Accession ID: MIRT006329 [miRNA, hsa-miR-137 :: PTGS2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-137LinkOut: [miRBase ]
Description Homo sapiens miR-137 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-137
Mature Sequence 59| UUAUUGCUUAAGAAUACGCGUAG |81
Evidence Experimental
Experiments Cloned
Putative hsa-miR-137 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PTGS2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms COX-2, COX2, GRIPGHS, PGG/HS, PGHS-2, PHS-2, hCox-2
Description prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Transcript NM_0009    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PTGS2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PTGS2
(miRNA target sites are highlighted)
>PTGS2|NM_0009|3'UTR
   1 TAGAAGTCTAATGATCATATTTATTTATTTATATGAACCATGTCTATTAATTTAATTATTTAATAATATTTATATTAAAC
  81 TCCTTATGTTACTTAACATCTTCTGTAACAGAAGTCAGTACTCCTGTTGCGGAGAAAGGAGTCATACTTGTGAAGACTTT
 161 TATGTCACTACTCTAAAGATTTTGCTGTTGCTGTTAAGTTTGGAAAACAGTTTTTATTCTGTTTTATAAACCAGAGAGAA
 241 ATGAGTTTTGACGTCTTTTTACTTGAATTTCAACTTATATTATAAGAACGAAAGTAAAGATGTTTGAATACTTAAACACT
 321 GTCACAAGATGGCAAAATGCTGAAAGTTTTTACACTGTCGATGTTTCCAATGCATCTTCCATGATGCATTAGAAGTAACT
 401 AATGTTTGAAATTTTAAAGTACTTTTGGTTATTTTTCTGTCATCAAACAAAAACAGGTATCAGTGCATTATTAAATGAAT
 481 ATTTAAATTAGACATTACCAGTAATTTCATGTCTACTTTTTAAAATCAGCAATGAAACAATAATTTGAAATTTCTAAATT
 561 CATAGGGTAGAATCACCTGTAAAAGCTTGTTTGATTTCTTAAAGTTATTAAACTTGTACATATACCAAAAAGAAGCTGTC
 641 TTGGATTTAAATCTGTAAAATCAGTAGAAATTTTACTACAATTGCTTGTTAAAATATTTTATAAGTGATGTTCCTTTTTC
 721 ACCAAGAGTATAAACCTTTTTAGTGTGACTGTTAAAACTTCCTTTTAAATCAAAATGCCAAATTTATTAAGGTGGTGGAG
 801 CCACTGCAGTGTTATCTTAAAATAAGAATATTTTGTTGAGATATTCCAGAATTTGTTTATATGGCTGGTAACATGTAAAA
 881 TCTATATCAGCAAAAGGGTCTACCTTTAAAATAAGCAATAACAAAGAAGAAAACCAAATTATTGTTCAAATTTAGGTTTA
 961 AACTTTTGAAGCAAACTTTTTTTTATCCTTGTGCACTGCAGGCCTGGTACTCAGATTTTGCTATGAGGTTAATGAAGTAC
1041 CAAGCTGTGCTTGAATAATGATATGTTTTCTCAGATTTTCTGTTGTACAGTTTAATTTAGCAGTCCATATCACATTGCAA
1121 AAGTAGCAATGACCTCATAAAATACCTCTTCAAAATGCTTAAATTCATTTCACACATTAATTTTATCTCAGTCTTGAAGC
1201 CAATTCAGTAGGTGCATTGGAATCAAGCCTGGCTACCTGCATGCTGTTCCTTTTCTTTTCTTCTTTTAGCCATTTTGCTA
1281 AGAGACACAGTCTTCTCATCACTTCGTTTCTCCTATTTTGTTTTACTAGTTTTAAGATCAGAGTTCACTTTCTTTGGACT
1361 CTGCCTATATTTTCTTACCTGAACTTTTGCAAGTTTTCAGGTAAACCTCAGCTCAGGACTGCTATTTAGCTCCTCTTAAG
1441 AAGATTAAAAGAGAAAAAAAAAGGCCCTTTTAAAAATAGTATACACTTATTTTAAGTGAAAAGCAGAGAATTTTATTTAT
1521 AGCTAATTTTAGCTATCTGTAACCAAGATGGATGCAAAGAGGCTAGTGCCTCAGAGAGAACTGTACGGGGTTTGTGACTG
1601 GAAAAAGTTACGTTCCCATTCTAATTAATGCCCTTTCTTATTTAAAAACAAAACCAAATGATATCTAAGTAGTTCTCAGC
1681 AATAATAATAATGACGATAATACTTCTTTTCCACATCTCATTGTCACTGACATTTAATGGTACTGTATATTACTTAATTT
1761 ATTGAAGATTATTATTTATGTCTTATTAGGACACTATGGTTATAAACTGTGTTTAAGCCTACAATCATTGATTTTTTTTT
1841 GTTATGTCACAATCAGTATATCTTCTTTGGGGTTACCTCTCTGAATATTATGTAAACAATCCAAAGAAATGATTGTATTA
1921 AGATTTGTGAATAAATTTTTAGAAATCTGATTGGCATATTGAGATATTTAAGGTTGAATGTTTGTCCTTAGGATAGGCCT
2001 ATGTGCTAGCCCACAAAGAATATTGTCTCATTAGCCTGAATGTGCCATAAGACTGACCTTTTAAAATGTTTTGAGGGATC
2081 TGTGGATGCTTCGTTAATTTGTTCAGCCACAATTTATTGAGAAAATATTCTGTGTCAAGCACTGTGGGTTTTAATATTTT
2161 TAAATCAAACGCTGATTACAGATAATAGTATTTATATAAATAATTGAAAAAAATTTTCTTTTGGGAAGAGGGAGAAAATG
