Accession ID: MIRT005971 [miRNA, hsa-miR-30c-5p :: SERPINE1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30c-2LinkOut: [miRBase ]
Synonyms MIRN30C2, MIR30C2
Description Homo sapiens miR-30c-2 stem-loop
Comment miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30c-5p
Mature Sequence 7| UGUAAACAUCCUACACUCUCAGC |29
Evidence Experimental
Experiments Cloned
Putative hsa-miR-30c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SERPINE1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PAI, PAI-1, PAI1, PLANH1
Description serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
Transcript NM_000602    LinkOut: [ RefSeq ]
Other Transcripts NM_001165413   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SERPINE1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SERPINE1
(miRNA target sites are highlighted)
>SERPINE1|NM_000602|3'UTR
   1 CCCTGGGGAAAGACGCCTTCATCTGGGACAAAACTGGAGATGCATCGGGAAAGAAGAAACTCCGAAGAAAAGAATTTTAG
  81 TGTTAATGACTCTTTCTGAAGGAAGAGAAGACATTTGCCTTTTGTTAAAAGATGGTAAACCAGATCTGTCTCCAAGACCT
 161 TGGCCTCTCCTTGGAGGACCTTTAGGTCAAACTCCCTAGTCTCCACCTGAGACCCTGGGAGAGAAGTTTGAAGCACAACT
 241 CCCTTAAGGTCTCCAAACCAGACGGTGACGCCTGCGGGACCATCTGGGGCACCTGCTTCCACCCGTCTCTCTGCCCACTC
 321 GGGTCTGCAGACCTGGTTCCCACTGAGGCCCTTTGCAGGATGGAACTACGGGGCTTACAGGAGCTTTTGTGTGCCTGGTA
 401 GAAACTATTTCTGTTCCAGTCACATTGCCATCACTCTTGTACTGCCTGCCACCGCGGAGGAGGCTGGTGACAGGCCAAAG
 481 GCCAGTGGAAGAAACACCCTTTCATCTCAGAGTCCACTGTGGCACTGGCCACCCCTCCCCAGTACAGGGGTGCTGCAGGT
 561 GGCAGAGTGAATGTCCCCCATCATGTGGCCCAACTCTCCTGGCCTGGCCATCTCCCTCCCCAGAAACAGTGTGCATGGGT
 641 TATTTTGGAGTGTAGGTGACTTGTTTACTCATTGAAGCAGATTTCTGCTTCCTTTTATTTTTATAGGAATAGAGGAAGAA
 721 ATGTCAGATGCGTGCCCAGCTCTTCACCCCCCAATCTCTTGGTGGGGAGGGGTGTACCTAAATATTTATCATATCCTTGC
 801 CCTTGAGTGCTTGTTAGAGAGAAAGAGAACTACTAAGGAAAATAATATTATTTAAACTCGCTCCTAGTGTTTCTTTGTGG
 881 TCTGTGTCACCGTATCTCAGGAAGTCCAGCCACTTGACTGGCACACACCCCTCCGGACATCCAGCGTGACGGAGCCCACA
 961 CTGCCACCTTGTGGCCGCCTGAGACCCTCGCGCCCCCCGCGCCCCTCTTTTTCCCCTTGATGGAAATTGACCATACAATT
1041 TCATCCTCCTTCAGGGGATCAAAAGGACGGAGTGGGGGGACAGAGACTCAGATGAGGACAGAGTGGTTTCCAATGTGTTC
1121 AATAGATTTAGGAGCAGAAATGCAAGGGGCTGCATGACCTACCAGGACAGAACTTTCCCCAATTACAGGGTGACTCACAG
1201 CCGCATTGGTGACTCACTTCAATGTGTCATTTCCGGCTGCTGTGTGTGAGCAGTGGACACGTGAGGGGGGGGTGGGTGAG
1281 AGAGACAGGCAGCTCGGATTCAACTACCTTAGATAATATTTCTGAAAACCTACCAGCCAGAGGGTAGGGCACAAAGATGG
1361 ATGTAATGCACTTTGGGAGGCCAAGGCGGGAGGATTGCTTGAGCCCAGGAGTTCAAGACCAGCCTGGGCAACATACCAAG
1441 ACCCCCGTCTCTTTAAAAATATATATATTTTAAATATACTTAAATATATATTTCTAATATCTTTAAATATATATATATAT
1521 TTTAAAGACCAATTTATGGGAGAATTGCACACAGATGTGAAATGAATGTAATCTAATAGAAGCCTAATCAGCCCACCATG
1601 TTCTCCACTGAAAAATCCTCTTTCTTTGGGGTTTTTCTTTCTTTCTTTTTTGATTTTGCACTGGACGGTGACGTCAGCCA
1681 TGTACAGGATCCACAGGGGTGGTGTCAAATGCTATTGAAATTGTGTTGAATTGTATGCTTTTTCACTTTTGATAAATAAA
1761 CATGTAAAAATGTTTCAAAAAAATAATAAAATAAATAAATACGAAGAATATGTCAGGACAGTCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgACUCUCACAUC--CU--ACAAAUGu 5'
            | :||||||||  ||  ||||||| 
Target 5' ttTTGGAGTGTAGGTGACTTGTTTACt 3'
643 - 669 173.00 -21.70
2
miRNA  3' cgACUCU--CACAUCCU-ACAAAUGu 5'
            ||| |  |||| | | ||| |:| 
