Accession ID: MIRT006220 [miRNA, hsa-miR-622 :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-622LinkOut: [miRBase ]
Synonyms MIRN622, hsa-mir-622, MIR622
Description Homo sapiens miR-622 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-622
Mature Sequence 61| ACAGUCUGCUGAGGUUGGAGC |81
Evidence Experimental
Experiments RT-PCR
Putative hsa-miR-622 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RASK2
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_0333    LinkOut: [ RefSeq ]
Other Transcripts NM_0049   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRAS
(miRNA target sites are highlighted)
>KRAS|NM_0333|3'UTR
   1 TAATCTGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTA
  81 AAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAAATACAATTTGTACTTTTTTCTTAAGGCATACTAGTA
 161 CAAGTGGTAATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAGCATTACCTAATTTTTTTCCTGCTCCATGCAG
 241 ACTGTTAGCTTTTACCTTAAATGCTTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCCCAGA
 321 GTTTTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATACCTAAGATTTCTGTCTTGGGGTTTTTGGTGCATG
 401 CAGTTGATTACTTCTTATTTTTCTTACCAATTGTGAATGTTGGTGTGAAACAAATTAATGAAGCTTTTGAATCATCCCTA
 481 TTCTGTGTTTTATCTAGTCACATAAATGGATTAATTACTAATTTCAGTTGAGACCTTCTAATTGGTTTTTACTGAAACAT
 561 TGAGGGAACACAAATTTATGGGCTTCCTGATGATGATTCTTCTAGGCATCATGTCCTATAGTTTGTCATCCCTGATGAAT
 641 GTAAAGTTACACTGTTCACAAAGGTTTTGTCTCCTTTCCACTGCTATTAGTCATGGTCACTCTCCCCAAAATATTATATT
 721 TTTTCTATAAAAAGAAAAAAATGGAAAAAAATTACAAGGCAATGGAAACTATTATAAGGCCATTTCCTTTTCACATTAGA
 801 TAAATTACTATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTATTATAGCAACCATT
 881 TTGGGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGATTTTAACAAGTATAAAAAATTCTCATAGGAAT
 961 TAAATGTAGTCTCCCTGTGTCAGACTGCTCTTTCATAGTATAACTTTAAATCTTTTCTTCAACTTGAGTCTTTGAAGATA
1041 GTTTTAATTCTGCTTGTGACATTAAAAGATTATTTGGGCCAGTTATAGCTTATTAGGTGTTGAAGAGACCAAGGTTGCAA
1121 GGCCAGGCCCTGTGTGAACCTTTGAGCTTTCATAGAGAGTTTCACAGCATGGACTGTGTCCCCACGGTCATCCAGTGTTG
1201 TCATGCATTGGTTAGTCAAAATGGGGAGGGACTAGGGCAGTTTGGATAGCTCAACAAGATACAATCTCACTCTGTGGTGG
1281 TCCTGCTGACAAATCAAGAGCATTGCTTTTGTTTCTTAAGAAAACAAACTCTTTTTTAAAAATTACTTTTAAATATTAAC
1361 TCAAAAGTTGAGATTTTGGGGTGGTGGTGTGCCAAGACATTAATTTTTTTTTTAAACAATGAAGTGAAAAAGTTTTACAA
1441 TCTCTAGGTTTGGCTAGTTCTCTTAACACTGGTTAAATTAACATTGCATAAACACTTTTCAAGTCTGATCCATATTTAAT
1521 AATGCTTTAAAATAAAAATAAAAACAATCCTTTTGATAAATTTAAAATGTTACTTATTTTAAAATAAATGAAGTGAGATG
1601 GCATGGTGAGGTGAAAGTATCACTGGACTAGGAAGAAGGTGACTTAGGTTCTAGATAGGTGTCTTTTAGGACTCTGATTT
1681 TGAGGACATCACTTACTATCCATTTCTTCATGTTAAAAGAAGTCATCTCAAACTCTTAGTTTTTTTTTTTTACAACTATG
1761 TAATTTATATTCCATTTACATAAGGATACACTTATTTGTCAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACAC
1841 CATCTTCAGTGCCAGTCTTGGGCAAAATTGTGCAAGAGGTGAAGTTTATATTTGAATATCCATTCTCGTTTTAGGACTCT
1921 TCTTCCATATTAGTGTCATCTTGCCTCCCTACCTTCCACATGCCCCATGACTTGATGCAGTTTTAATACTTGTAATTCCC
