Accession ID: MIRT006398 [miRNA, hsa-let-7d-5p :: IL13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7dLinkOut: [miRBase ]
Synonyms LET7D, MIRNLET7D, hsa-let-7d, let-7d, MIRLET7D
Description Homo sapiens let-7d stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7d-5p
Mature Sequence 8| AGAGGUAGUAGGUUGCAUAGUU |29
Evidence Experimental
Experiments Cloned
Putative hsa-let-7d-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ALRH, BHR1, IL-13, MGC116786, MGC116788, MGC116789, P600
Description interleukin 13
Transcript NM_0021    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL13
(miRNA target sites are highlighted)
>IL13|NM_0021|3'UTR
   1 TGAAACTTCGAAAGCATCATTATTTGCAGAGACAGGACCTGACTATTGAAGTTGCAGATTCATTTTTCTTTCTGATGTCA
  81 AAAATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTC
 161 TTCAGCCTAGCCGACCTCAGCCTTCCCCTTGCCCAGGGCTCAGCCTGGTGGGCCTCCTCTGTCCAGGGCCCTGAGCTCGG
 241 TGGACCCAGGGATGACATGTCCCTACACCCCTCCCCTGCCCTAGAGCACACTGTAGCATTACAGTGGGTGCCCCCCTTGC
 321 CAGACATGTGGTGGGACAGGGACCCACTTCACACACAGGCAACTGAGGCAGACAGCAGCTCAGGCACACTTCTTCTTGGT
 401 CTTATTTATTATTGTGTGTTATTTAAATGAGTGTGTTTGTCACCGTTGGGGATTGGGGAAGACTGTGGCTGCTAGCACTT
 481 GGAGCCAAGGGTTCAGAGACTCAGGGCCCCAGCACTAAAGCAGTGGACACCAGGAGTCCCTGGTAATAAGTACTGTGTAC
 561 AGAATTCTGCTACCTCACTGGGGTCCTGGGGCCTCGGAGCCTCATCCGAGGCAGGGTCAGGAGAGGGGCAGAACAGCCGC
 641 TCCTGTCTGCCAGCCAGCAGCCAGCTCTCAGCCAACGAGTAATTTATTGTTTTTCCTTGTATTTAAATATTAAATATGTT
 721 AGCAAAGAGTTAATATATAGAAGGGTACCTTGAACACTGGGGGAGGGGACATTGAACAAGTTGTTTCATTGACTATCAAA
 801 CTGAAGCCAGAAATAAAGTTGGTGACAGAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGAUACG----UU-GGAUGAUGGAGa 5'
            ||:||:    || :||:||||||| 
Target 5' taCTGTGTACAGAATTCTGCTACCTCa 3'
551 - 577 162.00 -22.20
2
miRNA  3' uugAUACGUUGGAU--GAUGGAGa 5'
             | | ||:||||  | ||||| 
Target 5' ccgTCTTCAGCCTAGCCGACCTCa 3'
156 - 179 133.00 -14.70
3
miRNA  3' uugauacguuggaugAUGGAGa 5'
                         |||||: 
Target 5' taatatatagaagggTACCTTg 3'
731 - 752 104.00 -6.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7d-5p :: IL13    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions A549
Location of target site 3'UTR
Tools used in this research miRanda , RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Let-7 targets IL13 3 ' UTR ...

- Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al., 2011, The Journal of allergy and clinical immunology.

Article - Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al.
- The Journal of allergy and clinical immunology, 2011
BACKGROUND: IL-13, a cytokine secreted by T(H)2 lymphocytes and other cells, critically modulates allergic inflammation and tissue remodeling in allergic asthma. Although much is known about transcriptional regulation of IL-13, posttranscriptional regulation is poorly understood. OBJECTIVE: Because many inflammatory pathways are known to be regulated by microRNAs, permitting a rapid and fine-tuned response, the role of microRNA-mediated regulation of IL-13 was investigated using both in vitro and in vivo studies. METHODS: A combination of in silico approaches and in vitro transfections in A549 cells and primary cultured T cells was used to demonstrate the involvement of let-7 in IL-13 regulation. Furthermore, intranasal delivery of let-7 microRNA mimic in mice was performed to study its effects in allergic airway inflammatory conditions. RESULTS: Using a combination of bioinformatics and molecular approaches, we demonstrate that the let-7 family of microRNAs regulates IL-13 expression. Induced levels of IL-13 in cultured T cells were inversely related to let-7 levels. In an IL-13-dependent murine model of allergic airway inflammation, we observed that inflammation was associated with a reduction in most of the members of the let-7 family. Exogenous administration of let-7 mimic to lungs of mice with allergic inflammation resulted in a decrease in IL-13 levels, resolution of airway inflammation, reduction in airway hyperresponsiveness, and attenuation of mucus metaplasia and subepithelial fibrosis. CONCLUSION: Let-7 microRNAs inhibit IL-13 expression and represent a major regulatory mechanism for modulating IL-13 secretion in IL-13-producing cell types and thereby T(H)2 inflammation.
