Accession ID: MIRT006400 [miRNA, hsa-let-7f-5p :: IL13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7f-1LinkOut: [miRBase ]
Synonyms LET7F1, MIRNLET7F1, let-7f-1, MIRLET7F1
Description Homo sapiens let-7f-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7f-5p
Mature Sequence 7| UGAGGUAGUAGAUUGUAUAGUU |28
Evidence Experimental
Experiments Cloned
Putative hsa-let-7f-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ALRH, BHR1, IL-13, P600
Description interleukin 13
Transcript NM_002188    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL13
(miRNA target sites are highlighted)
>IL13|NM_002188|3'UTR
   1 AACTTCGAAAGCATCATTATTTGCAGAGACAGGACCTGACTATTGAAGTTGCAGATTCATTTTTCTTTCTGATGTCAAAA
  81 ATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTCTTC
 161 AGCCTAGCCGACCTCAGCCTTCCCCTTGCCCAGGGCTCAGCCTGGTGGGCCTCCTCTGTCCAGGGCCCTGAGCTCGGTGG
 241 ACCCAGGGATGACATGTCCCTACACCCCTCCCCTGCCCTAGAGCACACTGTAGCATTACAGTGGGTGCCCCCCTTGCCAG
 321 ACATGTGGTGGGACAGGGACCCACTTCACACACAGGCAACTGAGGCAGACAGCAGCTCAGGCACACTTCTTCTTGGTCTT
 401 ATTTATTATTGTGTGTTATTTAAATGAGTGTGTTTGTCACCGTTGGGGATTGGGGAAGACTGTGGCTGCTAGCACTTGGA
 481 GCCAAGGGTTCAGAGACTCAGGGCCCCAGCACTAAAGCAGTGGACACCAGGAGTCCCTGGTAATAAGTACTGTGTACAGA
 561 ATTCTGCTACCTCACTGGGGTCCTGGGGCCTCGGAGCCTCATCCGAGGCAGGGTCAGGAGAGGGGCAGAACAGCCGCTCC
 641 TGTCTGCCAGCCAGCAGCCAGCTCTCAGCCAACGAGTAATTTATTGTTTTTCCTTGTATTTAAATATTAAATATGTTAGC
 721 AAAGAGTTAATATATAGAAGGGTACCTTGAACACTGGGGGAGGGGACATTGAACAAGTTGTTTCATTGACTATCAAACTG
 801 AAGCCAGAAATAAAGTTGGTGACAGAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugAUAUGUU---AGAUGAUGGAGu 5'
             |:||||:   |||:||||||| 
Target 5' ctgTGTACAGAATTCTGCTACCTCa 3'
550 - 574 171.00 -23.20
2
miRNA  3' uugAUAUGUUAGAU--GAUGGAGu 5'
             | | ||: |||  | ||||| 
Target 5' ccgTCTTCAGCCTAGCCGACCTCa 3'
153 - 176 125.00 -12.00
3
miRNA  3' uugAUAUGUUAGAUGAUGGAGu 5'
             ||||:|:   : |||||: 
Target 5' taaTATATAGAAGGGTACCTTg 3'
728 - 749 111.00 -9.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7f-5p :: IL13    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions A549
Location of target site 3'UTR
Tools used in this research miRanda , RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Let-7 targets IL13 3 ' UTR ...

- Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al., 2011, The Journal of allergy and clinical immunology.

Article - Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al.
- The Journal of allergy and clinical immunology, 2011
BACKGROUND: IL-13, a cytokine secreted by T(H)2 lymphocytes and other cells, critically modulates allergic inflammation and tissue remodeling in allergic asthma. Although much is known about transcriptional regulation of IL-13, posttranscriptional regulation is poorly understood. OBJECTIVE: Because many inflammatory pathways are known to be regulated by microRNAs, permitting a rapid and fine-tuned response, the role of microRNA-mediated regulation of IL-13 was investigated using both in vitro and in vivo studies. METHODS: A combination of in silico approaches and in vitro transfections in A549 cells and primary cultured T cells was used to demonstrate the involvement of let-7 in IL-13 regulation. Furthermore, intranasal delivery of let-7 microRNA mimic in mice was performed to study its effects in allergic airway inflammatory conditions. RESULTS: Using a combination of bioinformatics and molecular approaches, we demonstrate that the let-7 family of microRNAs regulates IL-13 expression. Induced levels of IL-13 in cultured T cells were inversely related to let-7 levels. In an IL-13-dependent murine model of allergic airway inflammation, we observed that inflammation was associated with a reduction in most of the members of the let-7 family. Exogenous administration of let-7 mimic to lungs of mice with allergic inflammation resulted in a decrease in IL-13 levels, resolution of airway inflammation, reduction in airway hyperresponsiveness, and attenuation of mucus metaplasia and subepithelial fibrosis. CONCLUSION: Let-7 microRNAs inhibit IL-13 expression and represent a major regulatory mechanism for modulating IL-13 secretion in IL-13-producing cell types and thereby T(H)2 inflammation.
