Accession ID: MIRT006398 [miRNA, hsa-let-7d-5p :: IL13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7dLinkOut: [miRBase ]
Synonyms LET7D, MIRNLET7D, hsa-let-7d, let-7d, MIRLET7D
Description Homo sapiens let-7d stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7d-5p
Mature Sequence 8| AGAGGUAGUAGGUUGCAUAGUU |29
Evidence Experimental
Experiments Cloned
Putative hsa-let-7d-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ALRH, BHR1, IL-13, P600
Description interleukin 13
Transcript NM_002188    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL13
(miRNA target sites are highlighted)
>IL13|NM_002188|3'UTR
   1 AACTTCGAAAGCATCATTATTTGCAGAGACAGGACCTGACTATTGAAGTTGCAGATTCATTTTTCTTTCTGATGTCAAAA
  81 ATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTCTTC
 161 AGCCTAGCCGACCTCAGCCTTCCCCTTGCCCAGGGCTCAGCCTGGTGGGCCTCCTCTGTCCAGGGCCCTGAGCTCGGTGG
 241 ACCCAGGGATGACATGTCCCTACACCCCTCCCCTGCCCTAGAGCACACTGTAGCATTACAGTGGGTGCCCCCCTTGCCAG
 321 ACATGTGGTGGGACAGGGACCCACTTCACACACAGGCAACTGAGGCAGACAGCAGCTCAGGCACACTTCTTCTTGGTCTT
 401 ATTTATTATTGTGTGTTATTTAAATGAGTGTGTTTGTCACCGTTGGGGATTGGGGAAGACTGTGGCTGCTAGCACTTGGA
 481 GCCAAGGGTTCAGAGACTCAGGGCCCCAGCACTAAAGCAGTGGACACCAGGAGTCCCTGGTAATAAGTACTGTGTACAGA
 561 ATTCTGCTACCTCACTGGGGTCCTGGGGCCTCGGAGCCTCATCCGAGGCAGGGTCAGGAGAGGGGCAGAACAGCCGCTCC
 641 TGTCTGCCAGCCAGCAGCCAGCTCTCAGCCAACGAGTAATTTATTGTTTTTCCTTGTATTTAAATATTAAATATGTTAGC
 721 AAAGAGTTAATATATAGAAGGGTACCTTGAACACTGGGGGAGGGGACATTGAACAAGTTGTTTCATTGACTATCAAACTG
 801 AAGCCAGAAATAAAGTTGGTGACAGAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGAUACG----UU-GGAUGAUGGAGa 5'
            ||:||:    || :||:||||||| 
Target 5' taCTGTGTACAGAATTCTGCTACCTCa 3'
548 - 574 162.00 -22.20
2
miRNA  3' uugAUACGUUGGAU--GAUGGAGa 5'
             | | ||:||||  | ||||| 
Target 5' ccgTCTTCAGCCTAGCCGACCTCa 3'
153 - 176 133.00 -14.70
3
miRNA  3' uugauacguuggaugAUGGAGa 5'
                         |||||: 
Target 5' taatatatagaagggTACCTTg 3'
728 - 749 104.00 -6.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7d-5p :: IL13    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions A549
Location of target site 3'UTR
Tools used in this research miRanda , RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Let-7 targets IL13 3 ' UTR ...

- Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al., 2011, The Journal of allergy and clinical immunology.

Article - Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al.
- The Journal of allergy and clinical immunology, 2011
BACKGROUND: IL-13, a cytokine secreted by T(H)2 lymphocytes and other cells, critically modulates allergic inflammation and tissue remodeling in allergic asthma. Although much is known about transcriptional regulation of IL-13, posttranscriptional regulation is poorly understood. OBJECTIVE: Because many inflammatory pathways are known to be regulated by microRNAs, permitting a rapid and fine-tuned response, the role of microRNA-mediated regulation of IL-13 was investigated using both in vitro and in vivo studies. METHODS: A combination of in silico approaches and in vitro transfections in A549 cells and primary cultured T cells was used to demonstrate the involvement of let-7 in IL-13 regulation. Furthermore, intranasal delivery of let-7 microRNA mimic in mice was performed to study its effects in allergic airway inflammatory conditions. RESULTS: Using a combination of bioinformatics and molecular approaches, we demonstrate that the let-7 family of microRNAs regulates IL-13 expression. Induced levels of IL-13 in cultured T cells were inversely related to let-7 levels. In an IL-13-dependent murine model of allergic airway inflammation, we observed that inflammation was associated with a reduction in most of the members of the let-7 family. Exogenous administration of let-7 mimic to lungs of mice with allergic inflammation resulted in a decrease in IL-13 levels, resolution of airway inflammation, reduction in airway hyperresponsiveness, and attenuation of mucus metaplasia and subepithelial fibrosis. CONCLUSION: Let-7 microRNAs inhibit IL-13 expression and represent a major regulatory mechanism for modulating IL-13 secretion in IL-13-producing cell types and thereby T(H)2 inflammation.
