Accession ID: MIRT006397 [miRNA, hsa-miR-98-5p :: IL13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-98LinkOut: [miRBase ]
Synonyms MIRN98, hsa-mir-98, miR-98, MIR98
Description Homo sapiens miR-98 stem-loop
Comment This sequence is localised to chromosome X and was named mir-98-X in reference . The predicted stem-loop precursor sequence is clearly related to let-7.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-98-5p
Mature Sequence 22| UGAGGUAGUAAGUUGUAUUGUU |43
Evidence Experimental
Experiments Cloned
Putative hsa-miR-98-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ALRH, BHR1, IL-13, MGC116786, MGC116788, MGC116789, P600
Description interleukin 13
Transcript NM_0021    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL13
(miRNA target sites are highlighted)
>IL13|NM_0021|3'UTR
   1 TGAAACTTCGAAAGCATCATTATTTGCAGAGACAGGACCTGACTATTGAAGTTGCAGATTCATTTTTCTTTCTGATGTCA
  81 AAAATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTC
 161 TTCAGCCTAGCCGACCTCAGCCTTCCCCTTGCCCAGGGCTCAGCCTGGTGGGCCTCCTCTGTCCAGGGCCCTGAGCTCGG
 241 TGGACCCAGGGATGACATGTCCCTACACCCCTCCCCTGCCCTAGAGCACACTGTAGCATTACAGTGGGTGCCCCCCTTGC
 321 CAGACATGTGGTGGGACAGGGACCCACTTCACACACAGGCAACTGAGGCAGACAGCAGCTCAGGCACACTTCTTCTTGGT
 401 CTTATTTATTATTGTGTGTTATTTAAATGAGTGTGTTTGTCACCGTTGGGGATTGGGGAAGACTGTGGCTGCTAGCACTT
 481 GGAGCCAAGGGTTCAGAGACTCAGGGCCCCAGCACTAAAGCAGTGGACACCAGGAGTCCCTGGTAATAAGTACTGTGTAC
 561 AGAATTCTGCTACCTCACTGGGGTCCTGGGGCCTCGGAGCCTCATCCGAGGCAGGGTCAGGAGAGGGGCAGAACAGCCGC
 641 TCCTGTCTGCCAGCCAGCAGCCAGCTCTCAGCCAACGAGTAATTTATTGTTTTTCCTTGTATTTAAATATTAAATATGTT
 721 AGCAAAGAGTTAATATATAGAAGGGTACCTTGAACACTGGGGGAGGGGACATTGAACAAGTTGTTTCATTGACTATCAAA
 801 CTGAAGCCAGAAATAAAGTTGGTGACAGAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuguUAUG--UUGA-AUGAUGGAGu 5'
              :|||  ||:| |:||||||| 
Target 5' ctgtGTACAGAATTCTGCTACCTCa 3'
553 - 577 160.00 -17.20
2
miRNA  3' uuguuAUGUUGAAU--GAUGGAGu 5'
               | ||:| ||  | ||||| 
Target 5' ccgtcTTCAGCCTAGCCGACCTCa 3'
156 - 179 123.00 -10.10
3
miRNA  3' uuGUUAUGUUGAAU-GA---UGGAGu 5'
            :|| |:  |||| ||   ||||| 
Target 5' ggTAAAATTCCTTAGCTTAGACCTCa 3'
119 - 144 112.00 -13.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-98-5p :: IL13    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions A549
Location of target site 3'UTR
Tools used in this research miRanda , RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Let-7 targets IL13 3 'UTR ...

- Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al., 2011, The Journal of allergy and clinical immunology.

Article - Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al.
- The Journal of allergy and clinical immunology, 2011
BACKGROUND: IL-13, a cytokine secreted by T(H)2 lymphocytes and other cells, critically modulates allergic inflammation and tissue remodeling in allergic asthma. Although much is known about transcriptional regulation of IL-13, posttranscriptional regulation is poorly understood. OBJECTIVE: Because many inflammatory pathways are known to be regulated by microRNAs, permitting a rapid and fine-tuned response, the role of microRNA-mediated regulation of IL-13 was investigated using both in vitro and in vivo studies. METHODS: A combination of in silico approaches and in vitro transfections in A549 cells and primary cultured T cells was used to demonstrate the involvement of let-7 in IL-13 regulation. Furthermore, intranasal delivery of let-7 microRNA mimic in mice was performed to study its effects in allergic airway inflammatory conditions. RESULTS: Using a combination of bioinformatics and molecular approaches, we demonstrate that the let-7 family of microRNAs regulates IL-13 expression. Induced levels of IL-13 in cultured T cells were inversely related to let-7 levels. In an IL-13-dependent murine model of allergic airway inflammation, we observed that inflammation was associated with a reduction in most of the members of the let-7 family. Exogenous administration of let-7 mimic to lungs of mice with allergic inflammation resulted in a decrease in IL-13 levels, resolution of airway inflammation, reduction in airway hyperresponsiveness, and attenuation of mucus metaplasia and subepithelial fibrosis. CONCLUSION: Let-7 microRNAs inhibit IL-13 expression and represent a major regulatory mechanism for modulating IL-13 secretion in IL-13-producing cell types and thereby T(H)2 inflammation.
