Accession ID: MIRT006400 [miRNA, hsa-let-7f-5p :: IL13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7f-1LinkOut: [miRBase ]
Synonyms LET7F1, MIRNLET7F1, let-7f-1, MIRLET7F1
Description Homo sapiens let-7f-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7f-5p
Mature Sequence 7| UGAGGUAGUAGAUUGUAUAGUU |28
Evidence Experimental
Experiments Cloned
Putative hsa-let-7f-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ALRH, BHR1, IL-13, MGC116786, MGC116788, MGC116789, P600
Description interleukin 13
Transcript NM_0021    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL13
(miRNA target sites are highlighted)
>IL13|NM_0021|3'UTR
   1 TGAAACTTCGAAAGCATCATTATTTGCAGAGACAGGACCTGACTATTGAAGTTGCAGATTCATTTTTCTTTCTGATGTCA
  81 AAAATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTC
 161 TTCAGCCTAGCCGACCTCAGCCTTCCCCTTGCCCAGGGCTCAGCCTGGTGGGCCTCCTCTGTCCAGGGCCCTGAGCTCGG
 241 TGGACCCAGGGATGACATGTCCCTACACCCCTCCCCTGCCCTAGAGCACACTGTAGCATTACAGTGGGTGCCCCCCTTGC
 321 CAGACATGTGGTGGGACAGGGACCCACTTCACACACAGGCAACTGAGGCAGACAGCAGCTCAGGCACACTTCTTCTTGGT
 401 CTTATTTATTATTGTGTGTTATTTAAATGAGTGTGTTTGTCACCGTTGGGGATTGGGGAAGACTGTGGCTGCTAGCACTT
 481 GGAGCCAAGGGTTCAGAGACTCAGGGCCCCAGCACTAAAGCAGTGGACACCAGGAGTCCCTGGTAATAAGTACTGTGTAC
 561 AGAATTCTGCTACCTCACTGGGGTCCTGGGGCCTCGGAGCCTCATCCGAGGCAGGGTCAGGAGAGGGGCAGAACAGCCGC
 641 TCCTGTCTGCCAGCCAGCAGCCAGCTCTCAGCCAACGAGTAATTTATTGTTTTTCCTTGTATTTAAATATTAAATATGTT
 721 AGCAAAGAGTTAATATATAGAAGGGTACCTTGAACACTGGGGGAGGGGACATTGAACAAGTTGTTTCATTGACTATCAAA
 801 CTGAAGCCAGAAATAAAGTTGGTGACAGAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugAUAUGUU---AGAUGAUGGAGu 5'
             |:||||:   |||:||||||| 
Target 5' ctgTGTACAGAATTCTGCTACCTCa 3'
553 - 577 171.00 -23.20
2
miRNA  3' uugAUAUGUUAGAU--GAUGGAGu 5'
             | | ||: |||  | ||||| 
Target 5' ccgTCTTCAGCCTAGCCGACCTCa 3'
156 - 179 125.00 -12.00
3
miRNA  3' uugAUAUGUUAGAUGAUGGAGu 5'
             ||||:|:   : |||||: 
Target 5' taaTATATAGAAGGGTACCTTg 3'
731 - 752 111.00 -9.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7f-5p :: IL13    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions A549
Location of target site 3'UTR
Tools used in this research miRanda , RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Let-7 targets IL13 3 ' UTR ...

- Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al., 2011, The Journal of allergy and clinical immunology.

Article - Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al.
- The Journal of allergy and clinical immunology, 2011
BACKGROUND: IL-13, a cytokine secreted by T(H)2 lymphocytes and other cells, critically modulates allergic inflammation and tissue remodeling in allergic asthma. Although much is known about transcriptional regulation of IL-13, posttranscriptional regulation is poorly understood. OBJECTIVE: Because many inflammatory pathways are known to be regulated by microRNAs, permitting a rapid and fine-tuned response, the role of microRNA-mediated regulation of IL-13 was investigated using both in vitro and in vivo studies. METHODS: A combination of in silico approaches and in vitro transfections in A549 cells and primary cultured T cells was used to demonstrate the involvement of let-7 in IL-13 regulation. Furthermore, intranasal delivery of let-7 microRNA mimic in mice was performed to study its effects in allergic airway inflammatory conditions. RESULTS: Using a combination of bioinformatics and molecular approaches, we demonstrate that the let-7 family of microRNAs regulates IL-13 expression. Induced levels of IL-13 in cultured T cells were inversely related to let-7 levels. In an IL-13-dependent murine model of allergic airway inflammation, we observed that inflammation was associated with a reduction in most of the members of the let-7 family. Exogenous administration of let-7 mimic to lungs of mice with allergic inflammation resulted in a decrease in IL-13 levels, resolution of airway inflammation, reduction in airway hyperresponsiveness, and attenuation of mucus metaplasia and subepithelial fibrosis. CONCLUSION: Let-7 microRNAs inhibit IL-13 expression and represent a major regulatory mechanism for modulating IL-13 secretion in IL-13-producing cell types and thereby T(H)2 inflammation.