LinkOut: [PMID: 21616524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
116 hsa-let-7d-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000401 BDNF brain-derived neurotrophic factor 1 1
MIRT000402 CDK6 cyclin-dependent kinase 6 1 1
MIRT000403 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000405 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT000406 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT002005 HMGA2 high mobility group AT-hook 2 4 3
MIRT003901 APP amyloid beta (A4) precursor protein 2 1
MIRT004347 DICER1 dicer 1, ribonuclease type III 3 1
MIRT004505 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 4 1
MIRT005549 PDGFA platelet-derived growth factor alpha polypeptide 3 1
MIRT006398 IL13 interleukin 13 2 1
MIRT006406 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT032101 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT032102 DRD3 dopamine receptor D3 1 1
MIRT032103 SMOX spermine oxidase 1 1
MIRT032104 DAD1 defender against cell death 1 1 1
MIRT032105 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT032106 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT032107 GPR63 G protein-coupled receptor 63 1 1
MIRT032108 FAM135A family with sequence similarity 135, member A 1 1
MIRT032109 CPNE1 copine I 1 1
MIRT032110 NR4A1 nuclear receptor subfamily 4, group A, member 1 1 1
MIRT032111 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) 1 1
MIRT032112 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 1 1
MIRT032113 LARP4B La ribonucleoprotein domain family, member 4B 1 1
MIRT032114 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT032115 FBXO3 F-box protein 3 1 1
MIRT032116 ZNF763 zinc finger protein 763 1 1
MIRT032117 PCNP PEST proteolytic signal containing nuclear protein 1 1
MIRT032118 HOMER1 homer homolog 1 (Drosophila) 1 1
MIRT032119 RBM12 RNA binding motif protein 12 1 1
MIRT032120 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT032121 CBR4 carbonyl reductase 4 1 1
MIRT032122 THBS1 thrombospondin 1 1 1
MIRT032123 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT032124 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT032125 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT032126 AKAP8 A kinase (PRKA) anchor protein 8 1 1
MIRT032127 TST thiosulfate sulfurtransferase (rhodanese) 1 1
MIRT032128 GPR137B G protein-coupled receptor 137B 1 1
MIRT032129 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT032130 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 1
MIRT032131 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT032132 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT032133 SPATA2 spermatogenesis associated 2 1 1
MIRT032134 GOLT1B golgi transport 1 homolog B (S. cerevisiae) 1 1
MIRT032135 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT032136 SREK1IP1 SFRS12-interacting protein 1 1 1
MIRT032137 RFX5 regulatory factor X, 5 (influences HLA class II expression) 1 1
MIRT032138 BIN3 bridging integrator 3 1 1
MIRT032139 CEP120 centrosomal protein 120kDa 1 1
MIRT032140 ZNF526 zinc finger protein 526 1 1
MIRT032141 ISL1 ISL LIM homeobox 1 1 1
MIRT032142 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT032143 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 1
MIRT032144 TMEM194A transmembrane protein 194A 1 1
MIRT032145 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT032146 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT032147 TMEM2 transmembrane protein 2 1 1
MIRT032148 DLC1 deleted in liver cancer 1 1 1
MIRT032149 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT032150 SREK1 splicing factor, arginine/serine-rich 12 1 1
MIRT032151 ZNF354B zinc finger protein 354B 1 1
MIRT032152 ZNF200 zinc finger protein 200 1 1
MIRT032153 ADCY9 adenylate cyclase 9 1 1
MIRT032154 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT032155 STK40 serine/threonine kinase 40 1 1
MIRT032156 PCGF3 polycomb group ring finger 3 1 1
MIRT032157 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT032158 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT032159 RAD9A RAD9 homolog A (S. pombe) 1 1
MIRT032160 ARRDC4 arrestin domain containing 4 1 1
MIRT032161 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT032162 LBR lamin B receptor 1 1
MIRT032163 C9orf41 chromosome 9 open reading frame 41 1 1
MIRT032164 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT032165 ABT1 activator of basal transcription 1 1 1
MIRT032166 NHLRC3 NHL repeat containing 3 1 1
MIRT032167 GLMN glomulin, FKBP associated protein 1 1
MIRT032168 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 1
MIRT032169 ZNF644 zinc finger protein 644 1 1
MIRT032170 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT032171 FAM104A family with sequence similarity 104, member A 1 1
MIRT032172 SPRYD4 SPRY domain containing 4 1 1
MIRT032173 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT032174 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT032175 ONECUT2 one cut homeobox 2 1 1
MIRT032176 USP24 ubiquitin specific peptidase 24 1 1
MIRT032177 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT032178 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT032179 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT032180 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 1
MIRT032181 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT032182 TMEM135 transmembrane protein 135 1 1
MIRT032183 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 1
MIRT032184 ZNF280B zinc finger protein 280B 1 1
MIRT032185 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT032186 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT051710 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT051711 PRR13 proline rich 13 1 1
MIRT051712 ZNF746 zinc finger protein 746 1 1
MIRT051713 SLC35A4 solute carrier family 35, member A4 1 1
MIRT051714 RPL31 ribosomal protein L31 1 1
MIRT051715 TPD52L2 tumor protein D52-like 2 1 1
MIRT051716 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT051717 CTDP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 1 1
MIRT051718 RPS6 ribosomal protein S6 1 1
MIRT051719 SENP5 SUMO1/sentrin specific peptidase 5 1 1
MIRT051720 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT051721 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT051722 H2AFX H2A histone family, member X 1 1
MIRT051723 DSC3 desmocollin 3 1 1
MIRT051724 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT051725 NCOA1 nuclear receptor coactivator 1 1 1
MIRT051726 LRRC42 leucine rich repeat containing 42 1 1
MIRT051727 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1