LinkOut: [PMID: 21616524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
499 hsa-miR-98-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001124 E2F1 E2F transcription factor 1 2 1
MIRT001126 E2F2 E2F transcription factor 2 4 1
MIRT002999 HMGA2 high mobility group AT-hook 2 4 3
MIRT003438 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 4
MIRT004305 NCOA3 nuclear receptor coactivator 3 3 2
MIRT004411 TUSC2 tumor suppressor candidate 2 4 3
MIRT004941 ZFP36L1 zinc finger protein 36, C3H type-like 1 2 1
MIRT004942 ZMPSTE24 zinc metallopeptidase (STE24 homolog, S. cerevisiae) 2 1
MIRT004943 THBS1 thrombospondin 1 3 2
MIRT004944 SERP1 stress-associated endoplasmic reticulum protein 1 2 1
MIRT004945 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 3 2
MIRT004946 MEIS1 Meis homeobox 1 2 1
MIRT004947 CNOT4 CCR4-NOT transcription complex, subunit 4 2 1
MIRT004948 HNRPDL heterogeneous nuclear ribonucleoprotein D-like 2 1
MIRT004949 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 2 1
MIRT004950 CBX5 chromobox homolog 5 (HP1 alpha homolog, Drosophila) 2 1
MIRT004951 CHRNB1 cholinergic receptor, nicotinic, beta 1 (muscle) 2 1
MIRT004953 ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain 2 1
MIRT005326 SOCS4 suppressor of cytokine signaling 4 4 1
MIRT005676 KLF13 Kruppel-like factor 13 1 1
MIRT005677 CCL5 chemokine (C-C motif) ligand 5 0 1
MIRT005721 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 2
MIRT006397 IL13 interleukin 13 2 1
MIRT006408 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT007106 CCNJ cyclin J 2 2
MIRT027399 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT027400 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT027401 MIR671 microRNA 671 1 1
MIRT027402 COLGALT1 glycosyltransferase 25 domain containing 1 1 1
MIRT027403 ZFAND3 zinc finger, AN1-type domain 3 1 1
MIRT027404 GCNT2 glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) 1 1
MIRT027405 INHBE inhibin, beta E 1 1
MIRT027406 SNX24 sorting nexin 24 1 1
MIRT027407 SUV39H1 suppressor of variegation 3-9 homolog 1 (Drosophila) 1 1
MIRT027408 HIST2H4A histone cluster 2, H4a 1 1
MIRT027409 KCNJ15 potassium inwardly-rectifying channel, subfamily J, member 15 1 1
MIRT027410 WBP11 WW domain binding protein 11 1 1
MIRT027411 BFAR bifunctional apoptosis regulator 1 1
MIRT027412 ARRB1 arrestin, beta 1 1 1
MIRT027413 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT027414 VPS54 vacuolar protein sorting 54 homolog (S. cerevisiae) 1 1
MIRT027415 GATA6 GATA binding protein 6 1 1
MIRT027416 USP10 ubiquitin specific peptidase 10 1 1
MIRT027417 TIMM17B translocase of inner mitochondrial membrane 17 homolog B (yeast) 1 1
MIRT027418 FADS3 fatty acid desaturase 3 1 1
MIRT027419 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT027420 GMPR2 guanosine monophosphate reductase 2 1 1
MIRT027421 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT027422 MED8 mediator complex subunit 8 1 1
MIRT027423 IL6R interleukin 6 receptor 1 1
MIRT027424 COIL coilin 1 1
MIRT027425 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT027426 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT027427 CHRNA9 cholinergic receptor, nicotinic, alpha 9 1 1
MIRT027428 ARCN1 archain 1 1 1
MIRT027429 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT027430 A2M alpha-2-macroglobulin 1 1
MIRT027431 TPST2 tyrosylprotein sulfotransferase 2 1 1
MIRT027432 ZNF573 zinc finger protein 573 1 1
MIRT027433 GRPEL1 GrpE-like 1, mitochondrial (E. coli) 1 1
MIRT027434 TMEM45A transmembrane protein 45A 1 1
MIRT027435 TEAD4 TEA domain family member 4 1 1
MIRT027436 SUPV3L1 suppressor of var1, 3-like 1 (S. cerevisiae) 1 1
MIRT027437 BIRC3 baculoviral IAP repeat-containing 3 1 1
MIRT027438 MYBBP1A MYB binding protein (P160) 1a 1 1
MIRT027439 CA9 carbonic anhydrase IX 1 1
MIRT027440 GABRE gamma-aminobutyric acid (GABA) A receptor, epsilon 1 1
MIRT027441 ECM2 extracellular matrix protein 2, female organ and adipocyte specific 1 1
MIRT027442 CALCB calcitonin-related polypeptide beta 1 1
MIRT027443 ASMTL acetylserotonin O-methyltransferase-like 1 1
MIRT027444 TNFRSF9 tumor necrosis factor receptor superfamily, member 9 1 1