Target 5' atTGAAATTGTGTTGAATTGTATGCt 3'
1714 - 1739 115.00 -7.10
3
miRNA  3' cgaCU-CUCACAU---CCUACAAAUGu 5'
             || |:|||||     || ||||: 
Target 5' gggGAGGGGTGTACCTAAATATTTATc 3'
764 - 790 112.00 -9.73
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30c-5p :: SERPINE1    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions HPMVEC
Location of target site 3'UTR
Tools used in this research MicroCosm
Original Description (Extracted from the article) ... Our results show reduced expression of miR-30c and miR-301a, but not of miR-99a in response to PlGF, which have evolutionarily conserved binding sites in the 3'-untranslated region (3'UTR) of PAI-1 mRNA. Luciferase reporter assays using wild-type and mutant 3’UTR constructs confirmed that PAI-1-3’UTR is indeed a direct target of miR-30c and miR-301a. ...

- Patel, N. Tahara, S. M. Malik, P. Kalra, V. K., 2011, The Biochemical journal.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cgACUCUCACAUC--CU--ACAAAUGu 5'
            | :||||||||  ||  ||||||| 
Target 5' ttTTGGAGTGTAGGTGACTTGTTTACt 3'
1 - 27
Article - Patel, N. Tahara, S. M. Malik, P. Kalra, V. K.
- The Biochemical journal, 2011
PAI-1 (plasminogen activator inhibitor-1) is a key physiological inhibitor of fibrinolysis. Previously, we have reported PlGF (placental growth factor)-mediated transcriptional up-regulation of PAI-1 (SERPINE1) mRNA expression via activation of HIF-1alpha (hypoxia-inducible factor-1alpha) and AP-1 (activator protein-1) in HPMVECs (human pulmonary microvascular endothelial cells), which resulted in elevated PAI-1 in humans with SCA (sickle cell anaemia). In the present study, we have identified the role of post-transcriptional mechanism(s) of PlGF-mediated accumulation of PAI-1 mRNA in HPMVECs by examining the role of microRNAs (miRNAs/miRs) in PlGF-induced PAI-1 mRNA stability. Our results show reduced expression of miR-30c and miR-301a, but not of miR-99a, in response to PlGF, which have evolutionarily conserved binding sites in the 3'-UTR (3'-untranslated region) of PAI-1 mRNA. Transfection of anti-miR-30c or anti-miR-301a oligonucleotides resulted in increased PAI-1 mRNA levels, which were increased further with PlGF stimulation. Conversely, overexpression of pre-miR-30c or pre-miR-301a resulted in an attenuation of PlGF-induced PAI-1 mRNA and protein levels. Luciferase reporter assays using wild-type and mutant 3'-UTR constructs confirmed that the PAI-1 3'-UTR is indeed a direct target of miR-30c and miR-301a. Finally, plasma levels of miR-30c and miR-301a were significantly down-regulated in patients with SCA compared with normal controls. These results provide a post-transcriptional regulatory mechanism of PlGF-induced PAI-1 elevation.
LinkOut: [PMID: 21175428]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30c-5p :: SERPINE1    [ Functional MTI ]
Validation Method
miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cgACUCUCACAUC--CU--ACAAAUGu 5'
            | :||||||||  ||  ||||||| 
Target 5' ttTTGGAGTGTAGGTGACTTGTTTACt 3'
1 - 27
Article - Lipchina, I. Elkabetz, Y. Hafner, M. et al.
