Accession ID: MIRT006329 [miRNA, hsa-miR-137 :: PTGS2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-137LinkOut: [miRBase ]
Description Homo sapiens miR-137 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-137
Mature Sequence 59| UUAUUGCUUAAGAAUACGCGUAG |81
Evidence Experimental
Experiments Cloned
Putative hsa-miR-137 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PTGS2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms COX-2, COX2, GRIPGHS, PGG/HS, PGHS-2, PHS-2, hCox-2
Description prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Transcript NM_000963    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PTGS2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PTGS2
(miRNA target sites are highlighted)
>PTGS2|NM_000963|3'UTR
   1 AAGTCTAATGATCATATTTATTTATTTATATGAACCATGTCTATTAATTTAATTATTTAATAATATTTATATTAAACTCC
  81 TTATGTTACTTAACATCTTCTGTAACAGAAGTCAGTACTCCTGTTGCGGAGAAAGGAGTCATACTTGTGAAGACTTTTAT
 161 GTCACTACTCTAAAGATTTTGCTGTTGCTGTTAAGTTTGGAAAACAGTTTTTATTCTGTTTTATAAACCAGAGAGAAATG
 241 AGTTTTGACGTCTTTTTACTTGAATTTCAACTTATATTATAAGAACGAAAGTAAAGATGTTTGAATACTTAAACACTGTC
 321 ACAAGATGGCAAAATGCTGAAAGTTTTTACACTGTCGATGTTTCCAATGCATCTTCCATGATGCATTAGAAGTAACTAAT
 401 GTTTGAAATTTTAAAGTACTTTTGGTTATTTTTCTGTCATCAAACAAAAACAGGTATCAGTGCATTATTAAATGAATATT
 481 TAAATTAGACATTACCAGTAATTTCATGTCTACTTTTTAAAATCAGCAATGAAACAATAATTTGAAATTTCTAAATTCAT
 561 AGGGTAGAATCACCTGTAAAAGCTTGTTTGATTTCTTAAAGTTATTAAACTTGTACATATACCAAAAAGAAGCTGTCTTG
 641 GATTTAAATCTGTAAAATCAGTAGAAATTTTACTACAATTGCTTGTTAAAATATTTTATAAGTGATGTTCCTTTTTCACC
 721 AAGAGTATAAACCTTTTTAGTGTGACTGTTAAAACTTCCTTTTAAATCAAAATGCCAAATTTATTAAGGTGGTGGAGCCA
 801 CTGCAGTGTTATCTTAAAATAAGAATATTTTGTTGAGATATTCCAGAATTTGTTTATATGGCTGGTAACATGTAAAATCT
 881 ATATCAGCAAAAGGGTCTACCTTTAAAATAAGCAATAACAAAGAAGAAAACCAAATTATTGTTCAAATTTAGGTTTAAAC
 961 TTTTGAAGCAAACTTTTTTTTATCCTTGTGCACTGCAGGCCTGGTACTCAGATTTTGCTATGAGGTTAATGAAGTACCAA
1041 GCTGTGCTTGAATAATGATATGTTTTCTCAGATTTTCTGTTGTACAGTTTAATTTAGCAGTCCATATCACATTGCAAAAG
1121 TAGCAATGACCTCATAAAATACCTCTTCAAAATGCTTAAATTCATTTCACACATTAATTTTATCTCAGTCTTGAAGCCAA
1201 TTCAGTAGGTGCATTGGAATCAAGCCTGGCTACCTGCATGCTGTTCCTTTTCTTTTCTTCTTTTAGCCATTTTGCTAAGA
1281 GACACAGTCTTCTCATCACTTCGTTTCTCCTATTTTGTTTTACTAGTTTTAAGATCAGAGTTCACTTTCTTTGGACTCTG
1361 CCTATATTTTCTTACCTGAACTTTTGCAAGTTTTCAGGTAAACCTCAGCTCAGGACTGCTATTTAGCTCCTCTTAAGAAG
1441 ATTAAAAGAGAAAAAAAAAGGCCCTTTTAAAAATAGTATACACTTATTTTAAGTGAAAAGCAGAGAATTTTATTTATAGC
1521 TAATTTTAGCTATCTGTAACCAAGATGGATGCAAAGAGGCTAGTGCCTCAGAGAGAACTGTACGGGGTTTGTGACTGGAA
1601 AAAGTTACGTTCCCATTCTAATTAATGCCCTTTCTTATTTAAAAACAAAACCAAATGATATCTAAGTAGTTCTCAGCAAT
1681 AATAATAATGACGATAATACTTCTTTTCCACATCTCATTGTCACTGACATTTAATGGTACTGTATATTACTTAATTTATT
1761 GAAGATTATTATTTATGTCTTATTAGGACACTATGGTTATAAACTGTGTTTAAGCCTACAATCATTGATTTTTTTTTGTT
1841 ATGTCACAATCAGTATATCTTCTTTGGGGTTACCTCTCTGAATATTATGTAAACAATCCAAAGAAATGATTGTATTAAGA