MIRT027445 SNORA25 small nucleolar RNA, H/ACA box 25 1 1
MIRT027446 USP3 ubiquitin specific peptidase 3 1 1
MIRT027447 FOXO1 forkhead box O1 1 1
MIRT027448 SORD sorbitol dehydrogenase 1 1
MIRT027449 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT027450 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT027451 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT027452 PPAN peter pan homolog (Drosophila) 1 1
MIRT027453 PUS1 pseudouridylate synthase 1 1 1
MIRT027454 CYB5R3 cytochrome b5 reductase 3 1 1
MIRT027455 HIST1H2BE histone cluster 1, H2be 1 1
MIRT027456 TRAF1 TNF receptor-associated factor 1 1 1
MIRT027457 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT027458 TMEM164 transmembrane protein 164 1 1
MIRT027459 ST5 suppression of tumorigenicity 5 1 1
MIRT027460 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT027461 AVEN apoptosis, caspase activation inhibitor 1 1
MIRT027462 CPOX coproporphyrinogen oxidase 1 1
MIRT027463 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT027464 LPCAT3 lysophosphatidylcholine acyltransferase 3 1 1
MIRT027465 SNX5 sorting nexin 5 1 1
MIRT027466 HMMR hyaluronan-mediated motility receptor (RHAMM) 1 1
MIRT027467 RND3 Rho family GTPase 3 1 1
MIRT027468 RASAL2 RAS protein activator like 2 1 1
MIRT027469 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT027470 SERTAD2 SERTA domain containing 2 1 1
MIRT027471 PRDM4 PR domain containing 4 1 1
MIRT027472 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT027473 NIPSNAP1 nipsnap homolog 1 (C. elegans) 1 1
MIRT027474 MMACHC methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria 1 1
MIRT027475 KIAA0922 KIAA0922 1 1
MIRT027476 ATG9A ATG9 autophagy related 9 homolog A (S. cerevisiae) 1 1
MIRT027477 TMEM8A transmembrane protein 8A 1 1
MIRT027478 ARSJ arylsulfatase family, member J 1 1
MIRT027479 RNF13 ring finger protein 13 1 1
MIRT027480 XPO4 exportin 4 1 1
MIRT027481 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT027482 SMAD7 SMAD family member 7 1 1
MIRT027483 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT027484 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT027485 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT027486 CANT1 calcium activated nucleotidase 1 1 1
MIRT027487 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT027488 TTI1 KIAA0406 1 1
MIRT027489 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT027490 MLXIP MLX interacting protein 1 1
MIRT027491 MAGEA6 melanoma antigen family A, 6 1 1
MIRT027492 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT027493 VAV3 vav 3 guanine nucleotide exchange factor 1 1
MIRT027494 STEAP3 STEAP family member 3 1 1
MIRT027495 MTF2 metal response element binding transcription factor 2 1 1
MIRT027496 TLDC1 KIAA1609 1 1
MIRT027497 GALNT2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) 1 1
MIRT027498 ADCY9 adenylate cyclase 9 1 1
MIRT027499 TRIB1 tribbles homolog 1 (Drosophila) 1 1
MIRT027500 ATP13A3 ATPase type 13A3 1 1
MIRT027501 YIPF1 Yip1 domain family, member 1 1 1
MIRT027502 ZNF473 zinc finger protein 473 1 1
MIRT027503 MED6 mediator complex subunit 6 1 1
MIRT027504 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT027505 ZNF202 zinc finger protein 202 1 1
MIRT027506 DUSP9 dual specificity phosphatase 9 1 1
MIRT027507 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT027508 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT027509 TAF5 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa 1 1
MIRT027510 PXDN peroxidasin homolog (Drosophila) 1 1
MIRT027511 RGS16 regulator of G-protein signaling 16 1 1
MIRT027512 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 1
MIRT027513 TARBP2 TAR (HIV-1) RNA binding protein 2 1 1
MIRT027514 CPA4 carboxypeptidase A4 1 1
MIRT027515 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT027516 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT027517 OSMR oncostatin M receptor 1 1
MIRT027518 BMP2K BMP2 inducible kinase 1 1
MIRT027519 IFI16 interferon, gamma-inducible protein 16 1 1
MIRT027520 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT027521 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 'protein-coding 1 1
