Accession ID: MIRT005971 [miRNA, hsa-miR-30c-5p :: SERPINE1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30c-2LinkOut: [miRBase ]
Synonyms MIRN30C2, MIR30C2
Description Homo sapiens miR-30c-2 stem-loop
Comment miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30c-5p
Mature Sequence 7| UGUAAACAUCCUACACUCUCAGC |29
Evidence Experimental
Experiments Cloned
Putative hsa-miR-30c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SERPINE1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PAI, PAI-1, PAI1, PLANH1
Description serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0011654   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SERPINE1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SERPINE1
(miRNA target sites are highlighted)
>SERPINE1|NM_0006|3'UTR
   1 TGACCCTGGGGAAAGACGCCTTCATCTGGGACAAAACTGGAGATGCATCGGGAAAGAAGAAACTCCGAAGAAAAGAATTT
  81 TAGTGTTAATGACTCTTTCTGAAGGAAGAGAAGACATTTGCCTTTTGTTAAAAGATGGTAAACCAGATCTGTCTCCAAGA
 161 CCTTGGCCTCTCCTTGGAGGACCTTTAGGTCAAACTCCCTAGTCTCCACCTGAGACCCTGGGAGAGAAGTTTGAAGCACA
 241 ACTCCCTTAAGGTCTCCAAACCAGACGGTGACGCCTGCGGGACCATCTGGGGCACCTGCTTCCACCCGTCTCTCTGCCCA
 321 CTCGGGTCTGCAGACCTGGTTCCCACTGAGGCCCTTTGCAGGATGGAACTACGGGGCTTACAGGAGCTTTTGTGTGCCTG
 401 GTAGAAACTATTTCTGTTCCAGTCACATTGCCATCACTCTTGTACTGCCTGCCACCGCGGAGGAGGCTGGTGACAGGCCA
 481 AAGGCCAGTGGAAGAAACACCCTTTCATCTCAGAGTCCACTGTGGCACTGGCCACCCCTCCCCAGTACAGGGGTGCTGCA
 561 GGTGGCAGAGTGAATGTCCCCCATCATGTGGCCCAACTCTCCTGGCCTGGCCATCTCCCTCCCCAGAAACAGTGTGCATG
 641 GGTTATTTTGGAGTGTAGGTGACTTGTTTACTCATTGAAGCAGATTTCTGCTTCCTTTTATTTTTATAGGAATAGAGGAA
 721 GAAATGTCAGATGCGTGCCCAGCTCTTCACCCCCCAATCTCTTGGTGGGGAGGGGTGTACCTAAATATTTATCATATCCT
 801 TGCCCTTGAGTGCTTGTTAGAGAGAAAGAGAACTACTAAGGAAAATAATATTATTTAAACTCGCTCCTAGTGTTTCTTTG
 881 TGGTCTGTGTCACCGTATCTCAGGAAGTCCAGCCACTTGACTGGCACACACCCCTCCGGACATCCAGCGTGACGGAGCCC
 961 ACACTGCCACCTTGTGGCCGCCTGAGACCCTCGCGCCCCCCGCGCCCCTCTTTTTCCCCTTGATGGAAATTGACCATACA
1041 ATTTCATCCTCCTTCAGGGGATCAAAAGGACGGAGTGGGGGGACAGAGACTCAGATGAGGACAGAGTGGTTTCCAATGTG
1121 TTCAATAGATTTAGGAGCAGAAATGCAAGGGGCTGCATGACCTACCAGGACAGAACTTTCCCCAATTACAGGGTGACTCA
1201 CAGCCGCATTGGTGACTCACTTCAATGTGTCATTTCCGGCTGCTGTGTGTGAGCAGTGGACACGTGAGGGGGGGGTGGGT
1281 GAGAGAGACAGGCAGCTCGGATTCAACTACCTTAGATAATATTTCTGAAAACCTACCAGCCAGAGGGTAGGGCACAAAGA
1361 TGGATGTAATGCACTTTGGGAGGCCAAGGCGGGAGGATTGCTTGAGCCCAGGAGTTCAAGACCAGCCTGGGCAACATACC
1441 AAGACCCCCGTCTCTTTAAAAATATATATATTTTAAATATACTTAAATATATATTTCTAATATCTTTAAATATATATATA
1521 TATTTTAAAGACCAATTTATGGGAGAATTGCACACAGATGTGAAATGAATGTAATCTAATAGAAGCCTAATCAGCCCACC
1601 ATGTTCTCCACTGAAAAATCCTCTTTCTTTGGGGTTTTTCTTTCTTTCTTTTTTGATTTTGCACTGGACGGTGACGTCAG
1681 CCATGTACAGGATCCACAGGGGTGGTGTCAAATGCTATTGAAATTGTGTTGAATTGTATGCTTTTTCACTTTTGATAAAT
1761 AAACATGTAAAAATGTTTCAAAAAAATAATAAAATAAATAAATACGAAGAATATGTCAGGACAGTCAAAAAAAAAAAAAA
1841 AAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgACUCUCACAUC--CU--ACAAAUGu 5'
            | :||||||||  ||  ||||||| 
