Accession ID: MIRT006374 [miRNA, hsa-miR-223-3p :: EPB41L3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-223LinkOut: [miRBase ]
Synonyms MIRN223, miRNA223, mir-223, MIR223
Description Homo sapiens miR-223 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-223-3p
Mature Sequence 68| UGUCAGUUUGUCAAAUACCCCA |89
Evidence Experimental
Experiments Cloned
Putative hsa-miR-223-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-223-3p :: EPB41L3    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions HEK293 , GRS , NSFC , SNU1 , KATO-III , NUGC-3 , AGS , N87 , XGC-9811L
Location of target site 3'UTR
Original Description (Extracted from the article) ... MiR-223 posttranscriptionally down-regulates EPB41L3 expression by directly targeting its 3’-UTR ...

- Li, X. Zhang, Y. Zhang, H. Liu, X. Gong, T. et al., 2011, Mol Cancer Res.

Article - Li, X. Zhang, Y. Zhang, H. Liu, X. Gong, T. et al.
- Mol Cancer Res, 2011
Traditional research modes aim to find cancer-specific single therapeutic target. Recently, emerging evidence suggested that some micro-RNAs (miRNA) can function as oncogenes or tumor suppressors. miRNAs are single-stranded, small noncoding RNA genes that can regulate hundreds of downstream target genes. In this study, we evaluated the miRNA expression patterns in gastric carcinoma and the specific role of miR-223 in gastric cancer metastasis. miRNA expression signature was first analyzed by real-time PCR on 10 paired gastric carcinomas and confirmed in another 20 paired gastric carcinoma tissues. With the 2-fold expression difference as a cutoff level, we identified 22 differential expressed mature miRNAs. Sixteen miRNAs were upregulated in gastric carcinoma, including miR-223, miR-21, miR-23b, miR-222, miR-25, miR-23a, miR-221, miR-107, miR-103, miR-99a, miR-100, miR-125b, miR-92, miR-146a, miR-214 and miR-191, and six miRNAs were downregulated in gastric carcinoma, including let-7a, miR-126, miR-210, miR-181b, miR-197, and miR-30aa-5p. After examining these miRNAs in several human gastric originated cell lines, we found that miR-223 is overexpressed only in metastatic gastric cancer cells and stimulated nonmetastatic gastric cancer cells migration and invasion. Mechanistically, miR-223, induced by the transcription factor Twist, posttranscriptionally downregulates EPB41L3 expression by directly targeting its 3'-untranslated regions. Significantly, overexpression of miR-223 in primary gastric carcinomas is associated with poor metastasis-free survival. These findings indicate a new regulatory mode, namely, specific miRNA, which is activated by its upstream transcription factor, could suppress its direct targets and lead to tumor invasion and metastasis. Mol Cancer Res; 9(7); 1-10. (c)2011 AACR.
LinkOut: [PMID: 21628394]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
90 hsa-miR-223-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000128 MEF2C myocyte enhancer factor 2C 4 3
MIRT000129 STMN1 stathmin 1 4 3
MIRT000130 LMO2 LIM domain only 2 (rhombotin-like 1) 4 3
MIRT000632 E2F1 E2F transcription factor 1 3 1
MIRT001109 RHOB ras homolog family member B 4 3
MIRT004316 NFIX nuclear factor I/X (CCAAT-binding transcription factor) 2 1
MIRT004522 NFIA nuclear factor I/A 5 4
MIRT005373 Arid4b AT rich interactive domain 4B (RBP1-like) 3 1
MIRT005379 Il6 interleukin 6 3 1
MIRT005380 Lpin2 lipin 2 3 1
MIRT005555 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT006237 FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase 4 4
MIRT006244 IGF1R insulin-like growth factor 1 receptor 4 4
MIRT006248 LIF leukemia inhibitory factor 2 1
MIRT006249 SP3 Sp3 transcription factor 2 1
MIRT006374 EPB41L3 erythrocyte membrane protein band 4.1-like 3 2 1
MIRT006559 SLC2A4 solute carrier family 2 (facilitated glucose transporter), member 4 2 1
MIRT006682 ARTN artemin 3 1
MIRT006733 FOXO1 forkhead box O1 3 2
MIRT007086 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT024136 IRS1 insulin receptor substrate 1 1 1