MIRT027522 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT027523 CNNM4 cyclin M4 1 1
MIRT027524 IL32 interleukin 32 1 1
MIRT027525 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT027526 COQ10B coenzyme Q10 homolog B (S. cerevisiae) 1 1
MIRT027527 HIST1H4H histone cluster 1, H4h 1 1
MIRT027528 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 1 1
MIRT027529 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT027530 PALMD palmdelphin 1 1
MIRT027531 SCHIP1 schwannomin interacting protein 1 1 1
MIRT027532 NUAK2 NUAK family, SNF1-like kinase, 2 1 1
MIRT027533 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT027534 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT027535 ZNF74 zinc finger protein 74 1 1
MIRT027536 HIST2H2BC histone cluster 2, H2bc 1 1
MIRT027537 STC2 stanniocalcin 2 1 1
MIRT027538 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT027539 NARF nuclear prelamin A recognition factor 1 1
MIRT027540 PALM2-AKAP2 PALM2-AKAP2 readthrough 1 1
MIRT027541 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 1
MIRT027542 EMR2 egf-like module containing, mucin-like, hormone receptor-like 2 1 1
MIRT027543 B4GALT3 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 1 1
MIRT027544 HIST1H2BH histone cluster 1, H2bh 1 1
MIRT027545 JAG1 jagged 1 (Alagille syndrome) 1 1
MIRT027546 MFSD5 major facilitator superfamily domain containing 5 1 1
MIRT027547 PDCD11 programmed cell death 11 1 1
MIRT027548 RTCA RNA terminal phosphate cyclase domain 1 1 1
MIRT027549 AKAP2 A kinase (PRKA) anchor protein 2 1 1
MIRT027550 HIST1H2BL histone cluster 1, H2bl 1 1
MIRT027551 NPR3 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 1 1
MIRT027552 SPRY1 sprouty homolog 1, antagonist of FGF signaling (Drosophila) 1 1
MIRT027553 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT027554 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT027555 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT027556 MBNL2 muscleblind-like 2 (Drosophila) 1 1
MIRT027557 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT027558 MGEA5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT027559 CDK17 cyclin-dependent kinase 17 1 1
MIRT027560 RASSF9 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 1 1
MIRT027561 PARP12 poly (ADP-ribose) polymerase family, member 12 1 1
MIRT027562 AHR aryl hydrocarbon receptor 1 1
MIRT027563 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT027564 MYLK3 myosin light chain kinase 3 1 1
MIRT027565 ZNF281 zinc finger protein 281 1 1
MIRT027566 EIF4E2 eukaryotic translation initiation factor 4E family member 2 1 1
MIRT027567 COX10 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) 1 1
MIRT027568 LRFN4 leucine rich repeat and fibronectin type III domain containing 4 1 1
MIRT027569 RHBDF2 rhomboid 5 homolog 2 (Drosophila) 1 1
MIRT027570 EIF3J eukaryotic translation initiation factor 3, subunit J 1 1
MIRT027571 TEAD1 TEA domain family member 1 (SV40 transcriptional enhancer factor) 1 1
MIRT027572 ROR1 receptor tyrosine kinase-like orphan receptor 1 1 1
MIRT027573 C10orf88 chromosome 10 open reading frame 88 1 1
MIRT027574 GPR56 G protein-coupled receptor 56 1 1
MIRT027575 BIN3 bridging integrator 3 1 1
MIRT027576 DOCK4 dedicator of cytokinesis 4 1 1
MIRT027577 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT027578 BAZ1A bromodomain adjacent to zinc finger domain, 1A 1 1
MIRT027579 RBPMS RNA binding protein with multiple splicing 1 1
MIRT027580 TMEM2 transmembrane protein 2 1 1
MIRT027581 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT027582 DOLK dolichol kinase 1 1
MIRT027583 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT027584 MAPRE1 microtubule-associated protein, RP/EB family, member 1 1 1
MIRT027585 RPAP1 RNA polymerase II associated protein 1 1 1
MIRT027586 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT027587 MIOS missing oocyte, meiosis regulator, homolog (Drosophila) 1 1
MIRT027588 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT027589 POM121C POM121 membrane glycoprotein C 1 1
MIRT027590 UBE2D3 ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) 1 1
MIRT027591 BTN2A1 butyrophilin, subfamily 2, member A1 1 1