- Genes Dev, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000223095.4 | 3UTR | UUAUUUUGGAGUGUAGGUGACUUGUUUACUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
498 hsa-miR-30c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004714 MUC17 mucin 17, cell surface associated 3 1
MIRT005090 UBE2I ubiquitin-conjugating enzyme E2I 4 1
MIRT005971 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 2 2
MIRT006321 SMAD1 SMAD family member 1 2 1
MIRT006607 Snai1 snail homolog 1 (Drosophila) 1 1
MIRT006762 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT007050 HSPA4 heat shock 70kDa protein 4 2 1
MIRT007108 TGIF2 TGFB-induced factor homeobox 2 2 1
MIRT007109 HDAC4 histone deacetylase 4 2 1
MIRT007129 SOCS3 suppressor of cytokine signaling 3 2 2
MIRT007130 CUL2 cullin 2 1 1
MIRT007131 NEDD4 neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase 1 1
MIRT007132 SOCS1 suppressor of cytokine signaling 1 2 4
MIRT007133 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT007134 ARHGEF6 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 1 1
MIRT007135 ITGA4 integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) 1 1
MIRT007136 PIK3R2 phosphoinositide-3-kinase, regulatory subunit 2 (beta) 1 1
MIRT007202 VIM vimentin 1 1
MIRT007203 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 2 2
MIRT047829 HMG20A high mobility group 20A 1 1
MIRT047830 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT047831 KCTD3 potassium channel tetramerisation domain containing 3 1 1
MIRT047832 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT047833 TRA2A transformer 2 alpha homolog (Drosophila) 1 1
MIRT047834 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT047835 NDNL2 necdin-like 2 1 1
MIRT047836 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 1 2
MIRT047837 SCN11A sodium channel, voltage-gated, type XI, alpha subunit 1 1
MIRT047838 E2F3 E2F transcription factor 3 1 1
MIRT047839 UBXN1 UBX domain protein 1 1 1
MIRT047840 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT047841 PAM peptidylglycine alpha-amidating monooxygenase 1 1
MIRT047842 CHD1 chromodomain helicase DNA binding protein 1 1 2
MIRT047843 UBE3C ubiquitin protein ligase E3C 1 2
MIRT047844 MED1 mediator complex subunit 1 1 1
MIRT047845 TTC19 tetratricopeptide repeat domain 19 1 1
MIRT047846 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT047847 PNKD paroxysmal nonkinesigenic dyskinesia 1 1
MIRT047848 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT047849 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT047850 RTN4 reticulon 4 1 1
MIRT047851 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT047852 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT047853 CPOX coproporphyrinogen oxidase 1 1
MIRT047854 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT047855 IKZF4 IKAROS family zinc finger 4 (Eos) 1 1
MIRT047856 SLC25A12 solute carrier family 25 (aspartate/glutamate carrier), member 12 1 1
MIRT047857 LACTB2 lactamase, beta 2 1 1
MIRT047858 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT047859 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 1
MIRT047860 CSF1 colony stimulating factor 1 (macrophage) 1 1
MIRT047861 CAPZA1 capping protein (actin filament) muscle Z-line, alpha 1 1 1
MIRT047862 UBE2D2 ubiquitin-conjugating enzyme E2D 2 1 1
MIRT047863 GDI2 GDP dissociation inhibitor 2 1 1
MIRT047864 LIMA1 LIM domain and actin binding 1 1 1
MIRT047865 PKM pyruvate kinase, muscle 1 1
MIRT047866 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT047867 CEP152 centrosomal protein 152kDa 1 1
MIRT047868 GTF3C3 general transcription factor IIIC, polypeptide 3, 102kDa 1 1
MIRT047869 OTP orthopedia homeobox 1 1
MIRT047870 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT047871 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT047872 MGEA5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT047873 HUS1 HUS1 checkpoint homolog (S. pombe) 1 1
MIRT047874 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 1 1
MIRT047875 ABI2 abl-interactor 2 1 1
MIRT047876 TNRC6A trinucleotide repeat containing 6A 1 2
MIRT047877 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 1
MIRT047878 RPL39 ribosomal protein L39 1 1
MIRT047879 TMEM120B transmembrane protein 120B 1 1
MIRT047880 MGLL monoglyceride lipase 1 1
MIRT047881 CASC4 cancer susceptibility candidate 4 1 1
MIRT047882 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT047883 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT047884 SNX2 sorting nexin 2 1 1
MIRT047885 MGAT2 mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase 1 1
MIRT047886 DNAJB14 DnaJ (Hsp40) homolog, subfamily B, member 14 1 1
MIRT047887 RRM2 ribonucleotide reductase M2 1 3
