Accession ID: MIRT006399 [miRNA, hsa-let-7g-5p :: IL13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7gLinkOut: [miRBase ]
Synonyms LET7G, MIRNLET7G, hsa-let-7g, MIRLET7G
Description Homo sapiens let-7g stem-loop
Comment let-7g-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7g-5p
Mature Sequence 5| UGAGGUAGUAGUUUGUACAGUU |26
Evidence Experimental
Experiments Cloned
Putative hsa-let-7g-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ALRH, BHR1, IL-13, MGC116786, MGC116788, MGC116789, P600
Description interleukin 13
Transcript NM_0021    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL13
(miRNA target sites are highlighted)
>IL13|NM_0021|3'UTR
   1 TGAAACTTCGAAAGCATCATTATTTGCAGAGACAGGACCTGACTATTGAAGTTGCAGATTCATTTTTCTTTCTGATGTCA
  81 AAAATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTC
 161 TTCAGCCTAGCCGACCTCAGCCTTCCCCTTGCCCAGGGCTCAGCCTGGTGGGCCTCCTCTGTCCAGGGCCCTGAGCTCGG
 241 TGGACCCAGGGATGACATGTCCCTACACCCCTCCCCTGCCCTAGAGCACACTGTAGCATTACAGTGGGTGCCCCCCTTGC
 321 CAGACATGTGGTGGGACAGGGACCCACTTCACACACAGGCAACTGAGGCAGACAGCAGCTCAGGCACACTTCTTCTTGGT
 401 CTTATTTATTATTGTGTGTTATTTAAATGAGTGTGTTTGTCACCGTTGGGGATTGGGGAAGACTGTGGCTGCTAGCACTT
 481 GGAGCCAAGGGTTCAGAGACTCAGGGCCCCAGCACTAAAGCAGTGGACACCAGGAGTCCCTGGTAATAAGTACTGTGTAC
 561 AGAATTCTGCTACCTCACTGGGGTCCTGGGGCCTCGGAGCCTCATCCGAGGCAGGGTCAGGAGAGGGGCAGAACAGCCGC
 641 TCCTGTCTGCCAGCCAGCAGCCAGCTCTCAGCCAACGAGTAATTTATTGTTTTTCCTTGTATTTAAATATTAAATATGTT
 721 AGCAAAGAGTTAATATATAGAAGGGTACCTTGAACACTGGGGGAGGGGACATTGAACAAGTTGTTTCATTGACTATCAAA
 801 CTGAAGCCAGAAATAAAGTTGGTGACAGAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugACAUGUUU---GAUGAUGGAGu 5'
             ||||||:|   ||:||||||| 
Target 5' ctgTGTACAGAATTCTGCTACCTCa 3'
553 - 577 175.00 -24.10
2
miRNA  3' uugACAUGUUUGAU--GAUGGAGu 5'
             | | ||: |||  | ||||| 
Target 5' ccgTCTTCAGCCTAGCCGACCTCa 3'
156 - 179 125.00 -10.90
3
miRNA  3' uugACAUGUUUGAUGAUGGAGu 5'
             | ||:|:|  : |||||: 
Target 5' taaTATATAGAAGGGTACCTTg 3'
731 - 752 111.00 -9.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7g-5p :: IL13    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions A549
Location of target site 3'UTR
Tools used in this research miRanda , RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Let-7 targets IL13 3 ' UTR ...

- Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al., 2011, The Journal of allergy and clinical immunology.

Article - Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al.
- The Journal of allergy and clinical immunology, 2011
BACKGROUND: IL-13, a cytokine secreted by T(H)2 lymphocytes and other cells, critically modulates allergic inflammation and tissue remodeling in allergic asthma. Although much is known about transcriptional regulation of IL-13, posttranscriptional regulation is poorly understood. OBJECTIVE: Because many inflammatory pathways are known to be regulated by microRNAs, permitting a rapid and fine-tuned response, the role of microRNA-mediated regulation of IL-13 was investigated using both in vitro and in vivo studies. METHODS: A combination of in silico approaches and in vitro transfections in A549 cells and primary cultured T cells was used to demonstrate the involvement of let-7 in IL-13 regulation. Furthermore, intranasal delivery of let-7 microRNA mimic in mice was performed to study its effects in allergic airway inflammatory conditions. RESULTS: Using a combination of bioinformatics and molecular approaches, we demonstrate that the let-7 family of microRNAs regulates IL-13 expression. Induced levels of IL-13 in cultured T cells were inversely related to let-7 levels. In an IL-13-dependent murine model of allergic airway inflammation, we observed that inflammation was associated with a reduction in most of the members of the let-7 family. Exogenous administration of let-7 mimic to lungs of mice with allergic inflammation resulted in a decrease in IL-13 levels, resolution of airway inflammation, reduction in airway hyperresponsiveness, and attenuation of mucus metaplasia and subepithelial fibrosis. CONCLUSION: Let-7 microRNAs inhibit IL-13 expression and represent a major regulatory mechanism for modulating IL-13 secretion in IL-13-producing cell types and thereby T(H)2 inflammation.
LinkOut: [PMID: 21616524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
30 hsa-let-7g-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000396 CDK6 cyclin-dependent kinase 6 1 1
MIRT000397 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000399 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT000472 COL1A2 collagen, type I, alpha 2 4 1
MIRT000475 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 2
MIRT002097 HMGA2 high mobility group AT-hook 2 4 3
MIRT003831 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 4 2
MIRT004489 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 4 1
MIRT004490 BCL2L1 BCL2-like 1 4 1
MIRT006161 GAB2 GRB2-associated binding protein 2 3 1
MIRT006162 FN1 fibronectin 1 3 1
MIRT006399 IL13 interleukin 13 2 1
MIRT024117 DAD1 defender against cell death 1 1 1
MIRT024118 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT024119 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 2 1
MIRT024120 BMI1 BMI1 polycomb ring finger oncogene 2 1
MIRT046555 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT046556 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046557 UBE3C ubiquitin protein ligase E3C 1 1
MIRT046558 RPL12 ribosomal protein L12 1 1
MIRT046559 SFT2D1 SFT2 domain containing 1 1 1
MIRT046560 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT046561 BRD1 bromodomain containing 1 1 1
MIRT046562 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT046563 RAB21 RAB21, member RAS oncogene family 1 1
MIRT046564 HMGB1 high-mobility group box 1 1 1
MIRT046565 RRM2 ribonucleotide reductase M2 1 1
MIRT046566 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT046567 RANBP2 RAN binding protein 2 1 1
MIRT046568 SART3 squamous cell carcinoma antigen recognized by T cells 3 1 1