Accession ID: MIRT006399 [miRNA, hsa-let-7g-5p :: IL13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7gLinkOut: [miRBase ]
Synonyms LET7G, MIRNLET7G, hsa-let-7g, MIRLET7G
Description Homo sapiens let-7g stem-loop
Comment let-7g-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7g-5p
Mature Sequence 5| UGAGGUAGUAGUUUGUACAGUU |26
Evidence Experimental
Experiments Cloned
Putative hsa-let-7g-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ALRH, BHR1, IL-13, P600
Description interleukin 13
Transcript NM_002188    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL13
(miRNA target sites are highlighted)
>IL13|NM_002188|3'UTR
   1 AACTTCGAAAGCATCATTATTTGCAGAGACAGGACCTGACTATTGAAGTTGCAGATTCATTTTTCTTTCTGATGTCAAAA
  81 ATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTCTTC
 161 AGCCTAGCCGACCTCAGCCTTCCCCTTGCCCAGGGCTCAGCCTGGTGGGCCTCCTCTGTCCAGGGCCCTGAGCTCGGTGG
 241 ACCCAGGGATGACATGTCCCTACACCCCTCCCCTGCCCTAGAGCACACTGTAGCATTACAGTGGGTGCCCCCCTTGCCAG
 321 ACATGTGGTGGGACAGGGACCCACTTCACACACAGGCAACTGAGGCAGACAGCAGCTCAGGCACACTTCTTCTTGGTCTT
 401 ATTTATTATTGTGTGTTATTTAAATGAGTGTGTTTGTCACCGTTGGGGATTGGGGAAGACTGTGGCTGCTAGCACTTGGA
 481 GCCAAGGGTTCAGAGACTCAGGGCCCCAGCACTAAAGCAGTGGACACCAGGAGTCCCTGGTAATAAGTACTGTGTACAGA
 561 ATTCTGCTACCTCACTGGGGTCCTGGGGCCTCGGAGCCTCATCCGAGGCAGGGTCAGGAGAGGGGCAGAACAGCCGCTCC
 641 TGTCTGCCAGCCAGCAGCCAGCTCTCAGCCAACGAGTAATTTATTGTTTTTCCTTGTATTTAAATATTAAATATGTTAGC
 721 AAAGAGTTAATATATAGAAGGGTACCTTGAACACTGGGGGAGGGGACATTGAACAAGTTGTTTCATTGACTATCAAACTG
 801 AAGCCAGAAATAAAGTTGGTGACAGAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugACAUGUUU---GAUGAUGGAGu 5'
             ||||||:|   ||:||||||| 
Target 5' ctgTGTACAGAATTCTGCTACCTCa 3'
550 - 574 175.00 -24.10
2
miRNA  3' uugACAUGUUUGAU--GAUGGAGu 5'
             | | ||: |||  | ||||| 
Target 5' ccgTCTTCAGCCTAGCCGACCTCa 3'
153 - 176 125.00 -10.90
3
miRNA  3' uugACAUGUUUGAUGAUGGAGu 5'
             | ||:|:|  : |||||: 
Target 5' taaTATATAGAAGGGTACCTTg 3'
728 - 749 111.00 -9.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7g-5p :: IL13    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions A549
Location of target site 3'UTR
Tools used in this research miRanda , RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Let-7 targets IL13 3 ' UTR ...

- Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al., 2011, The Journal of allergy and clinical immunology.

Article - Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al.