LinkOut: [PMID: 21616524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
367 hsa-let-7d-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000401 BDNF brain-derived neurotrophic factor 1 1
MIRT000402 CDK6 cyclin-dependent kinase 6 1 1
MIRT000403 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000405 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT000406 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT002005 HMGA2 high mobility group AT-hook 2 5 6
MIRT003901 APP amyloid beta (A4) precursor protein 2 1
MIRT004347 DICER1 dicer 1, ribonuclease type III 3 1
MIRT004505 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 5 3
MIRT005549 PDGFA platelet-derived growth factor alpha polypeptide 3 1
MIRT006398 IL13 interleukin 13 2 1
MIRT006406 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT032101 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT032102 DRD3 dopamine receptor D3 1 1
MIRT032103 SMOX spermine oxidase 1 1
MIRT032104 DAD1 defender against cell death 1 1 1
MIRT032105 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 2 3
MIRT032106 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT032107 GPR63 G protein-coupled receptor 63 1 1
MIRT032108 FAM135A family with sequence similarity 135, member A 1 1
MIRT032109 CPNE1 copine I 1 1
MIRT032110 NR4A1 nuclear receptor subfamily 4, group A, member 1 1 1
MIRT032111 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) 1 1
MIRT032112 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 1 1
MIRT032113 LARP4B La ribonucleoprotein domain family, member 4B 1 1
MIRT032114 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 2
MIRT032115 FBXO3 F-box protein 3 1 1
MIRT032116 ZNF763 zinc finger protein 763 1 1
MIRT032117 PCNP PEST proteolytic signal containing nuclear protein 1 1
MIRT032118 HOMER1 homer homolog 1 (Drosophila) 1 1
MIRT032119 RBM12 RNA binding motif protein 12 1 1
MIRT032120 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT032121 CBR4 carbonyl reductase 4 1 1
MIRT032122 THBS1 thrombospondin 1 1 2
MIRT032123 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT032124 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT032125 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT032126 AKAP8 A kinase (PRKA) anchor protein 8 1 2
MIRT032127 TST thiosulfate sulfurtransferase (rhodanese) 1 1
MIRT032128 GPR137B G protein-coupled receptor 137B 1 1
MIRT032129 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT032130 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 2
MIRT032131 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT032132 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT032133 SPATA2 spermatogenesis associated 2 1 1
MIRT032134 GOLT1B golgi transport 1B 1 1
MIRT032135 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT032136 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT032137 RFX5 regulatory factor X, 5 (influences HLA class II expression) 1 1
MIRT032138 BIN3 bridging integrator 3 1 1
MIRT032139 CEP120 centrosomal protein 120kDa 1 2
MIRT032140 ZNF526 zinc finger protein 526 1 1
MIRT032141 ISL1 ISL LIM homeobox 1 1 1
MIRT032142 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 3
MIRT032143 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT032144 TMEM194A transmembrane protein 194A 1 1
MIRT032145 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT032146 C12orf4 chromosome 12 open reading frame 4 1 2
MIRT032147 TMEM2 transmembrane protein 2 1 1
MIRT032148 DLC1 deleted in liver cancer 1 1 1
MIRT032149 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 2
MIRT032150 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 1
MIRT032151 ZNF354B zinc finger protein 354B 1 1
MIRT032152 ZNF200 zinc finger protein 200 1 2
MIRT032153 ADCY9 adenylate cyclase 9 1 1
MIRT032154 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT032155 STK40 serine/threonine kinase 40 1 1
MIRT032156 PCGF3 polycomb group ring finger 3 1 3
MIRT032157 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT032158 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT032159 RAD9A RAD9 homolog A (S. pombe) 1 1
MIRT032160 ARRDC4 arrestin domain containing 4 1 1
MIRT032161 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT032162 LBR lamin B receptor 1 1
MIRT032163 C9orf41 chromosome 9 open reading frame 41 1 1
MIRT032164 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 3
MIRT032165 ABT1 activator of basal transcription 1 1 5
MIRT032166 NHLRC3 NHL repeat containing 3 1 3
MIRT032167 GLMN glomulin, FKBP associated protein 1 1
MIRT032168 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT032169 ZNF644 zinc finger protein 644 1 2
MIRT032170 C11orf57 chromosome 11 open reading frame 57 1 3
MIRT032171 FAM104A family with sequence similarity 104, member A 1 1
MIRT032172 SPRYD4 SPRY domain containing 4 1 1
MIRT032173 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 2
MIRT032174 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 3
MIRT032175 ONECUT2 one cut homeobox 2 1 2
MIRT032176 USP24 ubiquitin specific peptidase 24 1 1