LinkOut: [PMID: 21616524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
370 hsa-let-7f-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000455 KLK10 kallikrein-related peptidase 10 3 2
MIRT004678 KLK6 kallikrein-related peptidase 6 3 1
MIRT005514 PRDM1 PR domain containing 1, with ZNF domain 4 2
MIRT006400 IL13 interleukin 13 2 1
MIRT006407 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT006943 CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 1 1
MIRT032078 KIF1A kinesin family member 1A 1 1
MIRT032079 FDPS farnesyl diphosphate synthase 1 1
MIRT032080 TFF1 trefoil factor 1 1 1
MIRT032081 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT032082 ESM1 endothelial cell-specific molecule 1 1 1
MIRT032083 ASS1 argininosuccinate synthase 1 1 1
MIRT032084 VIM vimentin 1 1
MIRT032085 NTS neurotensin 1 1
MIRT032086 COPS8 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) 1 1
MIRT032087 NKX2-1 NK2 homeobox 1 1 1
MIRT032088 SLC5A5 solute carrier family 5 (sodium iodide symporter), member 5 1 1
MIRT032089 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 2
MIRT032090 GPS1 G protein pathway suppressor 1 1 1
MIRT032091 TG thyroglobulin 1 1
MIRT032092 CCND1 cyclin D1 3 3
MIRT032093 COPS6 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) 1 1
MIRT032095 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2 2
MIRT051352 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT051353 MEF2D myocyte enhancer factor 2D 1 1
MIRT051354 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT051355 UBAP2 ubiquitin associated protein 2 1 1
MIRT051356 CEP170B KIAA0284 1 1
MIRT051357 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT051358 ARMC8 armadillo repeat containing 8 1 1
MIRT051359 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051360 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT051361 YARS2 tyrosyl-tRNA synthetase 2, mitochondrial 1 1
MIRT051362 GLUL glutamate-ammonia ligase 1 1
MIRT051363 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 4
MIRT051364 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT051365 USP45 ubiquitin specific peptidase 45 1 1
MIRT051366 RABEP1 rabaptin, RAB GTPase binding effector protein 1 1 1
MIRT051367 CNOT8 CCR4-NOT transcription complex, subunit 8 1 1
MIRT051368 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT051369 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051370 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT051371 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT051372 SP1 Sp1 transcription factor 1 1
MIRT051373 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT051374 TCEB3 transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) 1 1
MIRT051375 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT051376 ALDH7A1 aldehyde dehydrogenase 7 family, member A1 1 1
MIRT051377 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT051378 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT051379 MTSS1L metastasis suppressor 1-like 1 1
MIRT051380 TSPAN3 tetraspanin 3 1 1
MIRT051381 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT051382 CAPRIN2 caprin family member 2 1 1
MIRT051383 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT051384 NARS asparaginyl-tRNA synthetase 1 1
MIRT051385 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT051386 ROR2 receptor tyrosine kinase-like orphan receptor 2 1 1
MIRT051387 ANP32C acidic (leucine-rich) nuclear phosphoprotein 32 family, member C 1 1
MIRT051388 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT051389 ATXN2L ataxin 2-like 1 1
MIRT051390 SPTBN5 spectrin, beta, non-erythrocytic 5 1 1
MIRT051391 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT051392 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT051393 SLC25A12 solute carrier family 25 (aspartate/glutamate carrier), member 12 1 1
MIRT051394 ATR ataxia telangiectasia and Rad3 related 1 1
MIRT051395 BCOR BCL6 corepressor 1 1
MIRT051396 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT051397 ZNF280B zinc finger protein 280B 1 1
MIRT051398 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT051399 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 1
MIRT051400 CCNB2 cyclin B2 1 1
MIRT051401 USP2 ubiquitin specific peptidase 2 1 1
MIRT051402 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 2
MIRT051403 HMGA2 high mobility group AT-hook 2 1 3
MIRT051404 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT051405 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 3
MIRT051406 ASTE1 asteroid homolog 1 (Drosophila) 1 1
MIRT051407 NUDT4 nudix (nucleoside diphosphate linked moiety X)-type motif 4 1 1
MIRT051408 SART3 squamous cell carcinoma antigen recognized by T cells 3 1 1
MIRT051409 ATL1 atlastin GTPase 1 1 1
MIRT051410 THOC5 THO complex 5 1 1
MIRT051411 EDA ectodysplasin A 1 1
MIRT051412 CCNG1 cyclin G1 1 1
MIRT053474 MYH9 myosin, heavy chain 9, non-muscle 3 1
MIRT053626 CALM1 calmodulin 1 (phosphorylase kinase, delta) 1 1
MIRT053627 PDGFB platelet-derived growth factor beta polypeptide 1 1
MIRT053628 FARP1 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) 1 1
