Accession ID: MIRT006220 [miRNA, hsa-miR-622 :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-622LinkOut: [miRBase ]
Synonyms MIRN622, hsa-mir-622, MIR622
Description Homo sapiens miR-622 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-622
Mature Sequence 61| ACAGUCUGCUGAGGUUGGAGC |81
Evidence Experimental
Experiments RT-PCR
Putative hsa-miR-622 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RASK2
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_033360    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRAS
(miRNA target sites are highlighted)
>KRAS|NM_033360|3'UTR
   1 TCTGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAA
  81 AGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAAATACAATTTGTACTTTTTTCTTAAGGCATACTAGTACAA
 161 GTGGTAATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAGCATTACCTAATTTTTTTCCTGCTCCATGCAGACT
 241 GTTAGCTTTTACCTTAAATGCTTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCCCAGAGTT
 321 TTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATACCTAAGATTTCTGTCTTGGGGTTTTTGGTGCATGCAG
 401 TTGATTACTTCTTATTTTTCTTACCAATTGTGAATGTTGGTGTGAAACAAATTAATGAAGCTTTTGAATCATCCCTATTC
 481 TGTGTTTTATCTAGTCACATAAATGGATTAATTACTAATTTCAGTTGAGACCTTCTAATTGGTTTTTACTGAAACATTGA
 561 GGGAACACAAATTTATGGGCTTCCTGATGATGATTCTTCTAGGCATCATGTCCTATAGTTTGTCATCCCTGATGAATGTA
 641 AAGTTACACTGTTCACAAAGGTTTTGTCTCCTTTCCACTGCTATTAGTCATGGTCACTCTCCCCAAAATATTATATTTTT
 721 TCTATAAAAAGAAAAAAATGGAAAAAAATTACAAGGCAATGGAAACTATTATAAGGCCATTTCCTTTTCACATTAGATAA
 801 ATTACTATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTATTATAGCAACCATTTTG
 881 GGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGATTTTAACAAGTATAAAAAATTCTCATAGGAATTAA
 961 ATGTAGTCTCCCTGTGTCAGACTGCTCTTTCATAGTATAACTTTAAATCTTTTCTTCAACTTGAGTCTTTGAAGATAGTT
1041 TTAATTCTGCTTGTGACATTAAAAGATTATTTGGGCCAGTTATAGCTTATTAGGTGTTGAAGAGACCAAGGTTGCAAGGC
1121 CAGGCCCTGTGTGAACCTTTGAGCTTTCATAGAGAGTTTCACAGCATGGACTGTGTCCCCACGGTCATCCAGTGTTGTCA
1201 TGCATTGGTTAGTCAAAATGGGGAGGGACTAGGGCAGTTTGGATAGCTCAACAAGATACAATCTCACTCTGTGGTGGTCC
1281 TGCTGACAAATCAAGAGCATTGCTTTTGTTTCTTAAGAAAACAAACTCTTTTTTAAAAATTACTTTTAAATATTAACTCA
1361 AAAGTTGAGATTTTGGGGTGGTGGTGTGCCAAGACATTAATTTTTTTTTTAAACAATGAAGTGAAAAAGTTTTACAATCT
1441 CTAGGTTTGGCTAGTTCTCTTAACACTGGTTAAATTAACATTGCATAAACACTTTTCAAGTCTGATCCATATTTAATAAT
1521 GCTTTAAAATAAAAATAAAAACAATCCTTTTGATAAATTTAAAATGTTACTTATTTTAAAATAAATGAAGTGAGATGGCA
1601 TGGTGAGGTGAAAGTATCACTGGACTAGGAAGAAGGTGACTTAGGTTCTAGATAGGTGTCTTTTAGGACTCTGATTTTGA
1681 GGACATCACTTACTATCCATTTCTTCATGTTAAAAGAAGTCATCTCAAACTCTTAGTTTTTTTTTTTTACAACTATGTAA
1761 TTTATATTCCATTTACATAAGGATACACTTATTTGTCAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACACCAT
1841 CTTCAGTGCCAGTCTTGGGCAAAATTGTGCAAGAGGTGAAGTTTATATTTGAATATCCATTCTCGTTTTAGGACTCTTCT
1921 TCCATATTAGTGTCATCTTGCCTCCCTACCTTCCACATGCCCCATGACTTGATGCAGTTTTAATACTTGTAATTCCCCTA