MIRT032177 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 2
MIRT032178 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT032179 HAND1 heart and neural crest derivatives expressed 1 1 2
MIRT032180 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 4
MIRT032181 IGF1R insulin-like growth factor 1 receptor 1 5
MIRT032182 TMEM135 transmembrane protein 135 1 1
MIRT032183 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 2
MIRT032184 ZNF280B zinc finger protein 280B 1 1
MIRT032185 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT032186 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 2
MIRT051710 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT051711 PRR13 proline rich 13 1 1
MIRT051712 ZNF746 zinc finger protein 746 1 1
MIRT051713 SLC35A4 solute carrier family 35, member A4 1 1
MIRT051714 RPL31 ribosomal protein L31 1 1
MIRT051715 TPD52L2 tumor protein D52-like 2 1 1
MIRT051716 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT051717 CTDP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 1 1
MIRT051718 RPS6 ribosomal protein S6 1 1
MIRT051719 SENP5 SUMO1/sentrin specific peptidase 5 1 1
MIRT051720 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT051721 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT051722 H2AFX H2A histone family, member X 1 1
MIRT051723 DSC3 desmocollin 3 1 1
MIRT051724 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT051725 NCOA1 nuclear receptor coactivator 1 1 1
MIRT051726 LRRC42 leucine rich repeat containing 42 1 1
MIRT051727 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT063194 ADIPOR2 adiponectin receptor 2 1 1
MIRT068153 TXLNA taxilin alpha 1 1
MIRT068788 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT073005 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 3
MIRT076222 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT083299 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT084975 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT095765 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT112241 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 2
MIRT118585 STK4 serine/threonine kinase 4 1 1
MIRT120920 PDE12 phosphodiesterase 12 1 4
MIRT123316 CALU calumenin 1 1
MIRT123975 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT152271 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153846 NCOA3 nuclear receptor coactivator 3 1 1
MIRT168582 HMGA1 high mobility group AT-hook 1 1 2
MIRT180602 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT187716 SUOX sulfite oxidase 1 1
MIRT191403 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT193100 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT215719 C5ORF51 chromosome 5 open reading frame 51 1 5
MIRT218814 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT240329 UBXN2B UBX domain protein 2B 1 1
MIRT243472 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT244068 EDN1 endothelin 1 1 1
MIRT252329 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255313 CDV3 CDV3 homolog (mouse) 1 1
MIRT259276 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT259478 TXLNG taxilin gamma 1 1
MIRT260706 CLDN12 claudin 12 1 3
MIRT266211 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT266625 CHTOP chromatin target of PRMT1 1 1
MIRT268838 C1ORF21 chromosome 1 open reading frame 21 1 1
MIRT284527 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT294445 ZNF264 zinc finger protein 264 1 1
MIRT297012 RRM2 ribonucleotide reductase M2 1 1
MIRT300036 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT300892 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT303319 MXD1 MAX dimerization protein 1 1 1
MIRT309845 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT322427 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT324730 ACER2 alkaline ceramidase 2 1 1
MIRT402056 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT437855 EIF2C1 eukaryotic translation initiation factor 2C, 1 3 1
MIRT438633 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 2 1
MIRT439136 ZEB2 zinc finger E-box binding homeobox 2 0 1
MIRT439137 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT442021 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT445659 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 3
MIRT447137 KIF27 kinesin family member 27 1 1
MIRT448263 ZNF774 zinc finger protein 774 1 1
MIRT449006 ANKRD46 ankyrin repeat domain 46 1 1
MIRT449954 FMNL3 formin-like 3 1 1
MIRT451156 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT451625 MEIS3P1 Meis homeobox 3 pseudogene 1 1 1
MIRT451694 C1RL complement component 1, r subcomponent-like 1 1
MIRT452093 NUCB2 nucleobindin 2 1 1
MIRT452432 QDPR quinoid dihydropteridine reductase 1 1
MIRT452944 DISC1 disrupted in schizophrenia 1 1 1
MIRT453402 RHD Rh blood group, D antigen 1 3
MIRT454165 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT454281 FXN frataxin 1 1
MIRT454540 RABL2A RAB, member of RAS oncogene family-like 2A 1 1
MIRT454855 ACOT9 acyl-CoA thioesterase 9 1 2