MIRT053629 ACTR10 actin-related protein 10 homolog (S. cerevisiae) 1 1
MIRT053630 B3GNT1 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 1 1
MIRT053631 GALC galactosylceramidase 1 1
MIRT053632 FZD4 frizzled family receptor 4 1 1
MIRT053633 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT054389 SOCS3 suppressor of cytokine signaling 3 1 1
MIRT054390 ELF4 E74-like factor 4 (ets domain transcription factor) 1 1
MIRT054391 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT054392 CCL7 chemokine (C-C motif) ligand 7 1 1
MIRT063196 ADIPOR2 adiponectin receptor 2 1 1
MIRT065688 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 2
MIRT067400 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT068155 TXLNA taxilin alpha 1 1
MIRT068529 NHLRC3 NHL repeat containing 3 1 3
MIRT068790 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT073669 IGF1R insulin-like growth factor 1 receptor 1 4
MIRT076224 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT080399 ONECUT2 one cut homeobox 2 1 1
MIRT083301 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT084977 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT094161 PCGF3 polycomb group ring finger 3 1 3
MIRT094461 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 2
MIRT095767 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT100095 ABT1 activator of basal transcription 1 1 4
MIRT112243 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 2
MIRT118587 STK4 serine/threonine kinase 4 1 1
MIRT120922 PDE12 phosphodiesterase 12 1 4
MIRT123318 CALU calumenin 1 1
MIRT123976 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT152273 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153848 NCOA3 nuclear receptor coactivator 3 1 1
MIRT168584 HMGA1 high mobility group AT-hook 1 1 2
MIRT180604 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT187718 SUOX sulfite oxidase 1 1
MIRT191405 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT193102 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT215721 C5ORF51 chromosome 5 open reading frame 51 1 5
MIRT240331 UBXN2B UBX domain protein 2B 1 1
MIRT243474 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT244070 EDN1 endothelin 1 1 1
MIRT252331 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255315 CDV3 CDV3 homolog (mouse) 1 1
MIRT259278 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT259480 TXLNG taxilin gamma 1 1
MIRT260708 CLDN12 claudin 12 1 3
MIRT264694 C11ORF57 chromosome 11 open reading frame 57 1 2
MIRT266213 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT266627 CHTOP chromatin target of PRMT1 1 1
MIRT268840 C1ORF21 chromosome 1 open reading frame 21 1 1
MIRT284528 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT294447 ZNF264 zinc finger protein 264 1 1
MIRT297014 RRM2 ribonucleotide reductase M2 1 1
MIRT297444 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 2
MIRT300038 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT300894 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT303321 MXD1 MAX dimerization protein 1 1 1
MIRT309847 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT322429 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT324732 ACER2 alkaline ceramidase 2 1 1
MIRT402058 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT437856 EIF2C1 eukaryotic translation initiation factor 2C, 1 3 1
MIRT437990 HDAC2 histone deacetylase 2 1 1
MIRT442019 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT445657 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 3
MIRT447135 KIF27 kinesin family member 27 1 1
MIRT448258 ZNF774 zinc finger protein 774 1 1
MIRT449004 ANKRD46 ankyrin repeat domain 46 1 1
MIRT449952 FMNL3 formin-like 3 1 1
MIRT451154 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT451623 MEIS3P1 Meis homeobox 3 pseudogene 1 1 1
MIRT451692 C1RL complement component 1, r subcomponent-like 1 1
MIRT452091 NUCB2 nucleobindin 2 1 1
MIRT452430 QDPR quinoid dihydropteridine reductase 1 1
MIRT452942 DISC1 disrupted in schizophrenia 1 1 1
MIRT453400 RHD Rh blood group, D antigen 1 3
MIRT454163 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT454279 FXN frataxin 1 1
MIRT454538 RABL2A RAB, member of RAS oncogene family-like 2A 1 1
MIRT454853 ACOT9 acyl-CoA thioesterase 9 1 2
MIRT455675 GLO1 glyoxalase I 1 1
MIRT457247 RABL2B RAB, member of RAS oncogene family-like 2B 1 1
MIRT457676 ZNF587 zinc finger protein 587 1 1
MIRT457886 THEM6 thioesterase superfamily member 6 1 2
MIRT458015 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT458278 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT459735 RRM1 ribonucleotide reductase M1 1 1
MIRT460452 NOM1 nucleolar protein with MIF4G domain 1 1 2
MIRT460499 FAM105A family with sequence similarity 105, member A 1 3
MIRT460937 NOA1 nitric oxide associated 1 1 2
MIRT461091 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT461168 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 2
MIRT461363 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT462381 YAE1D1 Yae1 domain containing 1 1 1
MIRT462779 ZNF8 zinc finger protein 8 1 1
