Accession ID: MIRT005972 [miRNA, hsa-miR-301a-3p :: SERPINE1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-301aLinkOut: [miRBase ]
Description Homo sapiens miR-301a stem-loop
Comment This sequence is the predicted human homologue of mouse miR-301, cloned from mouse embryonic stem cells .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-301a-3p
Mature Sequence 51| CAGUGCAAUAGUAUUGUCAAAGC |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-301a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SERPINE1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PAI, PAI-1, PAI1, PLANH1
Description serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0011654   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SERPINE1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SERPINE1
(miRNA target sites are highlighted)
>SERPINE1|NM_0006|3'UTR
   1 TGACCCTGGGGAAAGACGCCTTCATCTGGGACAAAACTGGAGATGCATCGGGAAAGAAGAAACTCCGAAGAAAAGAATTT
  81 TAGTGTTAATGACTCTTTCTGAAGGAAGAGAAGACATTTGCCTTTTGTTAAAAGATGGTAAACCAGATCTGTCTCCAAGA
 161 CCTTGGCCTCTCCTTGGAGGACCTTTAGGTCAAACTCCCTAGTCTCCACCTGAGACCCTGGGAGAGAAGTTTGAAGCACA
 241 ACTCCCTTAAGGTCTCCAAACCAGACGGTGACGCCTGCGGGACCATCTGGGGCACCTGCTTCCACCCGTCTCTCTGCCCA
 321 CTCGGGTCTGCAGACCTGGTTCCCACTGAGGCCCTTTGCAGGATGGAACTACGGGGCTTACAGGAGCTTTTGTGTGCCTG
 401 GTAGAAACTATTTCTGTTCCAGTCACATTGCCATCACTCTTGTACTGCCTGCCACCGCGGAGGAGGCTGGTGACAGGCCA
 481 AAGGCCAGTGGAAGAAACACCCTTTCATCTCAGAGTCCACTGTGGCACTGGCCACCCCTCCCCAGTACAGGGGTGCTGCA
 561 GGTGGCAGAGTGAATGTCCCCCATCATGTGGCCCAACTCTCCTGGCCTGGCCATCTCCCTCCCCAGAAACAGTGTGCATG
 641 GGTTATTTTGGAGTGTAGGTGACTTGTTTACTCATTGAAGCAGATTTCTGCTTCCTTTTATTTTTATAGGAATAGAGGAA
 721 GAAATGTCAGATGCGTGCCCAGCTCTTCACCCCCCAATCTCTTGGTGGGGAGGGGTGTACCTAAATATTTATCATATCCT
 801 TGCCCTTGAGTGCTTGTTAGAGAGAAAGAGAACTACTAAGGAAAATAATATTATTTAAACTCGCTCCTAGTGTTTCTTTG
 881 TGGTCTGTGTCACCGTATCTCAGGAAGTCCAGCCACTTGACTGGCACACACCCCTCCGGACATCCAGCGTGACGGAGCCC
 961 ACACTGCCACCTTGTGGCCGCCTGAGACCCTCGCGCCCCCCGCGCCCCTCTTTTTCCCCTTGATGGAAATTGACCATACA
1041 ATTTCATCCTCCTTCAGGGGATCAAAAGGACGGAGTGGGGGGACAGAGACTCAGATGAGGACAGAGTGGTTTCCAATGTG
1121 TTCAATAGATTTAGGAGCAGAAATGCAAGGGGCTGCATGACCTACCAGGACAGAACTTTCCCCAATTACAGGGTGACTCA
1201 CAGCCGCATTGGTGACTCACTTCAATGTGTCATTTCCGGCTGCTGTGTGTGAGCAGTGGACACGTGAGGGGGGGGTGGGT
1281 GAGAGAGACAGGCAGCTCGGATTCAACTACCTTAGATAATATTTCTGAAAACCTACCAGCCAGAGGGTAGGGCACAAAGA
1361 TGGATGTAATGCACTTTGGGAGGCCAAGGCGGGAGGATTGCTTGAGCCCAGGAGTTCAAGACCAGCCTGGGCAACATACC
1441 AAGACCCCCGTCTCTTTAAAAATATATATATTTTAAATATACTTAAATATATATTTCTAATATCTTTAAATATATATATA
1521 TATTTTAAAGACCAATTTATGGGAGAATTGCACACAGATGTGAAATGAATGTAATCTAATAGAAGCCTAATCAGCCCACC
1601 ATGTTCTCCACTGAAAAATCCTCTTTCTTTGGGGTTTTTCTTTCTTTCTTTTTTGATTTTGCACTGGACGGTGACGTCAG
1681 CCATGTACAGGATCCACAGGGGTGGTGTCAAATGCTATTGAAATTGTGTTGAATTGTATGCTTTTTCACTTTTGATAAAT
1761 AAACATGTAAAAATGTTTCAAAAAAATAATAAAATAAATAAATACGAAGAATATGTCAGGACAGTCAAAAAAAAAAAAAA
1841 AAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgaAACUGUUAUGAUAACGUGAc 5'
             ||| ||  ||| |||:||| 
Target 5' acaTTGCCATCACTCTTGTACTg 3'
425 - 447 152.00 -15.20
2
miRNA  3' cgAAACUGUUAUGAUAACGUGAc 5'
            |||||      | ||||||| 
Target 5' ttTTTGA------TTTTGCACTg 3'
1650 - 1666 149.00 -13.10
3
miRNA  3' cgaAACUGUUAUGAUAACGUGac 5'
             || |::: |  |||||||  
Target 5' caaTTTATGGGAGAATTGCACac 3'
1533 - 1555 136.00 -7.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-301a-3p :: SERPINE1    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions HPMVEC
Location of target site 3'UTR
Tools used in this research MicroCosm
Original Description (Extracted from the article) ... Our results show reduced expression of miR-30c and miR-301a, but not of miR-99a in response to PlGF, which have evolutionarily conserved binding sites in the 3'-untranslated region (3'UTR) of PAI-1 mRNA. Luciferase reporter assays using wild-type and mutant 3’UTR constructs confirmed that PAI-1-3’UTR is indeed a direct target of miR-30c and miR-301a. ...