- The Journal of allergy and clinical immunology, 2011
BACKGROUND: IL-13, a cytokine secreted by T(H)2 lymphocytes and other cells, critically modulates allergic inflammation and tissue remodeling in allergic asthma. Although much is known about transcriptional regulation of IL-13, posttranscriptional regulation is poorly understood. OBJECTIVE: Because many inflammatory pathways are known to be regulated by microRNAs, permitting a rapid and fine-tuned response, the role of microRNA-mediated regulation of IL-13 was investigated using both in vitro and in vivo studies. METHODS: A combination of in silico approaches and in vitro transfections in A549 cells and primary cultured T cells was used to demonstrate the involvement of let-7 in IL-13 regulation. Furthermore, intranasal delivery of let-7 microRNA mimic in mice was performed to study its effects in allergic airway inflammatory conditions. RESULTS: Using a combination of bioinformatics and molecular approaches, we demonstrate that the let-7 family of microRNAs regulates IL-13 expression. Induced levels of IL-13 in cultured T cells were inversely related to let-7 levels. In an IL-13-dependent murine model of allergic airway inflammation, we observed that inflammation was associated with a reduction in most of the members of the let-7 family. Exogenous administration of let-7 mimic to lungs of mice with allergic inflammation resulted in a decrease in IL-13 levels, resolution of airway inflammation, reduction in airway hyperresponsiveness, and attenuation of mucus metaplasia and subepithelial fibrosis. CONCLUSION: Let-7 microRNAs inhibit IL-13 expression and represent a major regulatory mechanism for modulating IL-13 secretion in IL-13-producing cell types and thereby T(H)2 inflammation.
LinkOut: [PMID: 21616524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
308 hsa-let-7g-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000396 CDK6 cyclin-dependent kinase 6 1 1
MIRT000397 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000399 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT000472 COL1A2 collagen, type I, alpha 2 4 1
MIRT000475 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 3
MIRT002097 HMGA2 high mobility group AT-hook 2 5 6
MIRT003831 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 5 3
MIRT004489 CDKN2A cyclin-dependent kinase inhibitor 2A 4 1
MIRT004490 BCL2L1 BCL2-like 1 4 1
MIRT006161 GAB2 GRB2-associated binding protein 2 3 1
MIRT006162 FN1 fibronectin 1 3 1
MIRT006399 IL13 interleukin 13 2 1
MIRT024117 DAD1 defender against cell death 1 1 1
MIRT024118 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 2 3
MIRT024119 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 2 1
MIRT024120 BMI1 BMI1 polycomb ring finger oncogene 2 1
MIRT046555 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT046556 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046557 UBE3C ubiquitin protein ligase E3C 1 1
MIRT046558 RPL12 ribosomal protein L12 1 1
MIRT046559 SFT2D1 SFT2 domain containing 1 1 1
MIRT046560 MAP3K1 mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase 1 1
MIRT046561 BRD1 bromodomain containing 1 1 1
MIRT046562 AGO1 eukaryotic translation initiation factor 2C, 1 4 2
MIRT046563 RAB21 RAB21, member RAS oncogene family 1 1
MIRT046564 HMGB1 high mobility group box 1 1 1
MIRT046565 RRM2 ribonucleotide reductase M2 1 2
MIRT046566 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT046567 RANBP2 RAN binding protein 2 1 1
MIRT046568 SART3 squamous cell carcinoma antigen recognized by T cells 3 1 1
MIRT054642 CASP3 caspase 3, apoptosis-related cysteine peptidase 2 1
MIRT054662 THBS1 thrombospondin 1 4 2
MIRT054663 TGFBR1 transforming growth factor, beta receptor 1 3 1
MIRT054664 SMAD2 SMAD family member 2 3 1
MIRT063199 ADIPOR2 adiponectin receptor 2 1 1
MIRT065691 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 2
MIRT067403 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT068157 TXLNA taxilin alpha 1 1
MIRT068532 NHLRC3 NHL repeat containing 3 1 3
MIRT068792 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT073008 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 3
MIRT073672 IGF1R insulin-like growth factor 1 receptor 1 4
MIRT076227 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT080402 ONECUT2 one cut homeobox 2 1 1
MIRT083304 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT084979 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT094164 PCGF3 polycomb group ring finger 3 1 3
MIRT094464 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 2
MIRT095770 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT100096 ABT1 activator of basal transcription 1 1 4