MIRT047888 PARVG parvin, gamma 1 1
MIRT047889 BLMH bleomycin hydrolase 1 1
MIRT047890 HERC4 HECT and RLD domain containing E3 ubiquitin protein ligase 4 1 1
MIRT047891 ARF1 ADP-ribosylation factor 1 1 1
MIRT047892 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT047893 SOX4 SRY (sex determining region Y)-box 4 1 3
MIRT047894 PPP1R12A protein phosphatase 1, regulatory subunit 12A 1 2
MIRT047895 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 2
MIRT047896 AIFM1 apoptosis-inducing factor, mitochondrion-associated, 1 1 1
MIRT047897 KREMEN1 kringle containing transmembrane protein 1 1 2
MIRT047898 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT047899 ZNF506 zinc finger protein 506 1 1
MIRT047900 STARD7 StAR-related lipid transfer (START) domain containing 7 1 1
MIRT047901 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT047902 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT047903 PRCP prolylcarboxypeptidase (angiotensinase C) 1 1
MIRT047904 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT047905 ZNF668 zinc finger protein 668 1 1
MIRT047906 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047907 MXI1 MAX interactor 1 1 1
MIRT047908 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 1 1
MIRT047909 CTSC cathepsin C 1 1
MIRT047910 RPL27A ribosomal protein L27a 1 1
MIRT047911 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT047912 RPS3 ribosomal protein S3 1 1
MIRT047913 TKT transketolase 1 1
MIRT047914 MATR3 matrin 3 1 1
MIRT047915 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT047916 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 1 1
MIRT047917 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT047918 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT047919 UXT ubiquitously-expressed, prefoldin-like chaperone 1 1
MIRT047920 HMGA1 high mobility group AT-hook 1 1 1
MIRT047921 CSNK1E casein kinase 1, epsilon 1 1
MIRT047922 USP37 ubiquitin specific peptidase 37 1 2
MIRT047923 MTPAP mitochondrial poly(A) polymerase 1 1
MIRT047924 APLN apelin 1 1
MIRT047925 IPO9 importin 9 1 1
MIRT047926 RBM3 RNA binding motif (RNP1, RRM) protein 3 1 1
MIRT047927 JUP junction plakoglobin 1 1
MIRT047928 DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase 1 1
MIRT047929 PFN1 profilin 1 1 1
MIRT047930 ARFGAP1 ADP-ribosylation factor GTPase activating protein 1 1 1
MIRT047931 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 1
MIRT047932 PPM1H protein phosphatase, Mg2+/Mn2+ dependent, 1H 1 1
MIRT047933 CCDC117 coiled-coil domain containing 117 1 1
MIRT047934 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT047935 HMGXB4 HMG box domain containing 4 1 1
MIRT047936 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 1 1
MIRT047937 NFYB nuclear transcription factor Y, beta 1 1
MIRT047938 RPL32 ribosomal protein L32 1 1
MIRT047939 SLC39A1 solute carrier family 39 (zinc transporter), member 1 1 1
MIRT047940 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT047941 WDR5 WD repeat domain 5 1 1
MIRT047942 DDB1 damage-specific DNA binding protein 1, 127kDa 1 1
MIRT047943 SNRNP40 small nuclear ribonucleoprotein 40kDa (U5) 1 1
MIRT047944 KLC2 kinesin light chain 2 1 1
MIRT047945 MTCH2 mitochondrial carrier 2 1 1
MIRT047946 STARD5 StAR-related lipid transfer (START) domain containing 5 1 1
MIRT047947 RAPGEFL1 Rap guanine nucleotide exchange factor (GEF)-like 1 1 1
MIRT047948 EP300 E1A binding protein p300 1 1
MIRT047949 CFL2 cofilin 2 (muscle) 1 1
MIRT047950 SDF2L1 stromal cell-derived factor 2-like 1 1 1
MIRT047951 LYRM2 LYR motif containing 2 1 1
MIRT047952 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT047953 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT047954 ZNF687 zinc finger protein 687 1 1
MIRT047955 ESYT1 extended synaptotagmin-like protein 1 1 1
MIRT047956 SHFM1 split hand/foot malformation (ectrodactyly) type 1 1 1
MIRT047957 ZNF829 zinc finger protein 829 1 1
MIRT047958 TMEM14E transmembrane protein 14E 1 1
MIRT047959 LLPH LLP homolog, long-term synaptic facilitation (Aplysia) 1 1
MIRT047960 HMGN2 high mobility group nucleosomal binding domain 2 1 1
MIRT047961 MARK4 MAP/microtubule affinity-regulating kinase 4 1 1
MIRT047962 CKAP4 cytoskeleton-associated protein 4 1 1
MIRT047963 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT047964 KLHL42 kelch domain containing 5 1 1
MIRT047965 ARF3 ADP-ribosylation factor 3 1 1
MIRT047966 YTHDC2 YTH domain containing 2 1 1
MIRT047967 LIN9 lin-9 homolog (C. elegans) 1 1
MIRT047968 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT047969 SLC25A38 solute carrier family 25, member 38 1 1
MIRT047970 MED13 mediator complex subunit 13 1 1
MIRT047971 ZNF780B zinc finger protein 780B 1 1
MIRT047972 MTDH metadherin 1 2