MIRT455677 GLO1 glyoxalase I 1 1
MIRT457249 RABL2B RAB, member of RAS oncogene family-like 2B 1 1
MIRT457678 ZNF587 zinc finger protein 587 1 1
MIRT457888 THEM6 thioesterase superfamily member 6 1 2
MIRT458017 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT458280 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT459737 RRM1 ribonucleotide reductase M1 1 1
MIRT460454 NOM1 nucleolar protein with MIF4G domain 1 1 2
MIRT460501 FAM105A family with sequence similarity 105, member A 1 3
MIRT460939 NOA1 nitric oxide associated 1 1 2
MIRT461093 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT461365 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT462383 YAE1D1 Yae1 domain containing 1 1 1
MIRT462781 ZNF8 zinc finger protein 8 1 1
MIRT463418 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463663 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT464266 VCL vinculin 1 1
MIRT465125 TSC22D2 TSC22 domain family, member 2 1 2
MIRT466186 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466720 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT469103 RNF144B ring finger protein 144B 1 1
MIRT469713 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT470424 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT470860 PLXND1 plexin D1 1 1
MIRT471270 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT471965 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472738 MTUS1 microtubule associated tumor suppressor 1 1 3
MIRT473135 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT473829 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT473941 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT474024 LRRC20 leucine rich repeat containing 20 1 1
MIRT474501 KLHDC8B kelch domain containing 8B 1 1
MIRT474760 KIAA0930 KIAA0930 1 1
MIRT474908 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT475332 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT475380 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT475734 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 2
MIRT476549 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT476974 FAM83G family with sequence similarity 83, member G 1 2
MIRT477679 EFHD2 EF-hand domain family, member D2 1 1
MIRT479750 CCND1 cyclin D1 1 1
MIRT481194 ATXN7L3B ataxin 7-like 3B 1 2
MIRT481239 ATXN7L3 ataxin 7-like 3 1 1
MIRT481364 ATG9A autophagy related 9A 1 1
MIRT481389 ATG12 autophagy related 12 1 1
MIRT481653 AREL1 KIAA0317 1 1
MIRT481853 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT482185 AHR aryl hydrocarbon receptor 1 1
MIRT482221 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT485297 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT486660 ZNF28 zinc finger protein 28 1 1
MIRT489414 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT491865 ZBTB5 zinc finger and BTB domain containing 5 1 4
MIRT492211 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT492625 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT493322 LIMD2 LIM domain containing 2 1 1
MIRT493902 FAM43A family with sequence similarity 43, member A 1 2
MIRT495969 TBC1D19 TBC1 domain family, member 19 1 1
MIRT496113 SNX17 sorting nexin 17 1 1
MIRT497876 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT498118 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 2
MIRT499406 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 2
MIRT499494 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT499654 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 1 1
MIRT499943 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT499998 HIST1H2BD histone cluster 1, H2bd 1 2
MIRT500899 STRN striatin, calmodulin binding protein 1 2
MIRT501113 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 2
MIRT501209 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT501247 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 3
MIRT501327 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT501349 RNF44 ring finger protein 44 1 2
MIRT501388 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 5
MIRT501442 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT501752 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT501941 MBD2 methyl-CpG binding domain protein 2 1 4
MIRT502121 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 2
MIRT502783 CEP135 centrosomal protein 135kDa 1 1
MIRT502840 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT505579 SMC1A structural maintenance of chromosomes 1A 1 3
MIRT506360 NUP155 nucleoporin 155kDa 1 3
MIRT507243 FIGN fidgetin 1 4
MIRT507689 COIL coilin 1 3
MIRT508402 C1orf210 chromosome 1 open reading frame 210 1 3
MIRT508666 DIABLO diablo, IAP-binding mitochondrial protein 1 2
MIRT508933 AK4 adenylate kinase 4 1 2
MIRT510392 ZNF566 zinc finger protein 566 1 3
MIRT510514 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT511387 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT512747 CD59 CD59 molecule, complement regulatory protein 1 2
MIRT515955 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT516084 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 2