Target 5' ttTTGGAGTGTAGGTGACTTGTTTACt 3'
646 - 672 173.00 -21.70
2
miRNA  3' cgACUCU--CACAUCCU-ACAAAUGu 5'
            ||| |  |||| | | ||| |:| 
Target 5' atTGAAATTGTGTTGAATTGTATGCt 3'
1717 - 1742 115.00 -7.10
3
miRNA  3' cgaCU-CUCACAU---CCUACAAAUGu 5'
             || |:|||||     || ||||: 
Target 5' gggGAGGGGTGTACCTAAATATTTATc 3'
767 - 793 112.00 -9.73
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30c-5p :: SERPINE1    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions HPMVEC
Location of target site 3'UTR
Tools used in this research MicroCosm
Original Description (Extracted from the article) ... Our results show reduced expression of miR-30c and miR-301a, but not of miR-99a in response to PlGF, which have evolutionarily conserved binding sites in the 3'-untranslated region (3'UTR) of PAI-1 mRNA. Luciferase reporter assays using wild-type and mutant 3’UTR constructs confirmed that PAI-1-3’UTR is indeed a direct target of miR-30c and miR-301a. ...

- Patel, N. Tahara, S. M. Malik, P. Kalra, V. K., 2011, The Biochemical journal.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cgACUCUCACAUC--CU--ACAAAUGu 5'
            | :||||||||  ||  ||||||| 
Target 5' ttTTGGAGTGTAGGTGACTTGTTTACt 3'
1 - 27
Article - Patel, N. Tahara, S. M. Malik, P. Kalra, V. K.
- The Biochemical journal, 2011
PAI-1 (plasminogen activator inhibitor-1) is a key physiological inhibitor of fibrinolysis. Previously, we have reported PlGF (placental growth factor)-mediated transcriptional up-regulation of PAI-1 (SERPINE1) mRNA expression via activation of HIF-1alpha (hypoxia-inducible factor-1alpha) and AP-1 (activator protein-1) in HPMVECs (human pulmonary microvascular endothelial cells), which resulted in elevated PAI-1 in humans with SCA (sickle cell anaemia). In the present study, we have identified the role of post-transcriptional mechanism(s) of PlGF-mediated accumulation of PAI-1 mRNA in HPMVECs by examining the role of microRNAs (miRNAs/miRs) in PlGF-induced PAI-1 mRNA stability. Our results show reduced expression of miR-30c and miR-301a, but not of miR-99a, in response to PlGF, which have evolutionarily conserved binding sites in the 3'-UTR (3'-untranslated region) of PAI-1 mRNA. Transfection of anti-miR-30c or anti-miR-301a oligonucleotides resulted in increased PAI-1 mRNA levels, which were increased further with PlGF stimulation. Conversely, overexpression of pre-miR-30c or pre-miR-301a resulted in an attenuation of PlGF-induced PAI-1 mRNA and protein levels. Luciferase reporter assays using wild-type and mutant 3'-UTR constructs confirmed that the PAI-1 3'-UTR is indeed a direct target of miR-30c and miR-301a. Finally, plasma levels of miR-30c and miR-301a were significantly down-regulated in patients with SCA compared with normal controls. These results provide a post-transcriptional regulatory mechanism of PlGF-induced PAI-1 elevation.