MIRT047973 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 1 1
MIRT047974 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT047975 ERLIN1 ER lipid raft associated 1 1 2
MIRT047976 CADPS2 Ca++-dependent secretion activator 2 1 1
MIRT047977 SIAH2 siah E3 ubiquitin protein ligase 2 1 1
MIRT047978 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT047979 RBM14 RNA binding motif protein 14 1 1
MIRT047980 RPS27A ribosomal protein S27a 1 1
MIRT047981 ERLIN2 ER lipid raft associated 2 1 1
MIRT047982 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT047983 RPS12 ribosomal protein S12 1 1
MIRT047984 TMCO3 transmembrane and coiled-coil domains 3 1 1
MIRT047985 GZF1 GDNF-inducible zinc finger protein 1 1 1
MIRT047986 ARCN1 archain 1 1 1
MIRT047987 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 1 1
MIRT047988 CBY1 chibby homolog 1 (Drosophila) 1 1
MIRT047989 POLQ polymerase (DNA directed), theta 1 1
MIRT047990 POU2F1 POU class 2 homeobox 1 1 1
MIRT047991 PLCB1 phospholipase C, beta 1 (phosphoinositide-specific) 1 1
MIRT047992 SDE2 SDE2 telomere maintenance homolog (S. pombe) 1 1
MIRT047993 ERI1 exoribonuclease 1 1 1
MIRT047994 FAM134C family with sequence similarity 134, member C 1 1
MIRT047995 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047996 PTBP3 polypyrimidine tract binding protein 3 1 1
MIRT047997 ARHGEF12 Rho guanine nucleotide exchange factor (GEF) 12 1 1
MIRT047998 DIS3 DIS3 mitotic control homolog (S. cerevisiae) 1 1
MIRT047999 OTUD7A OTU domain containing 7A 1 1
MIRT048000 MRPL38 mitochondrial ribosomal protein L38 1 1
MIRT048001 C1QBP complement component 1, q subcomponent binding protein 1 1
MIRT048002 NUDT11 nudix (nucleoside diphosphate linked moiety X)-type motif 11 1 1
MIRT048003 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT048004 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3 1 1
MIRT048005 ZNF146 zinc finger protein 146 1 1
MIRT048006 POM121 POM121 transmembrane nucleoporin 1 1
MIRT048007 BCCIP BRCA2 and CDKN1A interacting protein 1 1
MIRT048008 ARHGAP44 Rho GTPase activating protein 44 1 1
MIRT048009 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT048010 HSPH1 heat shock 105kDa/110kDa protein 1 1 1
MIRT048011 UBE2NL ubiquitin-conjugating enzyme E2N-like 1 1
MIRT048012 HPRT1 hypoxanthine phosphoribosyltransferase 1 1 1
MIRT048013 EIF2A eukaryotic translation initiation factor 2A, 65kDa 1 1
MIRT048014 DLC1 deleted in liver cancer 1 1 1
MIRT048015 SNAPC4 small nuclear RNA activating complex, polypeptide 4, 190kDa 1 1
MIRT048016 BLOC1S4 biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino 1 1
MIRT048017 UQCRC1 ubiquinol-cytochrome c reductase core protein I 1 1
MIRT048018 EED embryonic ectoderm development 1 2
MIRT048019 ELOVL4 ELOVL fatty acid elongase 4 1 1
MIRT048020 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT048021 C16orf70 chromosome 16 open reading frame 70 1 1
MIRT048022 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 2
MIRT052954 MTA1 metastasis associated 1 3 3
MIRT053027 IL11 interleukin 11 3 1
MIRT053605 DDIT4 DNA-damage-inducible transcript 4 3 1
MIRT054329 DLL4 delta-like 4 (Drosophila) 3 1
MIRT054616 BCL9 B-cell CLL/lymphoma 9 3 1
MIRT054822 IDH1 isocitrate dehydrogenase 1 (NADP+), soluble 2 1
MIRT054823 RARB retinoic acid receptor, beta 3 1
MIRT054824 NCOR2 nuclear receptor corepressor 2 2 1
MIRT054825 RFX6 regulatory factor X, 6 3 1
MIRT054891 CCND2 cyclin D2 2 1
MIRT057356 PCGF5 polycomb group ring finger 5 1 1
MIRT057483 KIF11 kinesin family member 11 1 2
MIRT057673 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT059172 SLC35C1 solute carrier family 35, member C1 1 1
MIRT067976 TFDP1 transcription factor Dp-1 1 3
MIRT068114 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT068386 S100PBP S100P binding protein 1 1
MIRT069733 FOXG1 forkhead box G1 1 2
MIRT075439 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 3
MIRT079943 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 2
MIRT080957 LRRC8B leucine rich repeat containing 8 family, member B 1 1
MIRT081078 LDLR low density lipoprotein receptor 1 1
MIRT081713 ZNF507 zinc finger protein 507 1 2
MIRT082852 ZNF543 zinc finger protein 543 1 2
MIRT084233 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT087146 HIC2 hypermethylated in cancer 2 1 4
MIRT088445 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT088680 EML4 echinoderm microtubule associated protein like 4 1 2
MIRT088934 ASB3 ankyrin repeat and SOCS box containing 3 1 1
MIRT090503 SLC35G2 solute carrier family 35, member G2 1 1
MIRT091576 FBXO45 F-box protein 45 1 1
MIRT095096 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT096078 SFXN1 sideroflexin 1 1 1