2001 ACCATAAGATTTACTGCTGCTGTGGATATCTCCATGAAGTTTTCCCACTGAGTCACATCAGAAATGCCCTACATCTTATT
2081 TCCTCAGGGCTCAAGAGAATCTGACAGATACCATAAAGGGATTTGACCTAATCACTAATTTTCAGGTGGTGGCTGATGCT
2161 TTGAACATCTCTTTGCTGCCCAATCCATTAGCGACAGTAGGATTTTTCAAACCTGGTATGAATAGACAGAACCCTATCCA
2241 GTGGAAGGAGAATTTAATAAAGATAGTGCTGAAAGAATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACAGTA
2321 ATACATTCCATTGTTTTAGTAACCAGAAATCTTCATGCAATGAAAAATACTTTAATTCATGAAGCTTACTTTTTTTTTTT
2401 GGTGTCAGAGTCTCGCTCTTGTCACCCAGGCTGGAATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCCAGG
2481 TTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTGTAT
2561 TTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATTCACCCACCTTGGCC
2641 TCATAAACCTGTTTTGCAGAACTCATTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAAGGC
2721 ACTGGGTATATGGTATCCCCAAACAAGAGACATAATCCCGGTCCTTAGGTAGTGCTAGTGTGGTCTGTAATATCTTACTA
2801 AGGCCTTTGGTATACGACCCAGAGATAACACGATGCGTATTTTAGTTTTGCAAAGAAGGGGTTTGGTCTCTGTGCCAGCT
2881 CTATAATTGTTTTGCTACGATTCCACTGAAACTCTTCGATCAAGCTACTTTATGTAAATCACTTCATTGTTTTAAAGGAA
2961 TAAACTTGATTATATTGTTTTTTTATTTGGCATAACTGTGATTCTTTTAGGACAATTACTGTACACATTAAGGTGTATGT
3041 CAGATATTCATATTGACCCAAATGTGTAATATTCCAGTTTTCTCTGCATAAGTAATTAAAATATACTTAAAAATTAATAG
3121 TTTTATCTGGGTACAAATAAACAGGTGCCTGAACTAGTTCACAGACAAGGAAACTTCTATGTAAAAATCACTATGATTTC
3201 TGAATTGCTATGTGAAACTACAGATCTTTGGAACACTGTTTAGGTAGGGTGTTAAGACTTACACAGTACCTCGTTTCTAC
3281 ACAGAGAAAGAAATGGCCATACTTCAGGAACTGCAGTGCTTATGAGGGGATATTTAGGCCTCTTGAATTTTTGATGTAGA
3361 TGGGCATTTTTTTAAGGTAGTGGTTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGTAGAGA
3441 TTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAAGACAAAAATCCTTGTTGAAGTTTTT
3521 TTAAAAAAAGCTAAATTACATAGACTTAGGCATTAACATGTTTGTGGAAGAATATAGCAGACGTATATTGTATCATTTGA
3601 GTGAATGTTCCCAAGTAGGCATTCTAGGCTCTATTTAACTGAGTCACACTGCATAGGAATTTAGAACCTAACTTTTATAG
3681 GTTATCAAAACTGTTGTCACCATTGCACAATTTTGTCCTAATATATACATAGAAACTTTGTGGGGCATGTTAAGTTACAG
3761 TTTGCACAAGTTCATCTCATTTGTATTCCATTGATTTTTTTTTTCTTCTAAACATTTTTTCTTCAAACAGTATATAACTT
3841 TTTTTAGGGGATTTTTTTTTAGACAGCAAAAACTATCTGAAGATTTCCATTTGTCAAAAAGTAATGATTTCTTGATAATT
3921 GTGTAGTAATGTTTTTTAGAACCCAGCAGTTACCTTAAAGCTGAATTTATATTTAGTAACTTCTGTGTTAATACTGGATA
4001 GCATGAATTCTGCATTGAGAAACTGAATAGCTGTCATAAAATGAAACTTTCTTTCTAAAGAAAGATACTCACATGAGTTC
4081 TTGAAGAATAGTCATAACTAGATTAAGATCTGTGTTTTAGTTTAATAGTTTGAAGTGCCTGTTTGGGATAATGATAGGTA
4161 ATTTAGATGAATTTAGGGGAAAAAAAAGTTATCTGCAGATATGTTGAGGGCCCATCTCTCCCCCCACACCCCCACAGAGC
4241 TAACTGGGTTACAGTGTTTTATCCGAAAGTTTCCAATTCCACTGTCTTGTGTTTTCATGTTGAAAATACTTTTGCATTTT
4321 TCCTTTGAGTGCCAATTTCTTACTAGTACTATTTCTTAATGTAACATGTTTACCTGGAATGTATTTTAACTATTTTTGTA
4401 TAGTGTAAACTGAAACATGCACATTTTGTACATTGTGCTTTCTTTTGTGGGACATATGCAGTGTGATCCAGTTGTTTTCC
4481 ATCATTTGGTTGCGCTGACCTAGGAATGTTGGTCATATCAAACATTAAAAATGACCACTCTTTTAATTGAAATTAACTTT