LinkOut: [PMID: 21175428]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
213 hsa-miR-30c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004714 MUC17 mucin 17, cell surface associated 3 1
MIRT005090 UBE2I ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) 4 1
MIRT005971 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT006321 SMAD1 SMAD family member 1 2 1
MIRT006607 Snai1 snail homolog 1 (Drosophila) 1 1
MIRT006762 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT007050 HSPA4 heat shock 70kDa protein 4 2 1
MIRT007108 TGIF2 TGFB-induced factor homeobox 2 2 1
MIRT007109 HDAC4 histone deacetylase 4 2 1
MIRT007129 SOCS3 suppressor of cytokine signaling 3 1 1
MIRT007130 CUL2 cullin 2 1 1
MIRT007131 NEDD4 neural precursor cell expressed, developmentally down-regulated 4 1 1
MIRT007132 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT007133 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT007134 ARHGEF6 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 1 1
MIRT007135 ITGA4 integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) 1 1
MIRT007136 PIK3R2 phosphoinositide-3-kinase, regulatory subunit 2 (beta) 1 1
MIRT007202 VIM vimentin 1 1
MIRT007203 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 1
MIRT047829 HMG20A high-mobility group 20A 1 1
MIRT047830 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT047831 KCTD3 potassium channel tetramerisation domain containing 3 1 1
MIRT047832 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT047833 TRA2A transformer 2 alpha homolog (Drosophila) 1 1
MIRT047834 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT047835 NDNL2 necdin-like 2 1 1
MIRT047836 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 1 1
MIRT047837 SCN11A sodium channel, voltage-gated, type XI, alpha subunit 1 1
MIRT047838 E2F3 E2F transcription factor 3 1 1
MIRT047839 UBXN1 UBX domain protein 1 1 1
MIRT047840 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT047841 PAM peptidylglycine alpha-amidating monooxygenase 1 1
MIRT047842 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT047843 UBE3C ubiquitin protein ligase E3C 1 1
MIRT047844 MED1 mediator complex subunit 1 1 1
MIRT047845 TTC19 tetratricopeptide repeat domain 19 1 1
MIRT047846 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT047847 PNKD paroxysmal nonkinesigenic dyskinesia 1 1
MIRT047848 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT047849 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT047850 RTN4 reticulon 4 1 1
MIRT047851 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT047852 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT047853 CPOX coproporphyrinogen oxidase 1 1
MIRT047854 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT047855 IKZF4 IKAROS family zinc finger 4 (Eos) 1 1
MIRT047856 SLC25A12 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 1 1
MIRT047857 LACTB2 lactamase, beta 2 1 1
MIRT047858 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT047859 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 1
MIRT047860 CSF1 colony stimulating factor 1 (macrophage) 1 1
MIRT047861 CAPZA1 capping protein (actin filament) muscle Z-line, alpha 1 1 1
MIRT047862 UBE2D2 ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) 1 1
MIRT047863 GDI2 GDP dissociation inhibitor 2 1 1
MIRT047864 LIMA1 LIM domain and actin binding 1 1 1
MIRT047865 PKM pyruvate kinase, muscle 1 1
MIRT047866 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT047867 CEP152 centrosomal protein 152kDa 1 1
MIRT047868 GTF3C3 general transcription factor IIIC, polypeptide 3, 102kDa 1 1
MIRT047869 OTP orthopedia homeobox 1 1
MIRT047870 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT047871 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT047872 MGEA5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT047873 HUS1 HUS1 checkpoint homolog (S. pombe) 1 1
MIRT047874 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 1 1
MIRT047875 ABI2 abl-interactor 2 1 1
MIRT047876 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT047877 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 1