MIRT098036 SOBP sine oculis binding protein homolog (Drosophila) 1 1
MIRT100763 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 2
MIRT100908 CD2AP CD2-associated protein 1 1
MIRT103194 SP4 Sp4 transcription factor 1 4
MIRT104520 PEG10 paternally expressed 10 1 1
MIRT105030 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT106744 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT110575 KIF5B kinesin family member 5B 1 3
MIRT115921 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT118142 ZNF264 zinc finger protein 264 1 1
MIRT128242 STRIP1 striatin interacting protein 1 1 1
MIRT131794 CEP350 centrosomal protein 350kDa 1 1
MIRT131857 IER5 immediate early response 5 1 1
MIRT134330 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT135675 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT136214 STX12 syntaxin 12 1 1
MIRT137017 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT137122 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT138279 RNF220 ring finger protein 220 1 1
MIRT139247 JDP2 Jun dimerization protein 2 1 1
MIRT140634 PLEKHO2 pleckstrin homology domain containing, family O member 2 1 1
MIRT140878 GLCE glucuronic acid epimerase 1 1
MIRT142587 IL21R interleukin 21 receptor 1 2
MIRT143348 PAPD5 PAP associated domain containing 5 1 1
MIRT144536 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT145448 RNF135 ring finger protein 135 1 1
MIRT148351 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 1
MIRT149115 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT150760 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT152412 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 2
MIRT155236 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT159112 NRBP1 nuclear receptor binding protein 1 1 1
MIRT159243 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT160846 PLXNA1 plexin A1 1 1
MIRT162925 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT164234 GAB1 GRB2-associated binding protein 1 1 1
MIRT165595 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT167508 PRDM1 PR domain containing 1, with ZNF domain 1 1
MIRT170144 KLHDC10 kelch domain containing 10 1 1
MIRT171351 PHTF2 putative homeodomain transcription factor 2 1 2
MIRT171549 DBF4 DBF4 homolog (S. cerevisiae) 1 1
MIRT176033 JADE3 PHD finger protein 16 1 1
MIRT177710 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT185098 LYPLAL1 lysophospholipase-like 1 1 1
MIRT188272 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT192226 MKRN3 makorin ring finger protein 3 1 1
MIRT194170 IREB2 iron-responsive element binding protein 2 1 1
MIRT197646 DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 1 1
MIRT206179 RAB10 RAB10, member RAS oncogene family 1 1
MIRT206887 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT210816 SETD5 SET domain containing 5 1 1
MIRT212859 N4BP2 NEDD4 binding protein 2 1 1
MIRT215130 MFAP3 microfibrillar-associated protein 3 1 1
MIRT218371 FAM8A1 family with sequence similarity 8, member A1 1 1
MIRT219171 RUNX2 runt-related transcription factor 2 3 1
MIRT252099 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 1
MIRT257169 TBPL1 TBP-like 1 1 1
MIRT258176 CBX3 chromobox homolog 3 1 1
MIRT270739 TMED2 transmembrane emp24 domain trafficking protein 2 1 1
MIRT283401 CCNF cyclin F 1 1
MIRT289628 CBX2 chromobox homolog 2 1 1
MIRT292167 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT292814 MTF2 metal response element binding transcription factor 2 1 1
MIRT293783 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT294575 ZNF460 zinc finger protein 460 1 2
MIRT302901 FOXN2 forkhead box N2 1 1
MIRT306842 FYTTD1 forty-two-three domain containing 1 1 1
MIRT313773 MIER3 mesoderm induction early response 1, family member 3 1 2
MIRT322687 BAG4 BCL2-associated athanogene 4 1 1
MIRT368807 MZT1 mitotic spindle organizing protein 1 1 1
MIRT379727 ZXDB zinc finger, X-linked, duplicated B 1 1
MIRT387953 H6PD hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 1 1
MIRT437365 CASP3 caspase 3, apoptosis-related cysteine peptidase 5 2
MIRT437433 MTTP microsomal triglyceride transfer protein 1 1
MIRT437489 NOTCH1 notch 1 3 2
MIRT437494 TP53 tumor protein p53 3 1
MIRT438640 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT439098 ZEB2 zinc finger E-box binding homeobox 2 0 1
MIRT439099 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT444598 TGFA transforming growth factor, alpha 1 1
MIRT446449 CHST15 carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 1 1
MIRT448492 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1
MIRT448511 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 1 1
MIRT448652 NCOA3 nuclear receptor coactivator 3 1 1
MIRT448785 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 2
