Accession ID: MIRT006374 [miRNA, hsa-miR-223-3p :: EPB41L3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-223LinkOut: [miRBase ]
Synonyms MIRN223, miRNA223, mir-223, MIR223
Description Homo sapiens miR-223 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-223-3p
Mature Sequence 68| UGUCAGUUUGUCAAAUACCCCA |89
Evidence Experimental
Experiments Cloned
Putative hsa-miR-223-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-223-3p :: EPB41L3    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions HEK293 , GRS , NSFC , SNU1 , KATO-III , NUGC-3 , AGS , N87 , XGC-9811L
Location of target site 3'UTR
Original Description (Extracted from the article) ... MiR-223 posttranscriptionally down-regulates EPB41L3 expression by directly targeting its 3’-UTR ...

- Li, X. Zhang, Y. Zhang, H. Liu, X. Gong, T. et al., 2011, Mol Cancer Res.

Article - Li, X. Zhang, Y. Zhang, H. Liu, X. Gong, T. et al.
- Mol Cancer Res, 2011
Traditional research modes aim to find cancer-specific single therapeutic target. Recently, emerging evidence suggested that some micro-RNAs (miRNA) can function as oncogenes or tumor suppressors. miRNAs are single-stranded, small noncoding RNA genes that can regulate hundreds of downstream target genes. In this study, we evaluated the miRNA expression patterns in gastric carcinoma and the specific role of miR-223 in gastric cancer metastasis. miRNA expression signature was first analyzed by real-time PCR on 10 paired gastric carcinomas and confirmed in another 20 paired gastric carcinoma tissues. With the 2-fold expression difference as a cutoff level, we identified 22 differential expressed mature miRNAs. Sixteen miRNAs were upregulated in gastric carcinoma, including miR-223, miR-21, miR-23b, miR-222, miR-25, miR-23a, miR-221, miR-107, miR-103, miR-99a, miR-100, miR-125b, miR-92, miR-146a, miR-214 and miR-191, and six miRNAs were downregulated in gastric carcinoma, including let-7a, miR-126, miR-210, miR-181b, miR-197, and miR-30aa-5p. After examining these miRNAs in several human gastric originated cell lines, we found that miR-223 is overexpressed only in metastatic gastric cancer cells and stimulated nonmetastatic gastric cancer cells migration and invasion. Mechanistically, miR-223, induced by the transcription factor Twist, posttranscriptionally downregulates EPB41L3 expression by directly targeting its 3'-untranslated regions. Significantly, overexpression of miR-223 in primary gastric carcinomas is associated with poor metastasis-free survival. These findings indicate a new regulatory mode, namely, specific miRNA, which is activated by its upstream transcription factor, could suppress its direct targets and lead to tumor invasion and metastasis. Mol Cancer Res; 9(7); 1-10. (c)2011 AACR.
LinkOut: [PMID: 21628394]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
24 hsa-miR-223-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000128 MEF2C myocyte enhancer factor 2C 4 3
MIRT000129 STMN1 stathmin 1 4 2
MIRT000130 LMO2 LIM domain only 2 (rhombotin-like 1) 4 3
MIRT000632 E2F1 E2F transcription factor 1 3 1
MIRT001109 RHOB ras homolog family member B 4 3
MIRT004316 NFIX nuclear factor I/X (CCAAT-binding transcription factor) 2 1
MIRT004522 NFIA nuclear factor I/A 5 4
MIRT005373 Arid4b AT rich interactive domain 4B (RBP1-like) 3 1
MIRT005379 Il6 interleukin 6 3 1
MIRT005380 Lpin2 lipin 2 3 1
MIRT005555 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT006237 FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase 3 1
MIRT006244 IGF1R insulin-like growth factor 1 receptor 2 1
MIRT006248 LIF leukemia inhibitory factor 2 1
MIRT006249 SP3 Sp3 transcription factor 2 1
MIRT006374 EPB41L3 erythrocyte membrane protein band 4.1-like 3 2 1
MIRT006559 SLC2A4 solute carrier family 2 (facilitated glucose transporter), member 4 2 1
MIRT006682 ARTN artemin 3 1
MIRT006733 FOXO1 forkhead box O1 3 1
MIRT007086 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT024136 IRS1 insulin receptor substrate 1 1 1
MIRT035551 SCARB1 scavenger receptor class B, member 1 1 1
MIRT052650 PARP1 poly (ADP-ribose) polymerase 1 4 1
MIRT052651 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 2 1