MIRT463417 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463661 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT464264 VCL vinculin 1 1
MIRT465127 TSC22D2 TSC22 domain family, member 2 1 2
MIRT466185 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466725 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT469101 RNF144B ring finger protein 144B 1 1
MIRT469715 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT470418 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT470680 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 2
MIRT470862 PLXND1 plexin D1 1 1
MIRT471272 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT471966 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472673 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT472740 MTUS1 microtubule associated tumor suppressor 1 1 3
MIRT473131 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT473242 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT473827 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT473939 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT474025 LRRC20 leucine rich repeat containing 20 1 1
MIRT474495 KLHDC8B kelch domain containing 8B 1 1
MIRT474765 KIAA0930 KIAA0930 1 1
MIRT474910 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT475330 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT475378 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT475732 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 2
MIRT476547 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT476978 FAM83G family with sequence similarity 83, member G 1 2
MIRT477540 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 2
MIRT477681 EFHD2 EF-hand domain family, member D2 1 1
MIRT481199 ATXN7L3B ataxin 7-like 3B 1 2
MIRT481242 ATXN7L3 ataxin 7-like 3 1 1
MIRT481362 ATG9A autophagy related 9A 1 1
MIRT481387 ATG12 autophagy related 12 1 1
MIRT481651 AREL1 KIAA0317 1 1
MIRT481845 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT482183 AHR aryl hydrocarbon receptor 1 1
MIRT482219 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT485295 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT486658 ZNF28 zinc finger protein 28 1 1
MIRT489412 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT491857 ZBTB5 zinc finger and BTB domain containing 5 1 4
MIRT492213 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT492630 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT493324 LIMD2 LIM domain containing 2 1 1
MIRT493900 FAM43A family with sequence similarity 43, member A 1 2
MIRT494262 CEP120 centrosomal protein 120kDa 1 1
MIRT494682 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT495967 TBC1D19 TBC1 domain family, member 19 1 1
MIRT496110 SNX17 sorting nexin 17 1 1
MIRT497874 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT498121 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 2
MIRT499404 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 2
MIRT499492 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT499652 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 1 1
MIRT499941 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT499996 HIST1H2BD histone cluster 1, H2bd 1 2
MIRT500816 THBS1 thrombospondin 1 1 1
MIRT500903 STRN striatin, calmodulin binding protein 1 2
MIRT501117 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 2
MIRT501176 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 3
MIRT501211 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT501246 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 3
MIRT501329 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT501352 RNF44 ring finger protein 44 1 2
MIRT501390 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 5
MIRT501434 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT501758 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT501945 MBD2 methyl-CpG binding domain protein 2 1 4
MIRT502107 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 4
MIRT502128 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 2
MIRT502785 CEP135 centrosomal protein 135kDa 1 1
MIRT502843 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT504788 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT505015 ZNF644 zinc finger protein 644 1 1
MIRT505584 SMC1A structural maintenance of chromosomes 1A 1 3
MIRT506362 NUP155 nucleoporin 155kDa 1 3
MIRT506939 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT507251 FIGN fidgetin 1 4
MIRT507696 COIL coilin 1 3
MIRT508400 C1orf210 chromosome 1 open reading frame 210 1 3
MIRT508664 DIABLO diablo, IAP-binding mitochondrial protein 1 2
MIRT508931 AK4 adenylate kinase 4 1 2
MIRT510394 ZNF566 zinc finger protein 566 1 3
MIRT510519 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT511385 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT512744 CD59 CD59 molecule, complement regulatory protein 1 2
MIRT515953 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT516082 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 2
MIRT521393 RDX radixin 1 2
MIRT522348 NCKIPSD NCK interacting protein with SH3 domain 1 2
MIRT523628 FZD9 frizzled family receptor 9 1 2