4561 TAAATGTTTATAGGAGTATGTGCTGTGAAGTGATCTAAAATTTGTAATATTTTTGTCATGAACTGTACTACTCCTAATTA
4641 TTGTAATGTAATAAAAATAGTTACAGTGAC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgAGGUUGGAGU-CGUCUGACa 5'
            ||| :|: || |||||||| 
Target 5' ttTCCTGCTCCATGCAGACTGt 3'
221 - 242 163.00 -21.40
2
miRNA  3' cgAGGUUGGAGUCGUCUGACa 5'
            ||:  |: :: ||||||| 
Target 5' agTCTCCCTGTGTCAGACTGc 3'
965 - 985 147.00 -14.60
3
miRNA  3' cgAGGUUGG--AGUC-GUCUGACa 5'
            |:|| ||  |::| |||:||| 
Target 5' gtTTCACCCTGTTGGCCAGGCTGg 3'
2577 - 2600 141.00 -15.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-622 :: KRAS    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions 16HBE-T
Location of target site 3'UTR
Tools used in this research RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... K-Ras is a direct target of miR-622.//miR-622 functions as a tumor suppressor by targeting K-Ras. ...

- Han, Z. Yang, Q. Liu, B. Wu, J. Li, Y. et al., 2012, Carcinogenesis.

Article - Han, Z. Yang, Q. Liu, B. Wu, J. Li, Y. et al.
- Carcinogenesis, 2012
Aberrant expression of microRNA (miRNA) has been previously demonstrated to play an important role in a wide range of cancer types and further elucidation of its role in the mechanisms underlying tumorigenesis, anticarcinogenesis and potential chemotherapeutics is warranted. We chose the anti-benzo[a]pyrene-7,8-diol-9,10-epoxide-transformed human bronchial epithelial cell line 16HBE-T to study miRNAs involved in anticarcinogenesis. In resveratrol-treated cells, we found that miR-622 was upregulated, whereas it was downregulated in 16HBE-T cells, suggesting that miR-622 potentially acts as a tumor suppressor. Increasing the level of miR-622 by transient transfection-induced inhibition of proliferation and G(0) arrest in 16HBE-T cells and the lung cancer cell line H460 as demonstrated by cell viability and cell cycle analysis. MiR-622 dramatically suppressed the ability of 16HBE-T cells to form colonies in vitro and to develop tumors in nude mice. According to bioinformatics analysis, K-Ras messenger RNA was predicted as a putative miR-622 target; this was confirmed by western blot and luciferase reporter assays. Cell growth retardation was inhibited upon knockdown of K-Ras and an increase in the level of miR-622 in 16HBE-T cells. Furthermore, miR-622 inhibitor partially impaired the growth of 16HBE-T cells as demonstrated by luciferase reporter activity and K-Ras protein expression in 16HBE-T cells. In summary, miR-622 functions as a tumor suppressor by targeting K-Ras and impacting the anticancer effect of resveratrol. Therefore, miR-622 is potentially useful as a clinical therapy. MiR-622 impacts the K-Ras signal pathway and the potentially anticarcinogenic or chemotherapeutic properties warrant further investigation.