MIRT035551 SCARB1 scavenger receptor class B, member 1 1 1
MIRT052650 PARP1 poly (ADP-ribose) polymerase 1 4 1
MIRT052651 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 2 1
MIRT053070 CDK2 cyclin-dependent kinase 2 3 1
MIRT053107 ECT2 epithelial cell transforming sequence 2 oncogene 2 1
MIRT053243 PTBP2 polypyrimidine tract binding protein 2 2 1
MIRT054047 TAL1 T-cell acute lymphocytic leukemia 1 3 1
MIRT054170 Hnf1a HNF1 homeobox A 1 1
MIRT054622 ATM ataxia telangiectasia mutated 3 1
MIRT054659 CYB5A cytochrome b5 type A (microsomal) 3 1
MIRT054680 TOX thymocyte selection-associated high mobility group box 3 1
MIRT054801 PRDM1 PR domain containing 1, with ZNF domain 4 2
MIRT088093 SEPT2 septin 2 1 1
MIRT093443 MSMO1 methylsterol monooxygenase 1 3 2
MIRT437686 NAMPT nicotinamide phosphoribosyltransferase 2 1
MIRT437687 SNX24 sorting nexin 24 2 1
MIRT437688 CDS1 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 2 1
MIRT437689 SECISBP2L SECIS binding protein 2-like 2 1
MIRT437690 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 2 1
MIRT437691 ZNF365 zinc finger protein 365 2 1
MIRT437995 STAT5A signal transducer and activator of transcription 5A 2 1
MIRT438169 CARM1 coactivator-associated arginine methyltransferase 1 4 1
MIRT438226 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 1 1
MIRT438227 FOXO3 forkhead box O3 1 1
MIRT438228 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT438229 SP1 Sp1 transcription factor 1 1
MIRT438283 CCL3 chemokine (C-C motif) ligand 3 1 1
MIRT438284 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT438285 CXCL2 chemokine (C-X-C motif) ligand 2 1 1
MIRT438673 ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 3 1
MIRT438680 CAPRIN1 cell cycle associated protein 1 3 1
MIRT438685 PAX6 paired box 6 3 1
MIRT438885 CFTR cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) 2 1
MIRT448980 BAG2 BCL2-associated athanogene 2 1 1
MIRT450127 NSUN3 NOP2/Sun domain family, member 3 1 1
MIRT456407 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT462016 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT465435 TP53 tumor protein p53 1 1
MIRT465851 TMEM64 transmembrane protein 64 1 1
MIRT467584 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 3
MIRT468490 SESN3 sestrin 3 1 1
MIRT468899 RRAS2 related RAS viral (r-ras) oncogene homolog 2 1 4
MIRT472081 NOVA2 neuro-oncological ventral antigen 2 1 1
MIRT474248 LATS2 LATS, large tumor suppressor, homolog 2 (Drosophila) 1 1
MIRT477192 F3 coagulation factor III (thromboplastin, tissue factor) 1 4
MIRT486453 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 1
MIRT493112 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 2
MIRT493515 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 2
MIRT501009 SPPL2A signal peptide peptidase like 2A 1 2
MIRT504074 C9orf40 chromosome 9 open reading frame 40 1 3
MIRT505084 ZBTB18 zinc finger protein 238 1 2
MIRT506207 PHF19 PHD finger protein 19 1 1
MIRT513394 CHMP2B charged multivesicular body protein 2B 1 1
MIRT520210 WASL Wiskott-Aldrich syndrome-like 1 1
MIRT526997 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT529177 FABP7 fatty acid binding protein 7, brain 1 1
MIRT533698 TMEM67 transmembrane protein 67 1 1
MIRT555723 PDZD8 PDZ domain containing 8 1 1
MIRT559911 FAM60A family with sequence similarity 60, member A 1 1
MIRT562098 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT576066 Poteg POTE ankyrin domain family, member G 1 1
MIRT620700 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT625449 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT638643 GPATCH8 G patch domain containing 8 1 1
MIRT649226 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT684533 ZNF460 zinc finger protein 460 1 1
MIRT684765 PAX4 paired box 4 1 1
MIRT702966 HEXIM1 hexamethylene bis-acetamide inducible 1 1 1
MIRT707054 TRPV2 transient receptor potential cation channel, subfamily V, member 2 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*