Accession ID: MIRT006275 [miRNA, hsa-miR-19b-1-5p :: FGFR2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-19b-1LinkOut: [miRBase ]
Synonyms MIRN19B1, miR-19b-1, miRNA19B1, MIR19B1
Description Homo sapiens miR-19b-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-19b-1-5p
Mature Sequence 16| AGUUUUGCAGGUUUGCAUCCAGC |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-19b-1-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGFR2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BEK, BFR-1, CD332, CEK3, CFD1, ECT1, FLJ98662, JWS, K-SAM, KGFR, TK14, TK25
Description fibroblast growth factor receptor 2
Transcript NM_0001    LinkOut: [ RefSeq ]
Other Transcripts NM_0011449 , NM_0011449 , NM_0011449 , NM_0011449 , NM_0011449 , NM_0011449 , NM_0011449 , NM_0229   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGFR2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGFR2
(miRNA target sites are highlighted)
>FGFR2|NM_0001|3'UTR
   1 TGAATGACTGTGTCTGCCTGTCCCCAAACAGGACAGCACTGGGAACCTAGCTACACTGAGCAGGGAGACCATGCCTCCCA
  81 GAGCTTGTTGTCTCCACTTGTATATATGGATCAGAGGAGTAAATAATTGGAAAAGTAATCAGCATATGTGTAAAGATTTA
 161 TACAGTTGAAAACTTGTAATCTTCCCCAGGAGGAGAAGAAGGTTTCTGGAGCAGTGGACTGCCACAAGCCACCATGTAAC
 241 CCCTCTCACCTGCCGTGCGTACTGGCTGTGGACCAGTAGGACTCAAGGTGGACGTGCGTTCTGCCTTCCTTGTTAATTTT
 321 GTAATAATTGGAGAAGATTTATGTCAGCACACACTTACAGAGCACAAATGCAGTATATAGGTGCTGGATGTATGTAAATA
 401 TATTCAAATTATGTATAAATATATATTATATATTTACAAGGAGTTATTTTTTGTATTGATTTTAAATGGATGTCCCAATG
 481 CACCTAGAAAATTGGTCTCTCTTTTTTTAATAGCTATTTGCTAAATGCTGTTCTTACACATAATTTCTTAATTTTCACCG
 561 AGCAGAGGTGGAAAAATACTTTTGCTTTCAGGGAAAATGGTATAACGTTAATTTATTAATAAATTGGTAATATACAAAAC
 641 AATTAATCATTTATAGTTTTTTTTGTAATTTAAGTGGCATTTCTATGCAGGCAGCACAGCAGACTAGTTAATCTATTGCT
 721 TGGACTTAACTAGTTATCAGATCCTTTGAAAAGAGAATATTTACAATATATGACTAATTTGGGGAAAATGAAGTTTTGAT
 801 TTATTTGTGTTTAAATGCTGCTGTCAGACGATTGTTCTTAGACCTCCTAAATGCCCCATATTAAAAGAACTCATTCATAG
 881 GAAGGTGTTTCATTTTGGTGTGCAACCCTGTCATTACGTCAACGCAACGTCTAACTGGACTTCCCAAGATAAATGGTACC
 961 AGCGTCCTCTTAAAAGATGCCTTAATCCATTCCTTGAGGACAGACCTTAGTTGAAATGATAGCAGAATGTGCTTCTCTCT
1041 GGCAGCTGGCCTTCTGCTTCTGAGTTGCACATTAATCAGATTAGCCTGTATTCTCTTCAGTGAATTTTGATAATGGCTTC
1121 CAGACTCTTTGGCGTTGGAGACGCCTGTTAGGATCTTCAAGTCCCATCATAGAAAATTGAAACACAGAGTTGTTCTGCTG
1201 ATAGTTTTGGGGATACGTCCATCTTTTTAAGGGATTGCTTTCATCTAATTCTGGCAGGACCTCACCAAAAGATCCAGCCT
1281 CATACCTACATCAGACAAAATATCGCCGTTGTTCCTTCTGTACTAAAGTATTGTGTTTTGCTTTGGAAACACCCACTCAC
1361 TTTGCAATAGCCGTGCAAGATGAATGCAGATTACACTGATCTTATGTGTTACAAAATTGGAGAAAGTATTTAATAAAACC
1441 TGTTAATTTTTATACTGACAATAAAAATGTTTCTACAGATATTAATGTTAACAAGACAAAATAAATGTCACGCAACTTAT
1521 TTTTTTAATAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-19b-1-5p :: FGFR2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions HUVEC
Location of target site 3'UTR
Tools used in this research miRanda , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... The expression levels of these targets in the assay were 61% for FGFR2 of that of un- treated HUVECs (Supplemental Fig. S3A, P < 0.05), which conīŦrmed that miR-19b-1 actually down-regulated important factors in the growth signaling pathway. But we did not observe any differences in expression of other predicted targets at mRNA levels. ...

- Yin, R. Bao, W. Xing, Y. Xi, T. Gou, S., 2012, Biochem Biophys Res Commun.

Article - Yin, R. Bao, W. Xing, Y. Xi, T. Gou, S.
- Biochem Biophys Res Commun, 2012
MicroRNAs are endogenously expressed small, non-coding RNAs that modulate biological processes by recognizing specific gene transcripts, leading to translational repression or degradation. Previous work showed that the miR-17-92 cluster is highly expressed in human endothelial cells that participate in angiogenesis. In this study we showed that miR-19b-1, a component of this cluster, controls the intrinsic angiogenic activity of human umbilical vein endothelial cells (HUVECs) in vitro. In silico and in vitro analyses have suggested that miR-19b-1 targets mRNA corresponding to the pro-angiogenic protein, FGFR2, and blocks the cell cycle from the S phase to the G(2)/M phase transition by controlling the expression of cyclin D1. Thus, miR-19b-1 may serve as a valuable therapeutic agent in the context of tumor angiogenesis.
LinkOut: [PMID: 22197821]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
7 hsa-miR-19b-1-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006275 FGFR2 fibroblast growth factor receptor 2 2 1
MIRT006276 CCND1 cyclin D1 1 1
MIRT006277 KDR kinase insert domain receptor (a type III receptor tyrosine kinase) 1 1
MIRT006278 CASP8 caspase 8, apoptosis-related cysteine peptidase 1 1
MIRT006279 ITGB8 integrin, beta 8 1 1
MIRT038978 DNAH8 dynein, axonemal, heavy chain 8 1 1
MIRT038979 ZDHHC6 zinc finger, DHHC-type containing 6 1 1