MIRT047878 RPL39 ribosomal protein L39 1 1
MIRT047879 TMEM120B transmembrane protein 120B 1 1
MIRT047880 MGLL monoglyceride lipase 1 1
MIRT047881 CASC4 cancer susceptibility candidate 4 1 1
MIRT047882 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT047883 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT047884 SNX2 sorting nexin 2 1 1
MIRT047885 MGAT2 mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase 1 1
MIRT047886 DNAJB14 DnaJ (Hsp40) homolog, subfamily B, member 14 1 1
MIRT047887 RRM2 ribonucleotide reductase M2 1 1
MIRT047888 PARVG parvin, gamma 1 1
MIRT047889 BLMH bleomycin hydrolase 1 1
MIRT047890 HERC4 hect domain and RLD 4 1 1
MIRT047891 ARF1 ADP-ribosylation factor 1 1 1
MIRT047892 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT047893 SOX4 SRY (sex determining region Y)-box 4 1 1
MIRT047894 PPP1R12A protein phosphatase 1, regulatory (inhibitor) subunit 12A 1 1
MIRT047895 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT047896 AIFM1 apoptosis-inducing factor, mitochondrion-associated, 1 1 1
MIRT047897 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT047898 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT047899 ZNF506 zinc finger protein 506 1 1
MIRT047900 STARD7 StAR-related lipid transfer (START) domain containing 7 1 1
MIRT047901 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT047902 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT047903 PRCP prolylcarboxypeptidase (angiotensinase C) 1 1
MIRT047904 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT047905 ZNF668 zinc finger protein 668 1 1
MIRT047906 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047907 MXI1 MAX interactor 1 1 1
MIRT047908 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 1 1
MIRT047909 CTSC cathepsin C 1 1
MIRT047910 RPL27A ribosomal protein L27a 1 1
MIRT047911 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT047912 RPS3 ribosomal protein S3 1 1
MIRT047913 TKT transketolase 1 1
MIRT047914 MATR3 matrin 3 1 1
MIRT047915 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT047916 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 1 1
MIRT047917 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT047918 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT047919 UXT ubiquitously-expressed transcript 1 1
MIRT047920 HMGA1 high mobility group AT-hook 1 1 1
MIRT047921 CSNK1E casein kinase 1, epsilon 1 1
MIRT047922 USP37 ubiquitin specific peptidase 37 1 1
MIRT047923 MTPAP mitochondrial poly(A) polymerase 1 1
MIRT047924 APLN apelin 1 1
MIRT047925 IPO9 importin 9 1 1
MIRT047926 RBM3 RNA binding motif (RNP1, RRM) protein 3 1 1
MIRT047927 JUP junction plakoglobin 1 1
MIRT047928 DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase 1 1
MIRT047929 PFN1 profilin 1 1 1
MIRT047930 ARFGAP1 ADP-ribosylation factor GTPase activating protein 1 1 1
MIRT047931 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 1
MIRT047932 PPM1H protein phosphatase, Mg2+/Mn2+ dependent, 1H 1 1
MIRT047933 CCDC117 coiled-coil domain containing 117 1 1
MIRT047934 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT047935 HMGXB4 HMG box domain containing 4 1 1
MIRT047936 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 1 1
MIRT047937 NFYB nuclear transcription factor Y, beta 1 1
MIRT047938 RPL32 ribosomal protein L32 1 1
MIRT047939 SLC39A1 solute carrier family 39 (zinc transporter), member 1 1 1
MIRT047940 BIRC5 baculoviral IAP repeat-containing 5 1 1
MIRT047941 WDR5 WD repeat domain 5 1 1
MIRT047942 DDB1 damage-specific DNA binding protein 1, 127kDa 1 1
MIRT047943 SNRNP40 small nuclear ribonucleoprotein 40kDa (U5) 1 1
MIRT047944 KLC2 kinesin light chain 2 1 1
MIRT047945 MTCH2 mitochondrial carrier homolog 2 (C. elegans) 1 1
MIRT047946 STARD5 StAR-related lipid transfer (START) domain containing 5 1 1
MIRT047947 RAPGEFL1 Rap guanine nucleotide exchange factor (GEF)-like 1 1 1
MIRT047948 EP300 E1A binding protein p300 1 1
MIRT047949 CFL2 cofilin 2 (muscle) 1 1
MIRT047950 SDF2L1 stromal cell-derived factor 2-like 1 1 1
MIRT047951 LYRM2 LYR motif containing 2 1 1