2001 CTAACCATAAGATTTACTGCTGCTGTGGATATCTCCATGAAGTTTTCCCACTGAGTCACATCAGAAATGCCCTACATCTT
2081 ATTTCCTCAGGGCTCAAGAGAATCTGACAGATACCATAAAGGGATTTGACCTAATCACTAATTTTCAGGTGGTGGCTGAT
2161 GCTTTGAACATCTCTTTGCTGCCCAATCCATTAGCGACAGTAGGATTTTTCAAACCTGGTATGAATAGACAGAACCCTAT
2241 CCAGTGGAAGGAGAATTTAATAAAGATAGTGCTGAAAGAATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACA
2321 GTAATACATTCCATTGTTTTAGTAACCAGAAATCTTCATGCAATGAAAAATACTTTAATTCATGAAGCTTACTTTTTTTT
2401 TTTGGTGTCAGAGTCTCGCTCTTGTCACCCAGGCTGGAATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCC
2481 AGGTTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTG
2561 TATTTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATTCACCCACCTTG
2641 GCCTCATAAACCTGTTTTGCAGAACTCATTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAA
2721 GGCACTGGGTATATGGTATCCCCAAACAAGAGACATAATCCCGGTCCTTAGGTAGTGCTAGTGTGGTCTGTAATATCTTA
2801 CTAAGGCCTTTGGTATACGACCCAGAGATAACACGATGCGTATTTTAGTTTTGCAAAGAAGGGGTTTGGTCTCTGTGCCA
2881 GCTCTATAATTGTTTTGCTACGATTCCACTGAAACTCTTCGATCAAGCTACTTTATGTAAATCACTTCATTGTTTTAAAG
2961 GAATAAACTTGATTATATTGTTTTTTTATTTGGCATAACTGTGATTCTTTTAGGACAATTACTGTACACATTAAGGTGTA
3041 TGTCAGATATTCATATTGACCCAAATGTGTAATATTCCAGTTTTCTCTGCATAAGTAATTAAAATATACTTAAAAATTAA
3121 TAGTTTTATCTGGGTACAAATAAACAGGTGCCTGAACTAGTTCACAGACAAGGAAACTTCTATGTAAAAATCACTATGAT
3201 TTCTGAATTGCTATGTGAAACTACAGATCTTTGGAACACTGTTTAGGTAGGGTGTTAAGACTTACACAGTACCTCGTTTC
3281 TACACAGAGAAAGAAATGGCCATACTTCAGGAACTGCAGTGCTTATGAGGGGATATTTAGGCCTCTTGAATTTTTGATGT
3361 AGATGGGCATTTTTTTAAGGTAGTGGTTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGTAG
3441 AGATTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAAGACAAAAATCCTTGTTGAAGTT
3521 TTTTTAAAAAAAGCTAAATTACATAGACTTAGGCATTAACATGTTTGTGGAAGAATATAGCAGACGTATATTGTATCATT
3601 TGAGTGAATGTTCCCAAGTAGGCATTCTAGGCTCTATTTAACTGAGTCACACTGCATAGGAATTTAGAACCTAACTTTTA
3681 TAGGTTATCAAAACTGTTGTCACCATTGCACAATTTTGTCCTAATATATACATAGAAACTTTGTGGGGCATGTTAAGTTA
3761 CAGTTTGCACAAGTTCATCTCATTTGTATTCCATTGATTTTTTTTTTCTTCTAAACATTTTTTCTTCAAACAGTATATAA
3841 CTTTTTTTAGGGGATTTTTTTTTAGACAGCAAAAACTATCTGAAGATTTCCATTTGTCAAAAAGTAATGATTTCTTGATA
3921 ATTGTGTAGTAATGTTTTTTAGAACCCAGCAGTTACCTTAAAGCTGAATTTATATTTAGTAACTTCTGTGTTAATACTGG
4001 ATAGCATGAATTCTGCATTGAGAAACTGAATAGCTGTCATAAAATGAAACTTTCTTTCTAAAGAAAGATACTCACATGAG
4081 TTCTTGAAGAATAGTCATAACTAGATTAAGATCTGTGTTTTAGTTTAATAGTTTGAAGTGCCTGTTTGGGATAATGATAG
4161 GTAATTTAGATGAATTTAGGGGAAAAAAAAGTTATCTGCAGATATGTTGAGGGCCCATCTCTCCCCCCACACCCCCACAG
4241 AGCTAACTGGGTTACAGTGTTTTATCCGAAAGTTTCCAATTCCACTGTCTTGTGTTTTCATGTTGAAAATACTTTTGCAT
4321 TTTTCCTTTGAGTGCCAATTTCTTACTAGTACTATTTCTTAATGTAACATGTTTACCTGGAATGTATTTTAACTATTTTT
4401 GTATAGTGTAAACTGAAACATGCACATTTTGTACATTGTGCTTTCTTTTGTGGGACATATGCAGTGTGATCCAGTTGTTT
4481 TCCATCATTTGGTTGCGCTGACCTAGGAATGTTGGTCATATCAAACATTAAAAATGACCACTCTTTTAATTGAAATTAAC
4561 TTTTAAATGTTTATAGGAGTATGTGCTGTGAAGTGATCTAAAATTTGTAATATTTTTGTCATGAACTGTACTACTCCTAA
