAGGACTGCGGAAAAAAAAAAAAA
 161 AAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaCAAGG---ACGACUUGACUCGGu 5'
            || ||    ||  | |||:| | 
Target 5' ccGTGCCCCAAGCCCACCTGGGGCc 3'
96 - 120 100.00 -13.70
2
miRNA  3' gacaaggacgacuugACUCggu 5'
                         ||||   
Target 5' ---------------TGAGgtc 3'
1 - 7 80.00 -5.50
3
miRNA  3' gacaaggacgaCUUGACUCggu 5'
                     |:|||| |   
Target 5' agatggagagaGGACTGCGgaa 3'
128 - 149 79.00 -6.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-24-3p :: TGFB1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions HTM
Location of target site 3'UTR
Tools used in this research MicroCosm , PicTar , TargetScan
Original Description (Extracted from the article) ... Our results showed that CMS induced the expression of several miRNAs in HTM cells and that one of them, miR-24, can contribute to the regulation of the levels of TGbF1induced by CMS in HTM cells. ...

- Luna, C. Li, G. Qiu, J. Epstein, D. L. et al., 2011, Journal of cellular physiology.

Article - Luna, C. Li, G. Qiu, J. Epstein, D. L. et al.
- Journal of cellular physiology, 2011
Cyclic mechanical stress (CMS) leads to alterations of cellular functions in the trabecular meshwork (TM), including the up-regulation of transforming growth factor beta 1 (TGFbeta1), that can potentially contribute to the pathogenesis of glaucoma. Although microRNAs (miRNAs) are known to play important roles in many biological functions, little is known about their potential involvement in the cellular responses elicited by mechanical stress. Here we analyzed changes in miRNA expression induced by CMS, and examined the possible role of miR-24 in the response of human TM cells to CMS. CMS induced the expression of miR-24 that led to the down regulation of the subtilisin-like proprotein convertase FURIN, which is known to play a major role in the processing of TGFbeta1. FURIN was confirmed as a novel target of miR-24 by 3' UTR luciferase assay and western blot. Overexpression of miR-24 resulted in a significant decrease in activated TGFbeta1. This effect was mimicked by down regulation of FURIN by siRNA. Conversely, inhibition of miR-24 expression with a specific antagomir led to a small but significant increase in TGFbeta1. Furthermore, the increase in active TGFbeta1 induced by CMS in HTM cells was prevented by miR-24. Altogether, our results suggest that miRNAs might contribute to the regulation of responses to CMS in TM cells. Specifically, miR-24 might play an important role in modulating the induction of TGFbeta1 mediated by CMS through direct targeting of FURIN. J. Cell. Physiol. 226: 1407-1414, 2011. (c) 2010 Wiley-Liss, Inc.
LinkOut: [PMID: 20945401]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
319 hsa-miR-24-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000116 FEN1 flap structure-specific endonuclease 1 5 1
MIRT000117 CDK4 cyclin-dependent kinase 4 5 1
MIRT000119 CCNA2 cyclin A2 5 1
MIRT000120 AURKB aurora kinase B 5 1
MIRT000121 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 5 1
MIRT000122 E2F2 E2F transcription factor 2 5 1
MIRT001773 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 2 2
MIRT002018 DHFR dihydrofolate reductase 5 3
MIRT002950 MAPK14 mitogen-activated protein kinase 14 2 1
MIRT003354 TRIB3 tribbles homolog 3 (Drosophila) 4 2
MIRT003355 HNF4A hepatocyte nuclear factor 4, alpha 5 2
MIRT003830 ACVR1B activin A receptor, type IB 3 2
MIRT003889 MLEC malectin 3 2
MIRT004362 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 4 1
MIRT004836 BRCA1 breast cancer 1, early onset 5 2
MIRT004837 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa 5 1
MIRT005063 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 6 5
MIRT005397 KHSRP KH-type splicing regulatory protein 2 2
MIRT005398 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 2 2
MIRT005766 DND1 dead end homolog 1 (zebrafish) 3 1
MIRT005918 TGFB1 transforming growth factor, beta 1 4 1
MIRT005919 FURIN furin (paired basic amino acid cleaving enzyme) 4 1
MIRT006507 FAF1 Fas (TNFRSF6) associated factor 1 2 1
MIRT007012 ZNF217 zinc finger protein 217 2 2