- Patel, N. Tahara, S. M. Malik, P. Kalra, V. K., 2011, The Biochemical journal.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cgaAACUGUUAUGAUAACGUGAc 5'
             ||| ||  ||| |||:||| 
Target 5' acaTTGCCATCACTCTTGTACTg 3'
1 - 23
Article - Patel, N. Tahara, S. M. Malik, P. Kalra, V. K.
- The Biochemical journal, 2011
PAI-1 (plasminogen activator inhibitor-1) is a key physiological inhibitor of fibrinolysis. Previously, we have reported PlGF (placental growth factor)-mediated transcriptional up-regulation of PAI-1 (SERPINE1) mRNA expression via activation of HIF-1alpha (hypoxia-inducible factor-1alpha) and AP-1 (activator protein-1) in HPMVECs (human pulmonary microvascular endothelial cells), which resulted in elevated PAI-1 in humans with SCA (sickle cell anaemia). In the present study, we have identified the role of post-transcriptional mechanism(s) of PlGF-mediated accumulation of PAI-1 mRNA in HPMVECs by examining the role of microRNAs (miRNAs/miRs) in PlGF-induced PAI-1 mRNA stability. Our results show reduced expression of miR-30c and miR-301a, but not of miR-99a, in response to PlGF, which have evolutionarily conserved binding sites in the 3'-UTR (3'-untranslated region) of PAI-1 mRNA. Transfection of anti-miR-30c or anti-miR-301a oligonucleotides resulted in increased PAI-1 mRNA levels, which were increased further with PlGF stimulation. Conversely, overexpression of pre-miR-30c or pre-miR-301a resulted in an attenuation of PlGF-induced PAI-1 mRNA and protein levels. Luciferase reporter assays using wild-type and mutant 3'-UTR constructs confirmed that the PAI-1 3'-UTR is indeed a direct target of miR-30c and miR-301a. Finally, plasma levels of miR-30c and miR-301a were significantly down-regulated in patients with SCA compared with normal controls. These results provide a post-transcriptional regulatory mechanism of PlGF-induced PAI-1 elevation.
LinkOut: [PMID: 21175428]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
26 hsa-miR-301a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003611 MEOX2 mesenchyme homeobox 2 4 2
MIRT004113 NKRF NFKB repressing factor 5 1
MIRT005972 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT007250 SMAD4 SMAD family member 4 1 1
MIRT007295 RUNX3 runt-related transcription factor 3 3 1
MIRT044211 CEP192 centrosomal protein 192kDa 1 1
MIRT044212 CCT8 chaperonin containing TCP1, subunit 8 (theta) 1 1
MIRT044213 YTHDF1 YTH domain family, member 1 1 1
MIRT044214 GAK cyclin G associated kinase 1 1
MIRT044215 PPIB peptidylprolyl isomerase B (cyclophilin B) 1 1
MIRT044216 C1QBP complement component 1, q subcomponent binding protein 1 1
MIRT044217 RERE arginine-glutamic acid dipeptide (RE) repeats 1 1
MIRT044218 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT044219 RPL18A ribosomal protein L18a 1 1
MIRT044220 FAM126A family with sequence similarity 126, member A 1 1
MIRT044221 KIAA1279 KIAA1279 1 1
MIRT044222 CCND2 cyclin D2 1 1
MIRT044223 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT044224 KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 1 1
MIRT044225 TUBB4B tubulin, beta 2C 1 1
MIRT044226 PHAX phosphorylated adaptor for RNA export 1 1
MIRT044227 POMP proteasome maturation protein 1 1
MIRT044228 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT044229 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT044230 CYBRD1 cytochrome b reductase 1 1 1
MIRT044231 TMED5 transmembrane emp24 protein transport domain containing 5 1 1