2241 AAATAAATATCATTAAAGATAACTCAGGAGAATCTTCTTTACAATTTTACGTTTAGAATGTTTAAGGTTAAGAAAGAAAT
2321 AGTCAATATGCTTGTATAAAACACTGTTCACTGTTTTTTTTAAAAAAAAAACTTGATTTGTTATTAACATTGATCTGCTG
2401 ACAAAACCTGGGAATTTGGGTTGTGTATGCGAATGTTTCAGTGCCTCAGACAAATGTGTATTTAACTTATGTAAAAGATA
2481 AGTCTGGAAATAAATGTCTGTTTATTTTTGTACTATTTAAAAATTGACAGATCTTTTCTGAAGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaugcgCAUAAGAAUUCGUUAUu 5'
                ||| |: | ||||||| 
Target 5' atctaaGTAGTTCTCAGCAATAa 3'
1663 - 1685 157.00 -11.90
2
miRNA  3' gaUGCGCAUA---AGA----AUUCGUUAUu 5'
            | | || |   |:|    ||||||||| 
Target 5' aaAAGGGTCTACCTTTAAAATAAGCAATAa 3'
892 - 921 151.00 -12.40
3
miRNA  3' gaUGCGCAU-AAGAAU-----UCGUUAUu 5'
            |:|: || ||:|||     ||||||: 
Target 5' tcATGTCTACTTTTTAAAATCAGCAATGa 3'
507 - 535 145.00 -8.75
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-137 :: PTGS2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions U87 , LN229
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... miR-137 is able to inhibit Cox-2 protein expression through directly binding to 3' UTR region of Cox-2 mRNA. ...

- Chen, L. Wang, X. Wang, H. Li, Y. Yan, W. et al., 2012, Eur J Cancer.

Article - Chen, L. Wang, X. Wang, H. Li, Y. Yan, W. et al.
- Eur J Cancer, 2012
MicroRNAs are strongly implicated in cancer but their specific roles and functions in the major cancers have yet to be fully elucidated. In this study, we defined the expression and function of miR-137, which we found to be downregulated in glioma samples and glioma cells by qRT-PCR. Ectopic expression of miR-137 in glioma cell lines inhibited proliferation and invasion. Using computational and expression analysis, Cox-2 was identified as a candidate target of miR-137. Reporter assay with 3'UTR of Cox-2 cloned downstream of the luciferase gene showed reduced luciferase activity in the presence of miR-137, providing strong evidence that miR-137 was a direct regulator of Cox-2. Expression analysis further revealed that Cox-2 was elevated in glioma and associated with survival of patients. Furthermore, we observed that Cox-2 knockdown resulted in effects similar to those with miR-137 transfection in glioma cells. In conclusion, our study demonstrates that miR-137 deregulation is common in glioma, and restoration of its function inhibits cell proliferation and invasion, suggesting that miR-137 may act as a tumour suppressor.
LinkOut: [PMID: 22406049]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
13 hsa-miR-137 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002489 E2F6 E2F transcription factor 6 4 1
MIRT002490 CDK6 cyclin-dependent kinase 6 4 5
MIRT004004 NCOA2 nuclear receptor coactivator 2 4 1
MIRT004579 KDM1A lysine (K)-specific demethylase 1A 5 2
MIRT005485 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 3
MIRT005605 CTBP1 C-terminal binding protein 1 4 1
MIRT005883 MITF microphthalmia-associated transcription factor 3 1
MIRT006329 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 2 1
MIRT006957 ESRRA estrogen-related receptor alpha 1 1
MIRT007068 ZNF804A zinc finger protein 804A 1 1
MIRT007092 YBX1 Y box binding protein 1 1 1
MIRT007252 CSE1L CSE1 chromosome segregation 1-like (yeast) 2 1
MIRT007346 PXN paxillin 3 1