MIRT449709 TSPYL1 TSPY-like 1 1 1
MIRT450762 PGGT1B protein geranylgeranyltransferase type I, beta subunit 1 1
MIRT452141 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT463402 ZDHHC20 zinc finger, DHHC-type containing 20 1 1
MIRT464292 VASH1 vasohibin 1 1 1
MIRT467626 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT470405 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT471079 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta 1 2
MIRT471150 PHF13 PHD finger protein 13 1 3
MIRT472476 NAP1L1 nucleosome assembly protein 1-like 1 1 4
MIRT472493 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT473655 MARCKSL1 MARCKS-like 1 1 1
MIRT473697 MAPK8 mitogen-activated protein kinase 8 1 2
MIRT474084 LMBR1L limb region 1 homolog (mouse)-like 1 2
MIRT474286 LARP1 La ribonucleoprotein domain family, member 1 1 3
MIRT475697 HHIPL1 HHIP-like 1 1 1
MIRT476169 GOLGA8B golgin A8 family, member B 1 2
MIRT481137 AZIN1 antizyme inhibitor 1 1 3
MIRT481465 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 2
MIRT482065 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT482128 AKIRIN1 akirin 1 1 2
MIRT485201 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 3
MIRT488724 ADPRHL1 ADP-ribosylhydrolase like 1 1 1
MIRT492609 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT497126 IFNE interferon, epsilon 1 1
MIRT498611 MTRNR2L10 MT-RNR2-like 10 1 3
MIRT502701 CSNK1G1 casein kinase 1, gamma 1 1 3
MIRT503024 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT504039 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 1
MIRT507131 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT514179 PGPEP1 pyroglutamyl-peptidase I 1 2
MIRT530620 CXCL11 chemokine (C-X-C motif) ligand 11 1 1
MIRT531356 FAM81B family with sequence similarity 81, member B 1 1
MIRT534306 SKIDA1 SKI/DACH domain containing 1 1 1
MIRT536978 HABP4 hyaluronan binding protein 4 1 2
MIRT538154 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 2
MIRT544266 SIKE1 suppressor of IKBKE 1 1 1
MIRT544513 GTF2E2 general transcription factor IIE, polypeptide 2, beta 34kDa 1 1
MIRT547154 PGM3 phosphoglucomutase 3 1 1
MIRT547193 PBRM1 polybromo 1 1 1
MIRT547749 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 2
MIRT548192 FOXA1 forkhead box A1 1 1
MIRT548431 ELOVL5 ELOVL fatty acid elongase 5 1 1
MIRT552927 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT553990 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT554288 SIX4 SIX homeobox 4 1 1
MIRT555308 PPP3CB protein phosphatase 3, catalytic subunit, beta isozyme 1 1
MIRT555615 PICALM phosphatidylinositol binding clathrin assembly protein 1 2
MIRT555754 PDCD10 programmed cell death 10 1 1
MIRT556572 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT557731 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT557785 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT558465 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 1 1
MIRT562795 NDUFA12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 1 1
MIRT563233 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT563267 ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1 1
MIRT565077 UHRF1BP1 UHRF1 binding protein 1 1 2
MIRT565830 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT566680 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT566740 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 2
MIRT567607 FANCF Fanconi anemia, complementation group F 1 1
MIRT568346 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 2
MIRT572869 OPHN1 oligophrenin 1 1 1
MIRT612401 STRN striatin, calmodulin binding protein 1 1
MIRT623313 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT626125 PLSCR1 phospholipid scramblase 1 1 2
MIRT653917 SERPINC1 serpin peptidase inhibitor, clade C (antithrombin), member 1 1 1
MIRT656333 MED29 mediator complex subunit 29 1 1
MIRT669389 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT686767 STX16 syntaxin 16 1 1
MIRT687189 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT688637 CREM cAMP responsive element modulator 1 1
MIRT704914 CCDC71L coiled-coil domain containing 71-like 1 1
MIRT705331 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT705591 APLP2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT705914 ADAM9 ADAM metallopeptidase domain 9 1 1
MIRT716458 MRO maestro 1 1
MIRT717151 LRRC3C leucine rich repeat containing 3C 1 1
MIRT718295 MOGAT1 monoacylglycerol O-acyltransferase 1 1 1
MIRT718886 SLFN5 schlafen family member 5 1 1
MIRT719018 SHROOM3 shroom family member 3 1 1
MIRT725997 ZSCAN29 zinc finger and SCAN domain containing 29 1 1
MIRT726048 ZNF200 zinc finger protein 200 1 1
MIRT726060 ZMYND8 zinc finger, MYND-type containing 8 1 1