1921 TTTGTGAATAAATTTTTAGAAATCTGATTGGCATATTGAGATATTTAAGGTTGAATGTTTGTCCTTAGGATAGGCCTATG
2001 TGCTAGCCCACAAAGAATATTGTCTCATTAGCCTGAATGTGCCATAAGACTGACCTTTTAAAATGTTTTGAGGGATCTGT
2081 GGATGCTTCGTTAATTTGTTCAGCCACAATTTATTGAGAAAATATTCTGTGTCAAGCACTGTGGGTTTTAATATTTTTAA
2161 ATCAAACGCTGATTACAGATAATAGTATTTATATAAATAATTGAAAAAAATTTTCTTTTGGGAAGAGGGAGAAAATGAAA
2241 TAAATATCATTAAAGATAACTCAGGAGAATCTTCTTTACAATTTTACGTTTAGAATGTTTAAGGTTAAGAAAGAAATAGT
2321 CAATATGCTTGTATAAAACACTGTTCACTGTTTTTTTTAAAAAAAAAACTTGATTTGTTATTAACATTGATCTGCTGACA
2401 AAACCTGGGAATTTGGGTTGTGTATGCGAATGTTTCAGTGCCTCAGACAAATGTGTATTTAACTTATGTAAAAGATAAGT
2481 CTGGAAATAAATGTCTGTTTATTTTTGTACTATTTAAAAATTGACAGATCTTTTCTGAAGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaugcgCAUAAGAAUUCGUUAUu 5'
                ||| |: | ||||||| 
Target 5' atctaaGTAGTTCTCAGCAATAa 3'
1660 - 1682 157.00 -11.90
2
miRNA  3' gaUGCGCAUA---AGA----AUUCGUUAUu 5'
            | | || |   |:|    ||||||||| 
Target 5' aaAAGGGTCTACCTTTAAAATAAGCAATAa 3'
889 - 918 151.00 -12.40
3
miRNA  3' gaUGCGCAU-AAGAAU-----UCGUUAUu 5'
            |:|: || ||:|||     ||||||: 
Target 5' tcATGTCTACTTTTTAAAATCAGCAATGa 3'
504 - 532 145.00 -8.75
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-137 :: PTGS2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions U87 , LN229
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... miR-137 is able to inhibit Cox-2 protein expression through directly binding to 3' UTR region of Cox-2 mRNA. ...

- Chen, L. Wang, X. Wang, H. Li, Y. Yan, W. et al., 2012, Eur J Cancer.

Article - Chen, L. Wang, X. Wang, H. Li, Y. Yan, W. et al.
- Eur J Cancer, 2012
MicroRNAs are strongly implicated in cancer but their specific roles and functions in the major cancers have yet to be fully elucidated. In this study, we defined the expression and function of miR-137, which we found to be downregulated in glioma samples and glioma cells by qRT-PCR. Ectopic expression of miR-137 in glioma cell lines inhibited proliferation and invasion. Using computational and expression analysis, Cox-2 was identified as a candidate target of miR-137. Reporter assay with 3'UTR of Cox-2 cloned downstream of the luciferase gene showed reduced luciferase activity in the presence of miR-137, providing strong evidence that miR-137 was a direct regulator of Cox-2. Expression analysis further revealed that Cox-2 was elevated in glioma and associated with survival of patients. Furthermore, we observed that Cox-2 knockdown resulted in effects similar to those with miR-137 transfection in glioma cells. In conclusion, our study demonstrates that miR-137 deregulation is common in glioma, and restoration of its function inhibits cell proliferation and invasion, suggesting that miR-137 may act as a tumour suppressor.