MIRT007215 ST7L suppression of tumorigenicity 7 like 3 1
MIRT030361 VRK1 vaccinia related kinase 1 1 1
MIRT030362 NOP56 NOP56 ribonucleoprotein homolog (yeast) 1 1
MIRT030363 TBPL1 TBP-like 1 1 1
MIRT030364 TNPO3 transportin 3 1 1
MIRT030365 SNRPB2 small nuclear ribonucleoprotein polypeptide B' 1 1
MIRT030366 DDHD2 DDHD domain containing 2 1 1
MIRT030367 THOP1 thimet oligopeptidase 1 1 1
MIRT030368 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT030369 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT030370 GNPAT glyceronephosphate O-acyltransferase 1 1
MIRT030371 METAP2 methionyl aminopeptidase 2 1 1
MIRT030372 KIAA0020 KIAA0020 1 1
MIRT030373 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT030374 URM1 ubiquitin related modifier 1 homolog (S. cerevisiae) 1 1
MIRT030375 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT030376 MED22 mediator complex subunit 22 1 1
MIRT030377 USP10 ubiquitin specific peptidase 10 1 1
MIRT030378 FKBP1B FK506 binding protein 1B, 12.6 kDa 1 1
MIRT030379 SCML1 sex comb on midleg-like 1 (Drosophila) 1 1
MIRT030380 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 2 1
MIRT030381 MCM10 minichromosome maintenance complex component 10 2 1
MIRT030382 TOP1 topoisomerase (DNA) I 2 1
MIRT030383 H2AFX H2A histone family, member X 4 2
MIRT030384 TOMM22 translocase of outer mitochondrial membrane 22 homolog (yeast) 1 1
MIRT030385 HBQ1 hemoglobin, theta 1 1 1
MIRT030386 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT030387 PSMD1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 1 1
MIRT030388 AUNIP chromosome 1 open reading frame 135 1 1
MIRT030389 NARF nuclear prelamin A recognition factor 1 1
MIRT030390 MALSU1 chromosome 7 open reading frame 30 1 1
MIRT030391 TCEA3 transcription elongation factor A (SII), 3 1 1
MIRT030392 ADRM1 adhesion regulating molecule 1 1 1
MIRT030393 AGFG1 ArfGAP with FG repeats 1 1 1
MIRT030394 ACD adrenocortical dysplasia homolog (mouse) 1 1
MIRT030395 RCE1 RCE1 homolog, prenyl protein peptidase (S. cerevisiae) 1 1
MIRT030396 SUMO3 SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) 1 1
MIRT030397 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT030398 C18orf56 chromosome 18 open reading frame 56 1 1
MIRT030399 MIS18A chromosome 21 open reading frame 45 1 1
MIRT030400 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT030401 NAE1 NEDD8 activating enzyme E1 subunit 1 1 1
MIRT030402 ACTL6A actin-like 6A 1 1
MIRT030403 NCBP2 nuclear cap binding protein subunit 2, 20kDa 1 1
MIRT030404 SLC29A4 solute carrier family 29 (nucleoside transporters), member 4 1 1
MIRT030405 PHF16 PHD finger protein 16 1 1
MIRT030406 GYG2 glycogenin 2 1 1
MIRT030407 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT030408 EXOSC8 exosome component 8 1 1
MIRT030409 TDRP chromosome 8 open reading frame 42 1 1
MIRT030410 R3HDM4 chromosome 19 open reading frame 22 1 1
MIRT030411 DCAF4 DDB1 and CUL4 associated factor 4 1 1
MIRT030412 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT030413 VPS25 vacuolar protein sorting 25 homolog (S. cerevisiae) 1 1
MIRT030414 NR0B2 nuclear receptor subfamily 0, group B, member 2 1 1
MIRT030415 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT030416 STRADB STE20-related kinase adaptor beta 1 1
MIRT030417 MTF2 metal response element binding transcription factor 2 1 1
MIRT030418 PHOSPHO2 phosphatase, orphan 2 1 1
MIRT030419 ATAD3A ATPase family, AAA domain containing 3A 1 1
MIRT030420 CCDC59 coiled-coil domain containing 59 1 1
MIRT030421 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT030422 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT030423 CIRBP cold inducible RNA binding protein 1 1
MIRT030424 S100P S100 calcium binding protein P 1 1
MIRT030425 ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7 1 1
MIRT030426 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT030427 PDLIM7 PDZ and LIM domain 7 (enigma) 1 1
MIRT030428 KIAA0100 KIAA0100 1 1
MIRT030429 TOMM34 translocase of outer mitochondrial membrane 34 1 1
MIRT030430 CTCF CCCTC-binding factor (zinc finger protein) 1 1
MIRT030431 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT030432 SLC52A2 G protein-coupled receptor 172A 1 1