MIRT523732 FBXW2 F-box and WD repeat domain containing 2 1 2
MIRT523980 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT524112 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT525726 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT527762 RRAD Ras-related associated with diabetes 1 1
MIRT529726 OPRL1 opiate receptor-like 1 1 1
MIRT533185 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT536377 LEFTY1 left-right determination factor 1 1 1
MIRT543784 RBM12B RNA binding motif protein 12B 1 2
MIRT543867 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT545386 PM20D2 peptidase M20 domain containing 2 1 1
MIRT545888 ZNF200 zinc finger protein 200 1 2
MIRT546330 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547375 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT547832 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 2
MIRT548265 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548348 EPHA4 EPH receptor A4 1 1
MIRT548531 DUSP1 dual specificity phosphatase 1 1 1
MIRT548559 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT548781 COLEC12 collectin sub-family member 12 1 1
MIRT548979 CCNT2 cyclin T2 1 1
MIRT549027 CBX5 chromobox homolog 5 1 1
MIRT549209 BEND4 BEN domain containing 4 1 2
MIRT549762 ZNF611 zinc finger protein 611 1 3
MIRT549798 KIAA0391 KIAA0391 1 1
MIRT549846 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT550726 PMPCA peptidase (mitochondrial processing) alpha 1 2
MIRT550897 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT551282 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 3
MIRT551317 GSG2 germ cell associated 2 (haspin) 1 3
MIRT551931 AKAP8 A kinase (PRKA) anchor protein 8 1 2
MIRT552002 RAD18 RAD18 homolog (S. cerevisiae) 1 1
MIRT552409 ZNF460 zinc finger protein 460 1 2
MIRT553014 USP38 ubiquitin specific peptidase 38 1 1
MIRT555549 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT555712 PDZD8 PDZ domain containing 8 1 1
MIRT557373 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT557961 FAM222B family with sequence similarity 222, member B 1 1
MIRT559084 C19orf47 chromosome 19 open reading frame 47 1 2
MIRT559496 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT561774 PEG10 paternally expressed 10 1 1
MIRT564401 EMILIN2 elastin microfibril interfacer 2 1 2
MIRT565448 SURF4 surfeit 4 1 1
MIRT566517 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT567429 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT567714 E2F6 E2F transcription factor 6 1 1
MIRT568654 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT569497 THYN1 thymocyte nuclear protein 1 1 1
MIRT573819 TGOLN2 trans-golgi network protein 2 1 1
MIRT574362 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT574751 GOLGA4 golgin A4 1 1
MIRT574785 FAM104A family with sequence similarity 104, member A 1 1
MIRT576090 Poteg POTE ankyrin domain family, member G 1 1
MIRT576808 Thbs1 thrombospondin 1 1 1
MIRT616369 RWDD1 RWD domain containing 1 1 1
MIRT617850 FMO4 flavin containing monooxygenase 4 1 1
MIRT642393 ZNF556 zinc finger protein 556 1 1
MIRT680518 PRIM2 primase, DNA, polypeptide 2 (58kDa) 1 1
MIRT680546 ZNF584 zinc finger protein 584 1 1
MIRT680799 ZNF578 zinc finger protein 578 1 1
MIRT680837 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT681140 INTS7 integrator complex subunit 7 1 1
MIRT681270 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT681322 ZFAND4 zinc finger, AN1-type domain 4 1 2
MIRT681358 BRI3BP BRI3 binding protein 1 1
MIRT681505 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT681535 ZNF738 zinc finger protein 738 1 1
MIRT681657 DTX3L deltex 3-like (Drosophila) 1 1
MIRT681737 RAB19 RAB19, member RAS oncogene family 1 2
MIRT681760 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT681796 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT681868 DNAH9 dynein, axonemal, heavy chain 9 1 1
MIRT681940 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682101 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 2
MIRT682180 SLC38A7 solute carrier family 38, member 7 1 1
MIRT682237 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT682383 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT682443 MTX3 metaxin 3 1 1
MIRT682603 CPA4 carboxypeptidase A4 1 1
MIRT682639 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT689326 FPR1 formyl peptide receptor 1 1 1
MIRT689729 ATXN2 ataxin 2 1 1
MIRT691035 ZNF799 zinc finger protein 799 1 1
MIRT691934 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT694883 ZNF417 zinc finger protein 417 1 1
MIRT695254 ZNF443 zinc finger protein 443 1 1
MIRT695412 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT700590 PRSS22 protease, serine, 22 1 1
MIRT701431 NHLRC2 NHL repeat containing 2 1 1
MIRT702483 KIAA1328 KIAA1328 1 1
MIRT702712 IPO9 importin 9 1 1
MIRT704032 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT704417 CTPS1 CTP synthase 1 1 1
MIRT705749 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT712366 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT713519 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*