LinkOut: [PMID: 22406049]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
122 hsa-miR-137 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002489 E2F6 E2F transcription factor 6 4 1
MIRT002490 CDK6 cyclin-dependent kinase 6 4 7
MIRT004004 NCOA2 nuclear receptor coactivator 2 4 1
MIRT004579 KDM1A lysine (K)-specific demethylase 1A 5 3
MIRT005485 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 4
MIRT005605 CTBP1 C-terminal binding protein 1 4 1
MIRT005883 MITF microphthalmia-associated transcription factor 3 1
MIRT006329 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 2 1
MIRT006957 ESRRA estrogen-related receptor alpha 1 1
MIRT007068 ZNF804A zinc finger protein 804A 1 1
MIRT007092 YBX1 Y box binding protein 1 3 3
MIRT007252 CSE1L CSE1 chromosome segregation 1-like (yeast) 2 1
MIRT007346 PXN paxillin 3 1
MIRT053056 GLIPR1 GLI pathogenesis-related 1 3 1
MIRT053225 MET met proto-oncogene (hepatocyte growth factor receptor) 3 1
MIRT054547 FUNDC1 FUN14 domain containing 1 3 1
MIRT054568 BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 3 1
MIRT090615 PLS1 plastin 1 1 1
MIRT093393 TMA16 translation machinery associated 16 homolog (S. cerevisiae) 1 1
MIRT109230 VMA21 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) 1 3
MIRT153687 NCOA3 nuclear receptor coactivator 3 1 1
MIRT170929 FOXK1 forkhead box K1 1 1
MIRT219251 RREB1 ras responsive element binding protein 1 1 1
MIRT259552 KLHL15 kelch-like 15 (Drosophila) 1 2
MIRT271869 ZNF678 zinc finger protein 678 1 1
MIRT280623 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 4
MIRT293284 DR1 down-regulator of transcription 1, TBP-binding (negative cofactor 2) 1 1
MIRT314017 PAPD7 PAP associated domain containing 7 1 4
MIRT374677 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT437385 FMNL2 formin-like 2 1 1
MIRT437406 RORA RAR-related orphan receptor A 1 1
MIRT437423 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 3 1
MIRT437424 AKT2 v-akt murine thymoma viral oncogene homolog 2 4 3
MIRT437425 TGFB2 transforming growth factor, beta 2 3 1
MIRT437804 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1 1
MIRT437978 COX2 cytochrome c oxidase subunit II 3 1
MIRT438078 TRIM13 tripartite motif containing 13 4 1
MIRT438287 TBX3 T-box 3 1 1
MIRT438288 KLF4 Kruppel-like factor 4 (gut) 1 1
MIRT438537 MTDH metadherin 1 1
MIRT438757 Nr1i3 nuclear receptor subfamily 1, group I, member 3 2 1
MIRT442564 CCDC59 coiled-coil domain containing 59 1 1
MIRT442778 JAG1 jagged 1 1 1
MIRT444302 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT446969 SLCO4C1 solute carrier organic anion transporter family, member 4C1 1 1
MIRT448824 FKBP1A FK506 binding protein 1A, 12kDa 1 2
MIRT453617 SNRPE small nuclear ribonucleoprotein polypeptide E 1 2
MIRT459217 MRPS21 mitochondrial ribosomal protein S21 1 1
MIRT463490 ZC3H11A zinc finger CCCH-type containing 11A 1 6
MIRT470084 PTGES2 prostaglandin E synthase 2 1 1
MIRT475876 H3F3C H3 histone, family 3C 1 5
MIRT475912 H3F3B H3 histone, family 3B (H3.3B) 1 4
MIRT476669 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 5
MIRT477346 EOGT EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase 1 2
MIRT477596 EIF1 eukaryotic translation initiation factor 1 1 5
MIRT478367 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT479111 CNN2 calponin 2 1 1
MIRT482926 CTPS2 CTP synthase 2 1 1
MIRT485083 SNRK SNF related kinase 1 6
MIRT497120 NBEAL1 neurobeachin-like 1 1 1