MIRT726070 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT726075 ZCRB1 zinc finger CCHC-type and RNA binding motif 1 1 1
MIRT726123 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT726145 VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa 1 1
MIRT726181 UBXN4 UBX domain protein 4 1 1
MIRT726192 UBN1 ubinuclein 1 1 1
MIRT726206 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT726231 TRIM23 tripartite motif containing 23 1 1
MIRT726262 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT726379 TBC1D10B TBC1 domain family, member 10B 1 1
MIRT726388 TAOK1 TAO kinase 1 1 1
MIRT726392 TANK TRAF family member-associated NFKB activator 1 1
MIRT726398 TAF4B TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa 1 1
MIRT726430 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT726468 SOX12 SRY (sex determining region Y)-box 12 1 1
MIRT726521 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT726530 SLC38A7 solute carrier family 38, member 7 1 1
MIRT726588 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT726595 SH3GL1 SH3-domain GRB2-like 1 1 1
MIRT726611 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT726620 SETD3 SET domain containing 3 1 1
MIRT726653 SBF1 SET binding factor 1 1 1
MIRT726664 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT726692 RPA2 replication protein A2, 32kDa 1 1
MIRT726733 RNF122 ring finger protein 122 1 1
MIRT726767 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 1
MIRT726860 PREPL prolyl endopeptidase-like 1 1
MIRT726865 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT726887 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT726916 PNMA1 paraneoplastic Ma antigen 1 1 1
MIRT726978 PER2 period homolog 2 (Drosophila) 1 1
MIRT726995 PCDH10 protocadherin 10 1 1
MIRT727009 PAWR PRKC, apoptosis, WT1, regulator 1 1
MIRT727033 OTUD4 OTU domain containing 4 1 1
MIRT727092 NDEL1 nudE nuclear distribution E homolog (A. nidulans)-like 1 1 1
MIRT727123 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 1 1
MIRT727167 MLXIP MLX interacting protein 1 1
MIRT727193 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727204 MIA3 melanoma inhibitory activity family, member 3 1 1
MIRT727248 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 1
MIRT727277 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727303 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT727308 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT727313 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT727317 LCP1 lymphocyte cytosolic protein 1 (L-plastin) 1 1
MIRT727343 KLF10 Kruppel-like factor 10 1 1
MIRT727354 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT727391 JOSD1 Josephin domain containing 1 1 1
MIRT727396 KDM3A lysine (K)-specific demethylase 3A 1 1
MIRT727407 JAK1 Janus kinase 1 1 1
MIRT727433 IQCB1 IQ motif containing B1 1 1
MIRT727438 IP6K3 inositol hexakisphosphate kinase 3 1 1
MIRT727453 IL1A interleukin 1, alpha 1 1
MIRT727466 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT727545 GOLGA1 golgin A1 1 1
MIRT727567 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT727588 GCLC glutamate-cysteine ligase, catalytic subunit 1 1
MIRT727593 GCSAM germinal center-associated, signaling and motility 1 1
MIRT727634 FUCA1 fucosidase, alpha-L- 1, tissue 1 1
MIRT727688 FANCL Fanconi anemia, complementation group L 1 1
MIRT727723 FAM104A family with sequence similarity 104, member A 1 1
MIRT727765 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT727774 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT727809 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT727830 DYNLT3 dynein, light chain, Tctex-type 3 1 1
MIRT727899 DCTN4 dynactin 4 (p62) 1 1
MIRT727930 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT727957 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727978 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728012 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT728063 C8orf76 chromosome 8 open reading frame 76 1 1
MIRT728068 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT728077 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT728161 KIAA0226L KIAA0226-like 1 1
MIRT728178 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT728190 BTBD1 BTB (POZ) domain containing 1 1 1
MIRT728207 BECN1 beclin 1, autophagy related 1 1
MIRT728210 CFDP1 craniofacial development protein 1 1 1
MIRT728231 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT728241 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT728269 ATM ataxia telangiectasia mutated 1 1
MIRT728344 ANKRA2 ankyrin repeat, family A (RFXANK-like), 2 1 1
MIRT728374 AFF4 AF4/FMR2 family, member 4 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*