MIRT112245 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 2
MIRT118589 STK4 serine/threonine kinase 4 1 1
MIRT120924 PDE12 phosphodiesterase 12 1 4
MIRT123321 CALU calumenin 1 1
MIRT123980 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT152281 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153856 NCOA3 nuclear receptor coactivator 3 1 1
MIRT168587 HMGA1 high mobility group AT-hook 1 1 2
MIRT180606 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT187721 SUOX sulfite oxidase 1 1
MIRT191407 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT193104 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT215724 C5ORF51 chromosome 5 open reading frame 51 1 5
MIRT218816 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT240333 UBXN2B UBX domain protein 2B 1 1
MIRT243476 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT244074 EDN1 endothelin 1 1 1
MIRT252334 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255318 CDV3 CDV3 homolog (mouse) 1 1
MIRT259280 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT259483 TXLNG taxilin gamma 1 1
MIRT260711 CLDN12 claudin 12 1 3
MIRT264695 C11ORF57 chromosome 11 open reading frame 57 1 2
MIRT266216 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT266629 CHTOP chromatin target of PRMT1 1 1
MIRT268842 C1ORF21 chromosome 1 open reading frame 21 1 1
MIRT284531 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT294449 ZNF264 zinc finger protein 264 1 1
MIRT297445 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 2
MIRT300041 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT300896 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT303323 MXD1 MAX dimerization protein 1 1 1
MIRT309849 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT322431 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT324735 ACER2 alkaline ceramidase 2 1 1
MIRT402061 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT437976 AKT2 v-akt murine thymoma viral oncogene homolog 2 3 1
MIRT438631 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 2 1
MIRT442018 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT445656 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 3
MIRT447134 KIF27 kinesin family member 27 1 1
MIRT448256 ZNF774 zinc finger protein 774 1 1
MIRT449009 ANKRD46 ankyrin repeat domain 46 1 1
MIRT449951 FMNL3 formin-like 3 1 1
MIRT451153 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT451622 MEIS3P1 Meis homeobox 3 pseudogene 1 1 1
MIRT451691 C1RL complement component 1, r subcomponent-like 1 1
MIRT452090 NUCB2 nucleobindin 2 1 1
MIRT452429 QDPR quinoid dihydropteridine reductase 1 1
MIRT452941 DISC1 disrupted in schizophrenia 1 1 1
MIRT453399 RHD Rh blood group, D antigen 1 3
MIRT454162 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT454278 FXN frataxin 1 1
MIRT454537 RABL2A RAB, member of RAS oncogene family-like 2A 1 1
MIRT454852 ACOT9 acyl-CoA thioesterase 9 1 2
MIRT455674 GLO1 glyoxalase I 1 1
MIRT457246 RABL2B RAB, member of RAS oncogene family-like 2B 1 1
MIRT457675 ZNF587 zinc finger protein 587 1 1
MIRT457885 THEM6 thioesterase superfamily member 6 1 2
MIRT458014 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT458277 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT459734 RRM1 ribonucleotide reductase M1 1 1
MIRT460451 NOM1 nucleolar protein with MIF4G domain 1 1 2
MIRT460498 FAM105A family with sequence similarity 105, member A 1 3
MIRT460936 NOA1 nitric oxide associated 1 1 2
MIRT461090 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT461167 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 2
MIRT461362 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT462380 YAE1D1 Yae1 domain containing 1 1 1
MIRT462778 ZNF8 zinc finger protein 8 1 1
MIRT463416 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463660 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT464263 VCL vinculin 1 1
MIRT465128 TSC22D2 TSC22 domain family, member 2 1 2
MIRT466187 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466723 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT469100 RNF144B ring finger protein 144B 1 1
MIRT469716 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT470420 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT470681 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 2
MIRT470863 PLXND1 plexin D1 1 1
MIRT471273 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT471964 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472674 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT472734 MTUS1 microtubule associated tumor suppressor 1 1 3