MIRT498029 UBXN4 UBX domain protein 4 1 4
MIRT500603 UBE2Z ubiquitin-conjugating enzyme E2Z 1 2
MIRT500927 SSFA2 sperm specific antigen 2 1 4
MIRT504324 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504647 RPL9 ribosomal protein L9 1 3
MIRT506304 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 3
MIRT508007 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 2
MIRT510538 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 1
MIRT513051 LYPD6 LY6/PLAUR domain containing 6 1 3
MIRT515223 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 4
MIRT519857 ZFP62 zinc finger protein 62 homolog (mouse) 1 3
MIRT520508 TRAM2 translocation associated membrane protein 2 1 3
MIRT522047 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 2
MIRT524479 CHRM3 cholinergic receptor, muscarinic 3 1 2
MIRT526904 ZNF772 zinc finger protein 772 1 3
MIRT527862 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT528601 ZNF326 zinc finger protein 326 1 1
MIRT532950 ZNF24 zinc finger protein 24 1 2
MIRT536275 LMOD2 leiomodin 2 (cardiac) 1 1
MIRT537045 GRAMD4 GRAM domain containing 4 1 1
MIRT537124 GOLGA3 golgin A3 1 2
MIRT538884 BTBD1 BTB (POZ) domain containing 1 1 1
MIRT541457 AURKA aurora kinase A 1 1
MIRT542924 HOXC8 homeobox C8 1 1
MIRT544580 AP5Z1 adaptor-related protein complex 5, zeta 1 subunit 1 2
MIRT545175 RFTN2 raftlin family member 2 1 1
MIRT545248 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT546473 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT547523 MARCH9 membrane-associated ring finger (C3HC4) 9 1 1
MIRT548071 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT548200 FNIP1 folliculin interacting protein 1 1 1
MIRT551216 CIDEC cell death-inducing DFFA-like effector c 1 1
MIRT553046 USP28 ubiquitin specific peptidase 28 1 1
MIRT553875 SUPT7L suppressor of Ty 7 (S. cerevisiae)-like 1 2
MIRT554026 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT554153 SLX4 SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae) 1 1
MIRT554192 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT554362 SFXN5 sideroflexin 5 1 2
MIRT555349 PPP1R37 protein phosphatase 1, regulatory subunit 37 1 1
MIRT555822 PAX9 paired box 9 1 1
MIRT555866 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT555931 NUP43 nucleoporin 43kDa 1 1
MIRT555993 NFYB nuclear transcription factor Y, beta 1 1
MIRT556429 LONRF3 LON peptidase N-terminal domain and ring finger 3 1 1
MIRT556582 LHFPL2 lipoma HMGIC fusion partner-like 2 1 2
MIRT557220 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 1
MIRT558490 DBN1 drebrin 1 1 1
MIRT560986 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT562291 GLO1 glyoxalase I 1 1
MIRT564093 TLR3 toll-like receptor 3 1 1
MIRT565312 TMEM41A transmembrane protein 41A 1 1
MIRT565424 TEF thyrotrophic embryonic factor 1 1
MIRT566946 LIMCH1 LIM and calponin homology domains 1 1 1
MIRT572369 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT686211 ZNF267 zinc finger protein 267 1 1
MIRT686935 SFT2D3 SFT2 domain containing 3 1 1
MIRT687448 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT710856 COQ7 coenzyme Q7 homolog, ubiquinone (yeast) 1 1
MIRT719484 RBM27 RNA binding motif protein 27 1 1
MIRT719813 TXNDC17 thioredoxin domain containing 17 1 1
MIRT720076 YTHDF3 YTH domain family, member 3 1 1
MIRT723920 ADAMTS15 ADAM metallopeptidase with thrombospondin type 1 motif, 15 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*