Accession ID: MIRT006275 [miRNA, hsa-miR-19b-1-5p :: FGFR2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-19b-1LinkOut: [miRBase ]
Synonyms MIRN19B1, miR-19b-1, miRNA19B1, MIR19B1
Description Homo sapiens miR-19b-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-19b-1-5p
Mature Sequence 16| AGUUUUGCAGGUUUGCAUCCAGC |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-19b-1-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGFR2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BBDS, BEK, BFR-1, CD332, CEK3, CFD1, ECT1, JWS, K-SAM, KGFR, TK14, TK25
Description fibroblast growth factor receptor 2
Transcript NM_000141    LinkOut: [ RefSeq ]
Other Transcripts NM_001144913 , NM_001144914 , NM_001144915 , NM_001144916 , NM_001144917 , NM_001144918 , NM_001144919 , NM_022970   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGFR2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGFR2
(miRNA target sites are highlighted)
>FGFR2|NM_000141|3'UTR
   1 ATGACTGTGTCTGCCTGTCCCCAAACAGGACAGCACTGGGAACCTAGCTACACTGAGCAGGGAGACCATGCCTCCCAGAG
  81 CTTGTTGTCTCCACTTGTATATATGGATCAGAGGAGTAAATAATTGGAAAAGTAATCAGCATATGTGTAAAGATTTATAC
 161 AGTTGAAAACTTGTAATCTTCCCCAGGAGGAGAAGAAGGTTTCTGGAGCAGTGGACTGCCACAAGCCACCATGTAACCCC
 241 TCTCACCTGCCGTGCGTACTGGCTGTGGACCAGTAGGACTCAAGGTGGACGTGCGTTCTGCCTTCCTTGTTAATTTTGTA
 321 ATAATTGGAGAAGATTTATGTCAGCACACACTTACAGAGCACAAATGCAGTATATAGGTGCTGGATGTATGTAAATATAT
 401 TCAAATTATGTATAAATATATATTATATATTTACAAGGAGTTATTTTTTGTATTGATTTTAAATGGATGTCCCAATGCAC
 481 CTAGAAAATTGGTCTCTCTTTTTTTAATAGCTATTTGCTAAATGCTGTTCTTACACATAATTTCTTAATTTTCACCGAGC
 561 AGAGGTGGAAAAATACTTTTGCTTTCAGGGAAAATGGTATAACGTTAATTTATTAATAAATTGGTAATATACAAAACAAT
 641 TAATCATTTATAGTTTTTTTTGTAATTTAAGTGGCATTTCTATGCAGGCAGCACAGCAGACTAGTTAATCTATTGCTTGG
 721 ACTTAACTAGTTATCAGATCCTTTGAAAAGAGAATATTTACAATATATGACTAATTTGGGGAAAATGAAGTTTTGATTTA
 801 TTTGTGTTTAAATGCTGCTGTCAGACGATTGTTCTTAGACCTCCTAAATGCCCCATATTAAAAGAACTCATTCATAGGAA
 881 GGTGTTTCATTTTGGTGTGCAACCCTGTCATTACGTCAACGCAACGTCTAACTGGACTTCCCAAGATAAATGGTACCAGC
 961 GTCCTCTTAAAAGATGCCTTAATCCATTCCTTGAGGACAGACCTTAGTTGAAATGATAGCAGAATGTGCTTCTCTCTGGC
1041 AGCTGGCCTTCTGCTTCTGAGTTGCACATTAATCAGATTAGCCTGTATTCTCTTCAGTGAATTTTGATAATGGCTTCCAG
1121 ACTCTTTGGCGTTGGAGACGCCTGTTAGGATCTTCAAGTCCCATCATAGAAAATTGAAACACAGAGTTGTTCTGCTGATA
1201 GTTTTGGGGATACGTCCATCTTTTTAAGGGATTGCTTTCATCTAATTCTGGCAGGACCTCACCAAAAGATCCAGCCTCAT
1281 ACCTACATCAGACAAAATATCGCCGTTGTTCCTTCTGTACTAAAGTATTGTGTTTTGCTTTGGAAACACCCACTCACTTT
1361 GCAATAGCCGTGCAAGATGAATGCAGATTACACTGATCTTATGTGTTACAAAATTGGAGAAAGTATTTAATAAAACCTGT
1441 TAATTTTTATACTGACAATAAAAATGTTTCTACAGATATTAATGTTAACAAGACAAAATAAATGTCACGCAACTTATTTT
1521 TTTAATA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgaccuACGU--UUGG-ACGUUUUGa 5'
                ||||  |:|| |||||:|: 
Target 5' tcacttTGCAATAGCCGTGCAAGATg 3'
1354 - 1379 131.00 -13.10
2
miRNA  3' cgACCUACGUUUGGACGUUUUGa 5'
            ||| ||:::||| |:|::|| 
Target 5' acTGGCTGTGGACCAGTAGGACt 3'
258 - 280 129.00 -22.10
3
miRNA  3' cgaccUACGUUUGGA-CGUUUUGa 5'
               || :|| :|| |||::|| 
Target 5' ctttcATCTAATTCTGGCAGGACc 3'
1235 - 1258 126.00 -7.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-19b-1-5p :: FGFR2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions HUVEC
Location of target site 3'UTR
Tools used in this research miRanda , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... The expression levels of these targets in the assay were 61% for FGFR2 of that of un- treated HUVECs (Supplemental Fig. S3A, P < 0.05), which conīŦrmed that miR-19b-1 actually down-regulated important factors in the growth signaling pathway. But we did not observe any differences in expression of other predicted targets at mRNA levels. ...