MIRT473130 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT473238 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT473826 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT473938 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT474026 LRRC20 leucine rich repeat containing 20 1 1
MIRT474503 KLHDC8B kelch domain containing 8B 1 1
MIRT474764 KIAA0930 KIAA0930 1 1
MIRT474909 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT475329 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT475377 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT475731 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 2
MIRT476546 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT476979 FAM83G family with sequence similarity 83, member G 1 2
MIRT477680 EFHD2 EF-hand domain family, member D2 1 1
MIRT479748 CCND1 cyclin D1 1 1
MIRT481191 ATXN7L3B ataxin 7-like 3B 1 2
MIRT481234 ATXN7L3 ataxin 7-like 3 1 1
MIRT481361 ATG9A autophagy related 9A 1 1
MIRT481386 ATG12 autophagy related 12 1 1
MIRT481650 AREL1 KIAA0317 1 1
MIRT481850 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT482182 AHR aryl hydrocarbon receptor 1 1
MIRT482218 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT485294 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT486657 ZNF28 zinc finger protein 28 1 1
MIRT489411 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT491858 ZBTB5 zinc finger and BTB domain containing 5 1 4
MIRT492212 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT492627 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT493327 LIMD2 LIM domain containing 2 1 1
MIRT493899 FAM43A family with sequence similarity 43, member A 1 2
MIRT494261 CEP120 centrosomal protein 120kDa 1 1
MIRT494683 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT495966 TBC1D19 TBC1 domain family, member 19 1 1
MIRT496109 SNX17 sorting nexin 17 1 1
MIRT497873 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT498120 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 2
MIRT499403 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 2
MIRT499491 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT499651 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 1 1
MIRT499940 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT499995 HIST1H2BD histone cluster 1, H2bd 1 2
MIRT500905 STRN striatin, calmodulin binding protein 1 2
MIRT501114 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 2
MIRT501177 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 3
MIRT501208 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT501244 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 3
MIRT501330 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT501353 RNF44 ring finger protein 44 1 2
MIRT501391 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 5
MIRT501436 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT501756 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT501947 MBD2 methyl-CpG binding domain protein 2 1 4
MIRT502105 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 4
MIRT502131 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 2
MIRT502786 CEP135 centrosomal protein 135kDa 1 1
MIRT502844 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT504787 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT505021 ZNF644 zinc finger protein 644 1 1
MIRT505578 SMC1A structural maintenance of chromosomes 1A 1 3
MIRT506363 NUP155 nucleoporin 155kDa 1 3
MIRT506934 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT507249 FIGN fidgetin 1 4
MIRT507695 COIL coilin 1 3
MIRT508399 C1orf210 chromosome 1 open reading frame 210 1 3
MIRT508663 DIABLO diablo, IAP-binding mitochondrial protein 1 2
MIRT508930 AK4 adenylate kinase 4 1 2
MIRT510398 ZNF566 zinc finger protein 566 1 3
MIRT510517 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT511384 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT512743 CD59 CD59 molecule, complement regulatory protein 1 2
MIRT515952 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT516081 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 2
MIRT521388 RDX radixin 1 2
MIRT522347 NCKIPSD NCK interacting protein with SH3 domain 1 2
MIRT523624 FZD9 frizzled family receptor 9 1 2
MIRT523731 FBXW2 F-box and WD repeat domain containing 2 1 2
MIRT523988 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT524114 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT525725 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT527761 RRAD Ras-related associated with diabetes 1 1
MIRT529725 OPRL1 opiate receptor-like 1 1 1
MIRT533186 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT536376 LEFTY1 left-right determination factor 1 1 1