LinkOut: [PMID: 22016468]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
91 hsa-miR-622 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006220 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 2 1
MIRT080736 CYR61 cysteine-rich, angiogenic inducer, 61 1 1
MIRT085322 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT100555 SRSF3 serine/arginine-rich splicing factor 3 1 1
MIRT254556 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT259490 TXLNG taxilin gamma 1 1
MIRT312580 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 2
MIRT464177 VMP1 vacuole membrane protein 1 1 10
MIRT465448 TP53 tumor protein p53 1 1
MIRT467053 SRSF1 serine/arginine-rich splicing factor 1 1 2
MIRT474414 KLHL28 kelch-like 28 (Drosophila) 1 3
MIRT475981 GTPBP2 GTP binding protein 2 1 1
MIRT477058 FAM210A family with sequence similarity 210, member A 1 1
MIRT479841 CCDC86 coiled-coil domain containing 86 1 1
MIRT485423 LZIC leucine zipper and CTNNBIP1 domain containing 1 3
MIRT493830 FRS2 fibroblast growth factor receptor substrate 2 1 4
MIRT499106 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 3
MIRT502363 GIGYF1 GRB10 interacting GYF protein 1 1 4
MIRT503156 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 1
MIRT504193 FAM127B family with sequence similarity 127, member B 1 1
MIRT505082 ZBTB18 zinc finger protein 238 1 2
MIRT505696 SESN3 sestrin 3 1 1
MIRT505719 SESN2 sestrin 2 1 1
MIRT510799 SERBP1 SERPINE1 mRNA binding protein 1 1 3
MIRT514632 MTRNR2L7 MT-RNR2-like 7 1 1
MIRT520207 WASL Wiskott-Aldrich syndrome-like 1 1
MIRT525432 PROX2 prospero homeobox 2 1 1
MIRT526996 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT527360 KRTAP13-2 keratin associated protein 13-2 1 1
MIRT531226 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT532810 MRPS10 mitochondrial ribosomal protein S10 1 1
MIRT539545 AAK1 AP2 associated kinase 1 1 1
MIRT545476 TRIM37 tripartite motif containing 37 1 1
MIRT549369 ANKS1A ankyrin repeat and sterile alpha motif domain containing 1A 1 1
MIRT562295 GLO1 glyoxalase I 1 1
MIRT563552 SCP2 sterol carrier protein 2 1 1
MIRT563693 RPS26 ribosomal protein S26 1 1
MIRT569129 TMC5 transmembrane channel-like 5 1 2
MIRT574526 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT574919 Vmp1 vacuole membrane protein 1 1 1
MIRT610221 B3GALT5 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 1 2
MIRT612700 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT612837 KCNN3 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 1 2
MIRT615540 PHF1 PHD finger protein 1 1 1
MIRT622378 SALL1 sal-like 1 (Drosophila) 1 1
MIRT623022 OLFML2A olfactomedin-like 2A 1 1
MIRT628369 CAMK4 calcium/calmodulin-dependent protein kinase IV 1 1
MIRT629618 NOL10 nucleolar protein 10 1 1
MIRT631181 HCAR1 hydroxycarboxylic acid receptor 1 1 1
MIRT631455 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 1 1
MIRT632936 FGF9 fibroblast growth factor 9 (glia-activating factor) 1 1
MIRT634990 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT635264 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT635457 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT639261 MANEAL mannosidase, endo-alpha-like 1 1
MIRT642948 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT643486 DISC1 disrupted in schizophrenia 1 1 1
MIRT643504 ZNF195 zinc finger protein 195 1 1
MIRT643952 CCDC141 coiled-coil domain containing 141 1 1
MIRT644480 ZBTB3 zinc finger and BTB domain containing 3 1 1
MIRT644917 SERF1B small EDRK-rich factor 1B (centromeric) 1 1
MIRT646699 SERF1A small EDRK-rich factor 1A (telomeric) 1 1
MIRT649293 NEK8 NIMA (never in mitosis gene a)- related kinase 8 1 1
MIRT650084 MTL5 metallothionein-like 5, testis-specific (tesmin) 1 1
MIRT651861 UNC5B unc-5 homolog B (C. elegans) 1 1
MIRT652419 TMEM242 transmembrane protein 242 1 1
MIRT654168 RORA RAR-related orphan receptor A 1 1
MIRT658170 FCHSD1 FCH and double SH3 domains 1 1 1
MIRT659646 CDK2 cyclin-dependent kinase 2 1 1
MIRT676367 ZNF844 zinc finger protein 844 1 1
MIRT676457 PLEKHM3 pleckstrin homology domain containing, family M, member 3 1 1
MIRT677564 C19orf52 chromosome 19 open reading frame 52 1 1
MIRT678777 CEP76 centrosomal protein 76kDa 1 1
MIRT685338 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT694034 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 1 1
MIRT695524 SLC25A34 solute carrier family 25, member 34 1 1
MIRT697011 HAUS5 HAUS augmin-like complex, subunit 5 1 1
MIRT698441 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT699222 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT700027 RPP25 ribonuclease P/MRP 25kDa subunit 1 1
MIRT700651 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT703637 FBRS fibrosin 1 1
MIRT706498 SEPT6 septin 6 1 1
MIRT714478 CYCS cytochrome c, somatic 1 1
MIRT715675 HEBP2 heme binding protein 2 1 1
MIRT717424 SURF6 surfeit 6 1 1
MIRT717430 LRRC42 leucine rich repeat containing 42 1 1
MIRT719102 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT722337 BEND6 BEN domain containing 6 1 1
MIRT724251 TENM4 teneurin transmembrane protein 4 1 1
MIRT724962 PTK6 PTK6 protein tyrosine kinase 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*