- Yin, R. Bao, W. Xing, Y. Xi, T. Gou, S., 2012, Biochem Biophys Res Commun.

Article - Yin, R. Bao, W. Xing, Y. Xi, T. Gou, S.
- Biochem Biophys Res Commun, 2012
MicroRNAs are endogenously expressed small, non-coding RNAs that modulate biological processes by recognizing specific gene transcripts, leading to translational repression or degradation. Previous work showed that the miR-17-92 cluster is highly expressed in human endothelial cells that participate in angiogenesis. In this study we showed that miR-19b-1, a component of this cluster, controls the intrinsic angiogenic activity of human umbilical vein endothelial cells (HUVECs) in vitro. In silico and in vitro analyses have suggested that miR-19b-1 targets mRNA corresponding to the pro-angiogenic protein, FGFR2, and blocks the cell cycle from the S phase to the G(2)/M phase transition by controlling the expression of cyclin D1. Thus, miR-19b-1 may serve as a valuable therapeutic agent in the context of tumor angiogenesis.
LinkOut: [PMID: 22197821]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
100 hsa-miR-19b-1-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006275 FGFR2 fibroblast growth factor receptor 2 2 1
MIRT006276 CCND1 cyclin D1 1 1
MIRT006277 KDR kinase insert domain receptor (a type III receptor tyrosine kinase) 1 1
MIRT006278 CASP8 caspase 8, apoptosis-related cysteine peptidase 1 1
MIRT006279 ITGB8 integrin, beta 8 1 1
MIRT038978 DNAH8 dynein, axonemal, heavy chain 8 1 1
MIRT038979 ZDHHC6 zinc finger, DHHC-type containing 6 1 1
MIRT063865 RASSF8 Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 1 3
MIRT077657 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT078462 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT095249 FAM13B family with sequence similarity 13, member B 1 1
MIRT109491 KLHL15 kelch-like 15 (Drosophila) 1 3
MIRT155379 CCNT2 cyclin T2 1 1
MIRT163209 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 1 1
MIRT188327 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT204724 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT236400 HMGXB4 HMG box domain containing 4 1 1
MIRT237115 P2RY1 purinergic receptor P2Y, G-protein coupled, 1 1 2
MIRT286943 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT438800 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 1
MIRT442522 MOB3B MOB kinase activator 3B 1 1
MIRT452257 RPL30 ribosomal protein L30 1 1
MIRT473427 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT476782 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT476941 FAM83G family with sequence similarity 83, member G 1 1
MIRT480183 CALM2 calmodulin 2 (phosphorylase kinase, delta) 1 3
MIRT489619 ZNF384 zinc finger protein 384 1 1
MIRT492245 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 1
MIRT492421 RGL2 ral guanine nucleotide dissociation stimulator-like 2 1 1
MIRT494859 ZNF99 zinc finger protein 99 1 1
MIRT497000 SNAP25 synaptosomal-associated protein, 25kDa 1 1
MIRT501972 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT504916 CD38 CD38 molecule 1 2
MIRT507018 HMGA2 high mobility group AT-hook 2 1 3
MIRT510819 SBNO1 strawberry notch homolog 1 (Drosophila) 1 2
MIRT514165 PGPEP1 pyroglutamyl-peptidase I 1 1
MIRT514327 PSMG2 proteasome (prosome, macropain) assembly chaperone 2 1 2
MIRT514428 SLC38A7 solute carrier family 38, member 7 1 1
MIRT514535 ESR2 estrogen receptor 2 (ER beta) 1 1
MIRT516116 SRPX2 sushi-repeat containing protein, X-linked 2 1 2