MIRT543783 RBM12B RNA binding motif protein 12B 1 2
MIRT543866 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT545385 PM20D2 peptidase M20 domain containing 2 1 1
MIRT545889 ZNF200 zinc finger protein 200 1 2
MIRT546331 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547376 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT547574 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT547835 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 2
MIRT548263 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548349 EPHA4 EPH receptor A4 1 1
MIRT548530 DUSP1 dual specificity phosphatase 1 1 1
MIRT548558 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT548778 COLEC12 collectin sub-family member 12 1 1
MIRT548973 CCNT2 cyclin T2 1 1
MIRT549023 CBX5 chromobox homolog 5 1 1
MIRT549210 BEND4 BEN domain containing 4 1 2
MIRT549761 ZNF611 zinc finger protein 611 1 3
MIRT549797 KIAA0391 KIAA0391 1 1
MIRT549845 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT550725 PMPCA peptidase (mitochondrial processing) alpha 1 2
MIRT550896 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT551281 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 3
MIRT551316 GSG2 germ cell associated 2 (haspin) 1 3
MIRT551930 AKAP8 A kinase (PRKA) anchor protein 8 1 2
MIRT552001 RAD18 RAD18 homolog (S. cerevisiae) 1 1
MIRT552408 ZNF460 zinc finger protein 460 1 2
MIRT553015 USP38 ubiquitin specific peptidase 38 1 1
MIRT555548 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT555713 PDZD8 PDZ domain containing 8 1 1
MIRT557379 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT557963 FAM222B family with sequence similarity 222, member B 1 1
MIRT559083 C19orf47 chromosome 19 open reading frame 47 1 2
MIRT559495 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT561780 PEG10 paternally expressed 10 1 1
MIRT564400 EMILIN2 elastin microfibril interfacer 2 1 2
MIRT565447 SURF4 surfeit 4 1 1
MIRT566516 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT567433 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT567713 E2F6 E2F transcription factor 6 1 1
MIRT568659 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT569496 THYN1 thymocyte nuclear protein 1 1 1
MIRT573818 TGOLN2 trans-golgi network protein 2 1 1
MIRT574361 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT574745 GOLGA4 golgin A4 1 1
MIRT574784 FAM104A family with sequence similarity 104, member A 1 1
MIRT576084 Poteg POTE ankyrin domain family, member G 1 1
MIRT576809 Thbs1 thrombospondin 1 1 1
MIRT616368 RWDD1 RWD domain containing 1 1 1
MIRT617849 FMO4 flavin containing monooxygenase 4 1 1
MIRT642392 ZNF556 zinc finger protein 556 1 1
MIRT680517 PRIM2 primase, DNA, polypeptide 2 (58kDa) 1 1
MIRT680545 ZNF584 zinc finger protein 584 1 1
MIRT680798 ZNF578 zinc finger protein 578 1 1
MIRT680836 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT681139 INTS7 integrator complex subunit 7 1 1
MIRT681269 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT681321 ZFAND4 zinc finger, AN1-type domain 4 1 2
MIRT681357 BRI3BP BRI3 binding protein 1 1
MIRT681504 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT681534 ZNF738 zinc finger protein 738 1 1
MIRT681656 DTX3L deltex 3-like (Drosophila) 1 1
MIRT681736 RAB19 RAB19, member RAS oncogene family 1 2
MIRT681759 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT681795 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT681867 DNAH9 dynein, axonemal, heavy chain 9 1 1
MIRT681939 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682100 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 2
MIRT682179 SLC38A7 solute carrier family 38, member 7 1 1
MIRT682236 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT682382 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT682442 MTX3 metaxin 3 1 1
MIRT682602 CPA4 carboxypeptidase A4 1 1
MIRT682638 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT689325 FPR1 formyl peptide receptor 1 1 1
MIRT689728 ATXN2 ataxin 2 1 1
MIRT691034 ZNF799 zinc finger protein 799 1 1
MIRT691933 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT694882 ZNF417 zinc finger protein 417 1 1
MIRT695253 ZNF443 zinc finger protein 443 1 1
MIRT695411 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT700591 PRSS22 protease, serine, 22 1 1
MIRT701432 NHLRC2 NHL repeat containing 2 1 1
MIRT702482 KIAA1328 KIAA1328 1 1
MIRT702708 IPO9 importin 9 1 1
MIRT704033 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT704421 CTPS1 CTP synthase 1 1 1
MIRT705748 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT712368 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT713518 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*