MIRT027592 CEBPD CCAAT/enhancer binding protein (C/EBP), delta 1 1
MIRT027593 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT027594 CLP1 CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae) 1 1
MIRT027595 GNG5P2 guanine nucleotide binding protein (G protein), gamma 5 pseudogene 2 1 1
MIRT027596 TSC22D2 TSC22 domain family, member 2 1 1
MIRT027597 WDR73 WD repeat domain 73 1 1
MIRT027598 FAS Fas (TNF receptor superfamily, member 6) 1 1
MIRT027599 TXLNG taxilin gamma 1 1
MIRT027600 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT027601 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT027602 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha 1 1
MIRT027603 TTLL4 tubulin tyrosine ligase-like family, member 4 1 1
MIRT027604 TMEM38B transmembrane protein 38B 1 1
MIRT027605 SPARCL1 SPARC-like 1 (hevin) 1 1
MIRT027606 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT027607 IER3 immediate early response 3 1 1
MIRT027608 TMEM147 transmembrane protein 147 1 1
MIRT027609 ZDHHC3 zinc finger, DHHC-type containing 3 1 1
MIRT027610 KLF10 Kruppel-like factor 10 1 1
MIRT027611 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT027612 MITF microphthalmia-associated transcription factor 1 1
MIRT027613 RAPGEF4 Rap guanine nucleotide exchange factor (GEF) 4 1 1
MIRT027614 SGMS1 sphingomyelin synthase 1 1 1
MIRT027615 ICAM1 intercellular adhesion molecule 1 1 1
MIRT027616 CHPF2 chondroitin polymerizing factor 2 1 1
MIRT027617 WDR74 WD repeat domain 74 1 1
MIRT027618 OXA1L oxidase (cytochrome c) assembly 1-like 1 1
MIRT027619 RABGGTB Rab geranylgeranyltransferase, beta subunit 1 1
MIRT027620 TES testis derived transcript (3 LIM domains) 1 1
MIRT027621 DUSP10 dual specificity phosphatase 10 1 1
MIRT027622 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT027623 MOB3B MOB1, Mps One Binder kinase activator-like 2B (yeast) 1 1
MIRT027624 HIST1H2BF histone cluster 1, H2bf 1 1
MIRT027625 SYNGR2 synaptogyrin 2 1 1
MIRT027626 GPR37 G protein-coupled receptor 37 (endothelin receptor type B-like) 1 1
MIRT027627 ZFX zinc finger protein, X-linked 1 1
MIRT027628 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 1
MIRT027629 HIST1H2BI histone cluster 1, H2bi 1 1
MIRT027630 TEX10 testis expressed 10 1 1
MIRT027631 TBC1D4 TBC1 domain family, member 4 1 1
MIRT027632 NAV2 neuron navigator 2 1 1
MIRT027633 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT027634 PDSS1 prenyl (decaprenyl) diphosphate synthase, subunit 1 1 1
MIRT027635 ACTL8 actin-like 8 1 1
MIRT027636 WDR33 WD repeat domain 33 1 1
MIRT027637 PPT2 palmitoyl-protein thioesterase 2 1 1
MIRT027638 FZD10 frizzled homolog 10 (Drosophila) 1 1
MIRT027639 CLINT1 clathrin interactor 1 1 1
MIRT027640 FAM134C family with sequence similarity 134, member C 1 1
MIRT027641 C8orf4 chromosome 8 open reading frame 4 1 1
MIRT027642 HIST1H2AG histone cluster 1, H2ag 1 1
MIRT027643 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT027644 NFKB2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) 1 1
MIRT027645 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT027646 DOCK5 dedicator of cytokinesis 5 1 1
MIRT027647 HIST1H3D histone cluster 1, H3d 1 1
MIRT027648 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT027649 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT027650 KLF3 Kruppel-like factor 3 (basic) 1 1
MIRT027651 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT027652 CNIH cornichon homolog (Drosophila) 1 1
MIRT027653 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT027654 STK17B serine/threonine kinase 17b 1 1
MIRT027655 MED24 mediator complex subunit 24 1 1
MIRT027656 COG5 component of oligomeric golgi complex 5 1 1
MIRT027657 RBM19 RNA binding motif protein 19 1 1
MIRT027658 HSPB7 heat shock 27kDa protein family, member 7 (cardiovascular) 1 1
MIRT027659 IFNAR1 interferon (alpha, beta and omega) receptor 1 1 1
MIRT027660 RAB30 RAB30, member RAS oncogene family 1 1
MIRT027661 THOC5 THO complex 5 1 1
MIRT027662 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT027663 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT027664 SLC25A13 solute carrier family 25, member 13 (citrin) 1 1