MIRT030433 KHNYN KH and NYN domain containing 1 1
MIRT030434 ADD1 adducin 1 (alpha) 1 1
MIRT030435 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT030436 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT030437 SULT2A1 sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 1 1
MIRT030438 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT030439 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT030440 CARD10 caspase recruitment domain family, member 10 1 1
MIRT030441 PPM1F protein phosphatase, Mg2+/Mn2+ dependent, 1F 1 1
MIRT030442 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT030443 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT030444 FNTB farnesyltransferase, CAAX box, beta 1 1
MIRT030445 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 2 2
MIRT030446 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT030447 BCL2L2 BCL2-like 2 1 1
MIRT030448 PSTPIP2 proline-serine-threonine phosphatase interacting protein 2 1 1
MIRT030449 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT030450 MATR3 matrin 3 1 1
MIRT030451 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT030452 TSPAN14 tetraspanin 14 1 1
MIRT030453 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT030454 MIDN midnolin 1 1
MIRT030455 CCDC58 coiled-coil domain containing 58 1 1
MIRT030456 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT030457 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT030458 ZNF813 zinc finger protein 813 1 1
MIRT030459 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT030460 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT030461 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT030462 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT030463 DNAJB12 DnaJ (Hsp40) homolog, subfamily B, member 12 1 1
MIRT030464 NUP54 nucleoporin 54kDa 2 2
MIRT030465 SESN1 sestrin 1 2 2
MIRT030466 SLC35B2 solute carrier family 35, member B2 2 2
MIRT030467 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 2 2
MIRT030468 UBD ubiquitin D 2 1
MIRT030469 RRM2 ribonucleotide reductase M2 2 1
MIRT030470 BCL2L12 BCL2-like 12 (proline rich) 2 1
MIRT030471 MBD6 methyl-CpG binding domain protein 6 2 1
MIRT030472 OXSR1 oxidative-stress responsive 1 1 1
MIRT030473 PER2 period homolog 2 (Drosophila) 2 1
MIRT030474 UNG uracil-DNA glycosylase 1 1
MIRT030475 RRP12 ribosomal RNA processing 12 homolog (S. cerevisiae) 1 1
MIRT030476 CWC27 CWC27 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT030477 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 1
MIRT030478 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT030479 EXOSC3 exosome component 3 1 1
MIRT030480 ALG5 asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) 1 1
MIRT030481 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT030482 MRPS24 mitochondrial ribosomal protein S24 1 1
MIRT030483 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT030484 GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa 1 1
MIRT030485 FAH fumarylacetoacetate hydrolase (fumarylacetoacetase) 1 1
MIRT030486 ARL1 ADP-ribosylation factor-like 1 1 1
MIRT030487 MED16 mediator complex subunit 16 1 1
MIRT030488 MED24 mediator complex subunit 24 1 1
MIRT030489 CCAR1 cell division cycle and apoptosis regulator 1 1 1
MIRT030490 DUS1L dihydrouridine synthase 1-like (S. cerevisiae) 1 1
MIRT030491 BEX1 brain expressed, X-linked 1 1 1
MIRT030492 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT030493 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT030494 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT030495 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT030496 UBE3A ubiquitin protein ligase E3A 1 1
MIRT030497 TYW3 tRNA-yW synthesizing protein 3 homolog (S. cerevisiae) 1 1
MIRT030498 UQCC ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT030499 NKD1 naked cuticle homolog 1 (Drosophila) 1 1
MIRT030500 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 1 1
MIRT030501 AK3 adenylate kinase 3 1 1
MIRT030502 NSA2 NSA2 ribosome biogenesis homolog (S. cerevisiae) 1 1
MIRT030503 CDK1 cyclin-dependent kinase 1 5 1
MIRT030504 HSF2 heat shock transcription factor 2 1 1