MIRT047952 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT047953 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT047954 ZNF687 zinc finger protein 687 1 1
MIRT047955 ESYT1 extended synaptotagmin-like protein 1 1 1
MIRT047956 SHFM1 split hand/foot malformation (ectrodactyly) type 1 1 1
MIRT047957 ZNF829 zinc finger protein 829 1 1
MIRT047958 TMEM14E transmembrane protein 14E 1 1
MIRT047959 LLPH LLP homolog, long-term synaptic facilitation (Aplysia) 1 1
MIRT047960 HMGN2 high-mobility group nucleosomal binding domain 2 1 1
MIRT047961 MARK4 MAP/microtubule affinity-regulating kinase 4 1 1
MIRT047962 CKAP4 cytoskeleton-associated protein 4 1 1
MIRT047963 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT047964 KLHL42 kelch domain containing 5 1 1
MIRT047965 ARF3 ADP-ribosylation factor 3 1 1
MIRT047966 YTHDC2 YTH domain containing 2 1 1
MIRT047967 LIN9 lin-9 homolog (C. elegans) 1 1
MIRT047968 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT047969 SLC25A38 solute carrier family 25, member 38 1 1
MIRT047970 MED13 mediator complex subunit 13 1 1
MIRT047971 ZNF780B zinc finger protein 780B 1 1
MIRT047972 MTDH metadherin 1 1
MIRT047973 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 1 1
MIRT047974 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT047975 ERLIN1 ER lipid raft associated 1 1 1
MIRT047976 CADPS2 Ca++-dependent secretion activator 2 1 1
MIRT047977 SIAH2 seven in absentia homolog 2 (Drosophila) 1 1
MIRT047978 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT047979 RBM14 RNA binding motif protein 14 1 1
MIRT047980 RPS27A ribosomal protein S27a 1 1
MIRT047981 ERLIN2 ER lipid raft associated 2 1 1
MIRT047982 RNF34 ring finger protein 34 1 1
MIRT047983 RPS12 ribosomal protein S12 1 1
MIRT047984 TMCO3 transmembrane and coiled-coil domains 3 1 1
MIRT047985 GZF1 GDNF-inducible zinc finger protein 1 1 1
MIRT047986 ARCN1 archain 1 1 1
MIRT047987 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 1 1
MIRT047988 CBY1 chibby homolog 1 (Drosophila) 1 1
MIRT047989 POLQ polymerase (DNA directed), theta 1 1
MIRT047990 POU2F1 POU class 2 homeobox 1 1 1
MIRT047991 PLCB1 phospholipase C, beta 1 (phosphoinositide-specific) 1 1
MIRT047992 SDE2 chromosome 1 open reading frame 55 1 1
MIRT047993 ERI1 exoribonuclease 1 1 1
MIRT047994 FAM134C family with sequence similarity 134, member C 1 1
MIRT047995 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047996 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 1 1
MIRT047997 ARHGEF12 Rho guanine nucleotide exchange factor (GEF) 12 1 1
MIRT047998 DIS3 DIS3 mitotic control homolog (S. cerevisiae) 1 1
MIRT047999 OTUD7A OTU domain containing 7A 1 1
MIRT048000 MRPL38 mitochondrial ribosomal protein L38 1 1
MIRT048001 C1QBP complement component 1, q subcomponent binding protein 1 1
MIRT048002 NUDT11 nudix (nucleoside diphosphate linked moiety X)-type motif 11 1 1
MIRT048003 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT048004 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3 1 1
MIRT048005 ZNF146 zinc finger protein 146 1 1
MIRT048006 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT048007 BCCIP BRCA2 and CDKN1A interacting protein 1 1
MIRT048008 ARHGAP44 Rho-type GTPase-activating protein RICH2 1 1
MIRT048009 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT048010 HSPH1 heat shock 105kDa/110kDa protein 1 1 1
MIRT048011 UBE2NL ubiquitin-conjugating enzyme E2N-like 1 1
MIRT048012 HPRT1 hypoxanthine phosphoribosyltransferase 1 1 1
MIRT048013 EIF2A eukaryotic translation initiation factor 2A, 65kDa 1 1
MIRT048014 DLC1 deleted in liver cancer 1 1 1
MIRT048015 SNAPC4 small nuclear RNA activating complex, polypeptide 4, 190kDa 1 1
MIRT048016 BLOC1S4 cappuccino homolog (mouse) 1 1
MIRT048017 UQCRC1 ubiquinol-cytochrome c reductase core protein I 1 1
MIRT048018 EED embryonic ectoderm development 1 1
MIRT048019 ELOVL4 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 1 1
MIRT048020 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT048021 C16orf70 chromosome 16 open reading frame 70 1 1
MIRT048022 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 1