MIRT027665 HK2 hexokinase 2 1 1
MIRT027666 AGPS alkylglycerone phosphate synthase 1 1
MIRT027667 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT027668 SLC16A3 solute carrier family 16, member 3 (monocarboxylic acid transporter 4) 1 1
MIRT027669 PIGC phosphatidylinositol glycan anchor biosynthesis, class C 1 1
MIRT027670 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT027671 VGLL3 vestigial like 3 (Drosophila) 1 1
MIRT027672 PLK2 polo-like kinase 2 (Drosophila) 1 1
MIRT027673 HDHD1 haloacid dehalogenase-like hydrolase domain containing 1A 1 1
MIRT027674 IQCB1 IQ motif containing B1 1 1
MIRT027675 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT027676 ALKBH1 alkB, alkylation repair homolog 1 (E. coli) 1 1
MIRT027677 SLC35F2 solute carrier family 35, member F2 1 1
MIRT027678 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 1
MIRT027679 FAM60A family with sequence similarity 60, member A 1 1
MIRT027680 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT027681 CRTAP cartilage associated protein 1 1
MIRT027682 E2F6 E2F transcription factor 6 1 1
MIRT027683 MAGEA2B melanoma antigen family A, 2B 1 1
MIRT027684 ESRP2 epithelial splicing regulatory protein 2 1 1
MIRT027685 ADA adenosine deaminase 1 1
MIRT027686 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT027687 CDC34 cell division cycle 34 homolog (S. cerevisiae) 1 1
MIRT027688 GDAP2 ganglioside induced differentiation associated protein 2 1 1
MIRT027689 SENP2 SUMO1/sentrin/SMT3 specific peptidase 2 1 1
MIRT027690 ASAP1 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 1 1
MIRT027691 RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 1 1
MIRT027692 SLC35D2 solute carrier family 35, member D2 1 1
MIRT027693 DIDO1 death inducer-obliterator 1 1 1
MIRT027694 HIST1H2BO histone cluster 1, H2bo 1 1
MIRT027695 HIST1H2BC histone cluster 1, H2bc 1 1
MIRT027696 LTBR lymphotoxin beta receptor (TNFR superfamily, member 3) 1 1
MIRT027697 SLC25A32 solute carrier family 25, member 32 1 1
MIRT027698 PTTG1IP pituitary tumor-transforming 1 interacting protein 1 1
MIRT027699 MTPAP mitochondrial poly(A) polymerase 1 1
MIRT027700 NRBF2 nuclear receptor binding factor 2 1 1
MIRT027701 FAM69A family with sequence similarity 69, member A 1 1
MIRT027702 LMO7 LIM domain 7 1 1
MIRT027703 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT027704 NFIL3 nuclear factor, interleukin 3 regulated 1 1
MIRT027705 SEMA3C sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C 1 1
MIRT027706 SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 1 1
MIRT027707 PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 1 1
MIRT027708 MRTO4 mRNA turnover 4 homolog (S. cerevisiae) 1 1
MIRT027709 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT027710 NNMT nicotinamide N-methyltransferase 1 1
MIRT027711 HIST2H4B histone cluster 2, H4b 1 1
MIRT027712 MAGEB2 melanoma antigen family B, 2 1 1
MIRT027713 RNF111 ring finger protein 111 1 1
MIRT027714 CDKN2B cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) 1 1
MIRT027715 AIM1 absent in melanoma 1 1 1
MIRT027716 KCTD5 potassium channel tetramerisation domain containing 5 1 1
MIRT027717 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT027718 POLR1D polymerase (RNA) I polypeptide D, 16kDa 1 1
MIRT027719 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT027720 AKR1C3 aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) 1 1
MIRT027721 ZKSCAN8 zinc finger protein 192 1 1
MIRT027722 IFNGR1 interferon gamma receptor 1 1 1
MIRT027723 C10orf2 chromosome 10 open reading frame 2 1 1
MIRT027724 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT027725 HEG1 HEG homolog 1 (zebrafish) 1 1
MIRT027726 CXCL2 chemokine (C-X-C motif) ligand 2 1 1
MIRT027727 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT027728 NREP chromosome 5 open reading frame 13 1 1
MIRT027729 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT027730 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT027731 PLAGL1 pleiomorphic adenoma gene-like 1 1 1
MIRT027732 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT027733 VAMP3 vesicle-associated membrane protein 3 (cellubrevin) 1 1