MIRT030505 CDCA7 cell division cycle associated 7 1 1
MIRT030506 NCOA6 nuclear receptor coactivator 6 1 1
MIRT030507 TNIP2 TNFAIP3 interacting protein 2 1 1
MIRT030508 AKAP7 A kinase (PRKA) anchor protein 7 1 1
MIRT030509 TUBGCP2 tubulin, gamma complex associated protein 2 1 1
MIRT030510 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT030511 FBXO34 F-box protein 34 1 1
MIRT030512 STK35 serine/threonine kinase 35 1 1
MIRT030513 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT030514 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT030515 ZDHHC3 zinc finger, DHHC-type containing 3 1 1
MIRT030516 IQCB1 IQ motif containing B1 1 1
MIRT030517 RHOT2 ras homolog gene family, member T2 1 1
MIRT030518 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 1 1
MIRT030519 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT030520 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT030521 GBAS glioblastoma amplified sequence 1 1
MIRT030522 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 1
MIRT030523 NEK6 NIMA (never in mitosis gene a)-related kinase 6 1 1
MIRT030524 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT030525 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT030526 ADPGK ADP-dependent glucokinase 1 1
MIRT030527 DSCR3 Down syndrome critical region gene 3 1 1
MIRT030528 FZD4 frizzled homolog 4 (Drosophila) 1 1
MIRT030529 AAMP angio-associated, migratory cell protein 1 1
MIRT030530 PLIN3 perilipin 3 1 1
MIRT030531 LLGL1 lethal giant larvae homolog 1 (Drosophila) 1 1
MIRT030532 KLHDC3 kelch domain containing 3 1 1
MIRT030533 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT030534 MARCKSL1 MARCKS-like 1 1 1
MIRT030535 C1orf106 chromosome 1 open reading frame 106 1 1
MIRT030536 ADD3 adducin 3 (gamma) 1 1
MIRT030537 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 1
MIRT030538 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT030539 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT030540 GLUL glutamate-ammonia ligase 1 1
MIRT030541 TMEM209 transmembrane protein 209 1 1
MIRT030542 LBR lamin B receptor 1 1
MIRT030543 LIMD1 LIM domains containing 1 1 1
MIRT030544 SPIN4 spindlin family, member 4 1 1
MIRT030545 ZNF264 zinc finger protein 264 1 1
MIRT030546 VGLL3 vestigial like 3 (Drosophila) 1 1
MIRT030547 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT030548 DEDD death effector domain containing 1 1
MIRT030549 CD34 CD34 molecule 1 1
MIRT030550 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT030551 E2F3 E2F transcription factor 3 2 1
MIRT030552 ZNF317 zinc finger protein 317 2 1
MIRT030553 STX16 syntaxin 16 2 1
MIRT030554 DHFRP1 dihydrofolate reductase pseudogene 1 1 1
MIRT030555 CHEK1 CHK1 checkpoint homolog (S. pombe) 4 1
MIRT030556 NOTUM notum pectinacetylesterase homolog (Drosophila) 1 1
MIRT030557 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT030558 CCL2 chemokine (C-C motif) ligand 2 1 1
MIRT030559 OARD1 chromosome 6 open reading frame 130 1 1
MIRT030560 PCGF6 polycomb group ring finger 6 1 1
MIRT030561 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT030562 CTDSP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 1 1
MIRT030563 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT030564 RNF144A ring finger protein 144A 1 1
MIRT030565 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT030566 C15orf57 chromosome 15 open reading frame 57 1 1
MIRT030567 COMMD9 COMM domain containing 9 1 1
MIRT030568 SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 1 1
MIRT030569 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT030570 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT030571 OGFR opioid growth factor receptor 1 1
MIRT030572 ALG1 asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT030573 PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) 1 1
MIRT030574 SERGEF secretion regulating guanine nucleotide exchange factor 1 1
MIRT030575 ANPEP alanyl (membrane) aminopeptidase 1 1
MIRT030576 ITFG3 integrin alpha FG-GAP repeat containing 3 1 1
MIRT030577 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT030578 PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 1 1
MIRT030579 AP5M1 MU-2/AP1M2 domain containing, death-inducing 1 1