4641 TTATTGTAATGTAATAAAAATAGTTACAGTGACAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgAGGUUGGAGU-CGUCUGACa 5'
            ||| :|: || |||||||| 
Target 5' ttTCCTGCTCCATGCAGACTGt 3'
224 - 245 163.00 -21.40
2
miRNA  3' cgAGGUUGGAGUCGUCUGACa 5'
            ||:  |: :: ||||||| 
Target 5' agTCTCCCTGTGTCAGACTGc 3'
968 - 988 147.00 -14.60
3
miRNA  3' cgAGGUUGG--AGUC-GUCUGACa 5'
            |:|| ||  |::| |||:||| 
Target 5' gtTTCACCCTGTTGGCCAGGCTGg 3'
2580 - 2603 141.00 -15.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-622 :: KRAS    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions 16HBE-T
Location of target site 3'UTR
Tools used in this research RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... K-Ras is a direct target of miR-622.//miR-622 functions as a tumor suppressor by targeting K-Ras. ...

- Han, Z. Yang, Q. Liu, B. Wu, J. Li, Y. et al., 2012, Carcinogenesis.

Article - Han, Z. Yang, Q. Liu, B. Wu, J. Li, Y. et al.
- Carcinogenesis, 2012
Aberrant expression of microRNA (miRNA) has been previously demonstrated to play an important role in a wide range of cancer types and further elucidation of its role in the mechanisms underlying tumorigenesis, anticarcinogenesis and potential chemotherapeutics is warranted. We chose the anti-benzo[a]pyrene-7,8-diol-9,10-epoxide-transformed human bronchial epithelial cell line 16HBE-T to study miRNAs involved in anticarcinogenesis. In resveratrol-treated cells, we found that miR-622 was upregulated, whereas it was downregulated in 16HBE-T cells, suggesting that miR-622 potentially acts as a tumor suppressor. Increasing the level of miR-622 by transient transfection-induced inhibition of proliferation and G(0) arrest in 16HBE-T cells and the lung cancer cell line H460 as demonstrated by cell viability and cell cycle analysis. MiR-622 dramatically suppressed the ability of 16HBE-T cells to form colonies in vitro and to develop tumors in nude mice. According to bioinformatics analysis, K-Ras messenger RNA was predicted as a putative miR-622 target; this was confirmed by western blot and luciferase reporter assays. Cell growth retardation was inhibited upon knockdown of K-Ras and an increase in the level of miR-622 in 16HBE-T cells. Furthermore, miR-622 inhibitor partially impaired the growth of 16HBE-T cells as demonstrated by luciferase reporter activity and K-Ras protein expression in 16HBE-T cells. In summary, miR-622 functions as a tumor suppressor by targeting K-Ras and impacting the anticancer effect of resveratrol. Therefore, miR-622 is potentially useful as a clinical therapy. MiR-622 impacts the K-Ras signal pathway and the potentially anticarcinogenic or chemotherapeutic properties warrant further investigation.
LinkOut: [PMID: 22016468]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1 hsa-miR-622 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006220 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 2 1