MIRT027734 SOAT1 sterol O-acyltransferase 1 1 1
MIRT027735 NUP98 nucleoporin 98kDa 1 1
MIRT027736 RGS19 regulator of G-protein signaling 19 1 1
MIRT027737 P2RX5 purinergic receptor P2X, ligand-gated ion channel, 5 1 1
MIRT027738 UTP20 UTP20, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT027739 DENND1A DENN/MADD domain containing 1A 1 1
MIRT027740 URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 1 1
MIRT027741 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT027742 SLC19A3 solute carrier family 19, member 3 1 1
MIRT027743 TBC1D30 TBC1 domain family, member 30 1 1
MIRT027744 KCTD14 potassium channel tetramerisation domain containing 14 1 1
MIRT027745 LRIG1 leucine-rich repeats and immunoglobulin-like domains 1 1 1
MIRT027746 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 1 1
MIRT027747 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 1 1
MIRT027748 FLAD1 FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) 1 1
MIRT027749 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT027750 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 1
MIRT027751 TRAM2 translocation associated membrane protein 2 1 1
MIRT027752 DBF4 DBF4 homolog (S. cerevisiae) 1 1
MIRT027753 ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 1 1
MIRT027754 ZFHX3 zinc finger homeobox 3 1 1
MIRT027755 TMEM41B transmembrane protein 41B 1 1
MIRT027756 FAM46C family with sequence similarity 46, member C 1 1
MIRT027757 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT027758 ALG8 asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae) 1 1
MIRT027759 GLMN glomulin, FKBP associated protein 1 1
MIRT027760 ERGIC2 ERGIC and golgi 2 1 1
MIRT027761 C6orf211 chromosome 6 open reading frame 211 1 1
MIRT027762 IMP4 IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT027763 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT027764 DPAGT1 dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase) 1 1
MIRT027765 CTSC cathepsin C 1 1
MIRT027766 DTX4 deltex homolog 4 (Drosophila) 1 1
MIRT027767 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 1
MIRT027768 S100A8 S100 calcium binding protein A8 1 1
MIRT027769 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT027770 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 1 1
MIRT027771 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT027772 NME6 non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) 1 1
MIRT027773 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 1
MIRT027774 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT027775 PCTP phosphatidylcholine transfer protein 1 1
MIRT027776 ZNF200 zinc finger protein 200 1 1
MIRT027777 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT027778 FZD3 frizzled homolog 3 (Drosophila) 1 1
MIRT027779 CLUH KIAA0664 1 1
MIRT027780 CCNF cyclin F 1 1
MIRT027781 SEMA3G sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G 1 1
MIRT027782 SLC2A14 solute carrier family 2 (facilitated glucose transporter), member 14 1 1
MIRT027783 CXCR7 chemokine (C-X-C motif) receptor 7 1 1
MIRT027784 PICALM phosphatidylinositol binding clathrin assembly protein 1 1
MIRT027785 TNS1 tensin 1 1 1
MIRT027786 SOX4 SRY (sex determining region Y)-box 4 1 1
MIRT027787 CDK7 cyclin-dependent kinase 7 1 1
MIRT027788 SCG2 secretogranin II 1 1
MIRT027789 MCAT malonyl CoA:ACP acyltransferase (mitochondrial) 1 1
MIRT027790 GNA12 guanine nucleotide binding protein (G protein) alpha 12 1 1
MIRT027791 RB1CC1 RB1-inducible coiled-coil 1 1 1
MIRT027792 NELFCD TH1-like (Drosophila) 1 1
MIRT027793 USP36 ubiquitin specific peptidase 36 1 1
MIRT027794 DIEXF chromosome 1 open reading frame 107 1 1
MIRT027795 MAST4 microtubule associated serine/threonine kinase family member 4 1 1
MIRT027796 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT027797 HIST1H1C histone cluster 1, H1c 1 1
MIRT027798 COA1 chromosome 7 open reading frame 44 1 1
MIRT027799 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT027800 CHST11 carbohydrate (chondroitin 4) sulfotransferase 11 1 1
MIRT027801 IP6K2 inositol hexakisphosphate kinase 2 1 1
MIRT027802 CFB complement factor B 1 1