MIRT517758 ZNF366 zinc finger protein 366 1 2
MIRT518494 FAM161B family with sequence similarity 161, member B 1 2
MIRT518511 CASP10 caspase 10, apoptosis-related cysteine peptidase 1 1
MIRT518560 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 1 1
MIRT518640 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT518728 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT523563 GGCX gamma-glutamyl carboxylase 1 2
MIRT526522 YIPF6 Yip1 domain family, member 6 1 1
MIRT530253 ZNF620 zinc finger protein 620 1 1
MIRT531657 ZFP14 zinc finger protein 14 homolog (mouse) 1 1
MIRT532698 TCN2 transcobalamin II 1 2
MIRT534018 STXBP4 syntaxin binding protein 4 1 1
MIRT535747 MYO10 myosin X 1 2
MIRT544508 GTF2E2 general transcription factor IIE, polypeptide 2, beta 34kDa 1 1
MIRT546757 RLIM ring finger protein, LIM domain interacting 1 1
MIRT547928 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT550129 ZNF138 zinc finger protein 138 1 1
MIRT551762 MED21 mediator complex subunit 21 1 1
MIRT557726 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT558923 CBX1 chromobox homolog 1 1 1
MIRT562465 CORO1C coronin, actin binding protein, 1C 1 1
MIRT562758 ZNF846 zinc finger protein 846 1 1
MIRT563060 ZNF28 zinc finger protein 28 1 1
MIRT563335 RPLP0 ribosomal protein, large, P0 1 1
MIRT569169 DMD dystrophin 1 1
MIRT573254 TNFAIP6 tumor necrosis factor, alpha-induced protein 6 1 1
MIRT575056 P2ry1 purinergic receptor P2Y, G-protein coupled 1 1 1
MIRT575359 Zxda zinc finger, X-linked, duplicated A 1 1
MIRT613232 CCDC39 coiled-coil domain containing 39 1 1
MIRT613346 ADRBK2 adrenergic, beta, receptor kinase 2 1 3
MIRT613951 TMEM59 transmembrane protein 59 1 1
MIRT615487 EDN1 endothelin 1 1 1
MIRT618709 ESD esterase D 1 1
MIRT630608 ARHGAP1 Rho GTPase activating protein 1 1 1
MIRT630618 CXCR6 chemokine (C-X-C motif) receptor 6 1 1
MIRT630630 IMPAD1 inositol monophosphatase domain containing 1 1 1
MIRT630673 KLF7 Kruppel-like factor 7 (ubiquitous) 1 1
MIRT630745 COG6 component of oligomeric golgi complex 6 1 1
MIRT636852 ZSCAN2 zinc finger and SCAN domain containing 2 1 1
MIRT638641 GPATCH8 G patch domain containing 8 1 1
MIRT639105 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 1
MIRT639421 PKP1 plakophilin 1 (ectodermal dysplasia/skin fragility syndrome) 1 1
MIRT640186 ABCC12 ATP-binding cassette, sub-family C (CFTR/MRP), member 12 1 1
MIRT641756 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT666576 RHOBTB3 Rho-related BTB domain containing 3 1 1
MIRT672165 FANCF Fanconi anemia, complementation group F 1 1
MIRT688344 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 1 1
MIRT690119 ZFAND1 zinc finger, AN1-type domain 1 1 1
MIRT696938 CERK ceramide kinase 1 1
MIRT701360 NR4A3 nuclear receptor subfamily 4, group A, member 3 1 1
MIRT703287 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 1
MIRT709145 ZNF799 zinc finger protein 799 1 1
MIRT710847 FAM210A family with sequence similarity 210, member A 1 1
MIRT712620 GTF2H5 general transcription factor IIH, polypeptide 5 1 1
MIRT714590 CMBL carboxymethylenebutenolidase homolog (Pseudomonas) 1 1
MIRT716908 CACNB2 calcium channel, voltage-dependent, beta 2 subunit 1 1
MIRT721164 FAM200B family with sequence similarity 200, member B 1 1
MIRT722402 BCAS2 breast carcinoma amplified sequence 2 1 1
MIRT722516 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT724598 AP3B1 adaptor-related protein complex 3, beta 1 subunit 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*