MIRT521390 RDX radixin 1 2
MIRT522349 NCKIPSD NCK interacting protein with SH3 domain 1 2
MIRT523627 FZD9 frizzled family receptor 9 1 2
MIRT523734 FBXW2 F-box and WD repeat domain containing 2 1 2
MIRT523983 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT524115 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT525728 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT527764 RRAD Ras-related associated with diabetes 1 1
MIRT529728 OPRL1 opiate receptor-like 1 1 1
MIRT533189 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT536379 LEFTY1 left-right determination factor 1 1 1
MIRT543786 RBM12B RNA binding motif protein 12B 1 2
MIRT543869 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT545388 PM20D2 peptidase M20 domain containing 2 1 1
MIRT546329 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547372 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT547573 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT548266 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548346 EPHA4 EPH receptor A4 1 1
MIRT548535 DUSP1 dual specificity phosphatase 1 1 1
MIRT548564 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT548780 COLEC12 collectin sub-family member 12 1 1
MIRT548972 CCNT2 cyclin T2 1 1
MIRT549022 CBX5 chromobox homolog 5 1 1
MIRT549207 BEND4 BEN domain containing 4 1 2
MIRT549764 ZNF611 zinc finger protein 611 1 3
MIRT549800 KIAA0391 KIAA0391 1 1
MIRT549848 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT550727 PMPCA peptidase (mitochondrial processing) alpha 1 2
MIRT550899 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT551284 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 3
MIRT551319 GSG2 germ cell associated 2 (haspin) 1 3
MIRT552004 RAD18 RAD18 homolog (S. cerevisiae) 1 1
MIRT552411 ZNF460 zinc finger protein 460 1 2
MIRT553018 USP38 ubiquitin specific peptidase 38 1 1
MIRT555551 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT555717 PDZD8 PDZ domain containing 8 1 1
MIRT557967 FAM222B family with sequence similarity 222, member B 1 1
MIRT559088 C19orf47 chromosome 19 open reading frame 47 1 2
MIRT559498 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT561776 PEG10 paternally expressed 10 1 1
MIRT564403 EMILIN2 elastin microfibril interfacer 2 1 2
MIRT565450 SURF4 surfeit 4 1 1
MIRT566519 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT567430 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT567718 E2F6 E2F transcription factor 6 1 1
MIRT568649 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT569499 THYN1 thymocyte nuclear protein 1 1 1
MIRT573821 TGOLN2 trans-golgi network protein 2 1 1
MIRT574364 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT574749 GOLGA4 golgin A4 1 1
MIRT576088 Poteg POTE ankyrin domain family, member G 1 1
MIRT576807 Thbs1 thrombospondin 1 1 1
MIRT616371 RWDD1 RWD domain containing 1 1 1
MIRT617852 FMO4 flavin containing monooxygenase 4 1 1
MIRT642395 ZNF556 zinc finger protein 556 1 1
MIRT680520 PRIM2 primase, DNA, polypeptide 2 (58kDa) 1 1
MIRT680548 ZNF584 zinc finger protein 584 1 1
MIRT680801 ZNF578 zinc finger protein 578 1 1
MIRT680839 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT681142 INTS7 integrator complex subunit 7 1 1
MIRT681272 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT681324 ZFAND4 zinc finger, AN1-type domain 4 1 2
MIRT681360 BRI3BP BRI3 binding protein 1 1
MIRT681507 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT681537 ZNF738 zinc finger protein 738 1 1
MIRT681659 DTX3L deltex 3-like (Drosophila) 1 1
MIRT681739 RAB19 RAB19, member RAS oncogene family 1 2
MIRT681761 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT681798 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT681870 DNAH9 dynein, axonemal, heavy chain 9 1 1
MIRT681942 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682103 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 2
MIRT682182 SLC38A7 solute carrier family 38, member 7 1 1
MIRT682239 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT682385 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT682445 MTX3 metaxin 3 1 1
MIRT682605 CPA4 carboxypeptidase A4 1 1
MIRT682641 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT689328 FPR1 formyl peptide receptor 1 1 1
MIRT689731 ATXN2 ataxin 2 1 1
MIRT691037 ZNF799 zinc finger protein 799 1 1
MIRT691936 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT694885 ZNF417 zinc finger protein 417 1 1
MIRT695256 ZNF443 zinc finger protein 443 1 1
MIRT695414 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT700588 PRSS22 protease, serine, 22 1 1
MIRT701425 NHLRC2 NHL repeat containing 2 1 1
MIRT702485 KIAA1328 KIAA1328 1 1
MIRT702714 IPO9 importin 9 1 1
MIRT704030 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT704422 CTPS1 CTP synthase 1 1 1
MIRT705751 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT712372 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT713521 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*