MIRT030580 HMGB2 high-mobility group box 2 1 1
MIRT030581 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT030582 CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa 1 1
MIRT030583 FOXQ1 forkhead box Q1 1 1
MIRT030584 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT030585 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT030586 ZMYND19 zinc finger, MYND-type containing 19 1 1
MIRT030587 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT030588 CCNB1 cyclin B1 1 1
MIRT030589 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 1 1
MIRT030590 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like 1 1
MIRT030591 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT030592 LAMTOR3 MAPK scaffold protein 1 1 1
MIRT030593 MRPL27 mitochondrial ribosomal protein L27 1 1
MIRT030594 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 1 1
MIRT030595 DSC2 desmocollin 2 1 1
MIRT030596 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT030597 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT030598 KIAA0195 KIAA0195 1 1
MIRT030599 KIAA1967 KIAA1967 1 1
MIRT030600 HIC2 hypermethylated in cancer 2 1 1
MIRT030601 DTL denticleless homolog (Drosophila) 1 1
MIRT030602 NUBPL nucleotide binding protein-like 1 1
MIRT030603 GMFB glia maturation factor, beta 1 1
MIRT030604 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT030605 CMTM3 CKLF-like MARVEL transmembrane domain containing 3 1 1
MIRT030606 CSK c-src tyrosine kinase 1 1
MIRT030607 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT030608 MRPS22 mitochondrial ribosomal protein S22 1 1
MIRT030609 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT030610 NET1 neuroepithelial cell transforming 1 1 1
MIRT030611 GUCD1 chromosome 22 open reading frame 13 1 1
MIRT030612 RALA v-ral simian leukemia viral oncogene homolog A (ras related) 1 1
MIRT030613 AK4 adenylate kinase 4 1 1
MIRT030614 KCNJ14 potassium inwardly-rectifying channel, subfamily J, member 14 1 1
MIRT030615 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT030616 BRD8 bromodomain containing 8 1 1
MIRT030617 PIM2 pim-2 oncogene 1 1
MIRT030618 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT030619 HDAC1 histone deacetylase 1 1 1
MIRT030620 WRB tryptophan rich basic protein 1 1
MIRT030621 TMEM194A transmembrane protein 194A 1 1
MIRT030622 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT030623 RNF11 ring finger protein 11 1 1
MIRT030624 RNF2 ring finger protein 2 1 1
MIRT030625 FZD5 frizzled homolog 5 (Drosophila) 1 1
MIRT030626 E2F1 E2F transcription factor 1 1 1
MIRT030627 CORO1A coronin, actin binding protein, 1A 1 1
MIRT030628 UBC ubiquitin C 1 1
MIRT030629 MCM4 minichromosome maintenance complex component 4 2 1
MIRT030630 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 2 2
MIRT030631 PCNA proliferating cell nuclear antigen 3 1
MIRT035526 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT035527 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT035542 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT035543 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT050365 RPS7 ribosomal protein S7 1 1
MIRT050366 EXOSC1 exosome component 1 1 1
MIRT050367 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT050368 RANBP1 RAN binding protein 1 1 1
MIRT050369 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT050370 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT050371 RPS16 ribosomal protein S16 1 1
MIRT050372 DEPDC1 DEP domain containing 1 1 1
MIRT050373 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 1 1
MIRT050374 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT050375 SNX12 sorting nexin 12 1 1
MIRT050376 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT050377 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT050378 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050379 CCNG1 cyclin G1 1 1
MIRT050380 IKBKAP inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein 1 1
MIRT050381 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT050382 GCLM glutamate-cysteine ligase, modifier subunit 1 1
MIRT050383 DCAF10 DDB1 and CUL4 associated factor 10 1 1