MIRT027803 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT027804 WNT10B wingless-type MMTV integration site family, member 10B 1 1
MIRT027805 VANGL1 vang-like 1 (van gogh, Drosophila) 1 1
MIRT027806 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT027807 GPN1 GPN-loop GTPase 1 1 1
MIRT027808 AK2 adenylate kinase 2 1 1
MIRT027809 FAM57A family with sequence similarity 57, member A 1 1
MIRT027810 JMJD4 jumonji domain containing 4 1 1
MIRT027811 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT027812 ZBED4 zinc finger, BED-type containing 4 1 1
MIRT027813 ZNF267 zinc finger protein 267 1 1
MIRT027814 C3 complement component 3 1 1
MIRT027815 TET3 tet oncogene family member 3 1 1
MIRT027816 BCL9 B-cell CLL/lymphoma 9 1 1
MIRT027817 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT027818 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT027819 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT027820 HBEGF heparin-binding EGF-like growth factor 1 1
MIRT027821 MED13L mediator complex subunit 13-like 1 1
MIRT027822 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT027823 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 1
MIRT027824 FKBP3 FK506 binding protein 3, 25kDa 1 1
MIRT027825 PLCXD1 phosphatidylinositol-specific phospholipase C, X domain containing 1 1 1
MIRT027826 PPAT phosphoribosyl pyrophosphate amidotransferase 1 1
MIRT027827 PIK3C3 phosphoinositide-3-kinase, class 3 1 1
MIRT027828 TCERG1 transcription elongation regulator 1 1 1
MIRT027829 CCNA2 cyclin A2 1 1
MIRT027830 SIGMAR1 sigma non-opioid intracellular receptor 1 1 1
MIRT027831 RHOBTB3 Rho-related BTB domain containing 3 1 1
MIRT027832 SLC7A6 solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 1 1
MIRT027833 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1 1
MIRT027834 LGR4 leucine-rich repeat-containing G protein-coupled receptor 4 1 1
MIRT027835 C5orf30 chromosome 5 open reading frame 30 1 1
MIRT027836 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT027837 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 1 1
MIRT027838 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT027839 RIPK2 receptor-interacting serine-threonine kinase 2 1 1
MIRT027840 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 1 1
MIRT027841 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 1 1
MIRT027842 LEPROTL1 leptin receptor overlapping transcript-like 1 1 1
MIRT027843 ANKRD11 ankyrin repeat domain 11 1 1
MIRT027844 UST uronyl-2-sulfotransferase 1 1
MIRT027845 CHST3 carbohydrate (chondroitin 6) sulfotransferase 3 1 1
MIRT027846 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif, 5 1 1
MIRT027847 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT027848 MAGEA2 melanoma antigen family A, 2 1 1
MIRT027849 NEK3 NIMA (never in mitosis gene a)-related kinase 3 1 1
MIRT027850 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT027851 POU2F1 POU class 2 homeobox 1 1 1
MIRT027852 HMGA1 high mobility group AT-hook 1 1 1
MIRT027853 IGF2BP2 insulin-like growth factor 2 mRNA binding protein 2 1 1
MIRT027854 RNF44 ring finger protein 44 1 1
MIRT027855 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 1 1
MIRT027856 SNAP23 synaptosomal-associated protein, 23kDa 1 1
MIRT027857 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT027858 DICER1 dicer 1, ribonuclease type III 1 1
MIRT027859 ABT1 activator of basal transcription 1 1 1
MIRT027860 XK X-linked Kx blood group (McLeod syndrome) 1 1
MIRT027861 FGD6 FYVE, RhoGEF and PH domain containing 6 1 1
MIRT027862 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 1
MIRT027863 IRS2 insulin receptor substrate 2 1 1
MIRT027864 FRMD4B FERM domain containing 4B 1 1
MIRT027865 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT027866 PPP4C protein phosphatase 4, catalytic subunit 1 1
MIRT027867 MRS2 MRS2 magnesium homeostasis factor homolog (S. cerevisiae) 1 1
MIRT027868 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT048710 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT048711 CDC42BPA CDC42 binding protein kinase alpha (DMPK-like) 1 1
MIRT048712 E2F4 E2F transcription factor 4, p107/p130-binding 1 1
MIRT048713 NDUFAF3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 1 1