LinkOut: [PMID: 21616524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
84 hsa-let-7f-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000455 KLK10 kallikrein-related peptidase 10 3 2
MIRT004678 KLK6 kallikrein-related peptidase 6 3 1
MIRT005514 PRDM1 PR domain containing 1, with ZNF domain 4 1
MIRT006400 IL13 interleukin 13 2 1
MIRT006407 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT006943 CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 1 1
MIRT032078 KIF1A kinesin family member 1A 1 1
MIRT032079 FDPS farnesyl diphosphate synthase (farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase) 1 1
MIRT032080 TFF1 trefoil factor 1 1 1
MIRT032081 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT032082 ESM1 endothelial cell-specific molecule 1 1 1
MIRT032083 ASS1 argininosuccinate synthase 1 1 1
MIRT032084 VIM vimentin 1 1
MIRT032085 NTS neurotensin 1 1
MIRT032086 COPS8 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) 1 1
MIRT032087 NKX2-1 NK2 homeobox 1 1 1
MIRT032088 SLC5A5 solute carrier family 5 (sodium iodide symporter), member 5 1 1
MIRT032089 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 1
MIRT032090 GPS1 G protein pathway suppressor 1 1 1
MIRT032091 TG thyroglobulin 1 1
MIRT032092 CCND1 cyclin D1 1 1
MIRT032093 COPS6 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) 1 1
MIRT032095 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT051352 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT051353 MEF2D myocyte enhancer factor 2D 1 1
MIRT051354 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT051355 UBAP2 ubiquitin associated protein 2 1 1
MIRT051356 CEP170B KIAA0284 1 1
MIRT051357 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT051358 ARMC8 armadillo repeat containing 8 1 1
MIRT051359 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051360 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT051361 YARS2 tyrosyl-tRNA synthetase 2, mitochondrial 1 1
MIRT051362 GLUL glutamate-ammonia ligase 1 1
MIRT051363 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 1
MIRT051364 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT051365 USP45 ubiquitin specific peptidase 45 1 1
MIRT051366 RABEP1 rabaptin, RAB GTPase binding effector protein 1 1 1
MIRT051367 CNOT8 CCR4-NOT transcription complex, subunit 8 1 1
MIRT051368 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT051369 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051370 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT051371 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT051372 SP1 Sp1 transcription factor 1 1
MIRT051373 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT051374 TCEB3 transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) 1 1
MIRT051375 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT051376 ALDH7A1 aldehyde dehydrogenase 7 family, member A1 1 1
MIRT051377 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT051378 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT051379 MTSS1L metastasis suppressor 1-like 1 1
MIRT051380 TSPAN3 tetraspanin 3 1 1
MIRT051381 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT051382 CAPRIN2 caprin family member 2 1 1
MIRT051383 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT051384 NARS asparaginyl-tRNA synthetase 1 1
MIRT051385 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT051386 ROR2 receptor tyrosine kinase-like orphan receptor 2 1 1
MIRT051387 ANP32C acidic (leucine-rich) nuclear phosphoprotein 32 family, member C 1 1
MIRT051388 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT051389 ATXN2L ataxin 2-like 1 1
MIRT051390 SPTBN5 spectrin, beta, non-erythrocytic 5 1 1
MIRT051391 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT051392 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT051393 SLC25A12 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 1 1
MIRT051394 ATR ataxia telangiectasia and Rad3 related 1 1
MIRT051395 BCOR BCL6 corepressor 1 1
MIRT051396 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT051397 ZNF280B zinc finger protein 280B 1 1
MIRT051398 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT051399 CNEP1R1 transmembrane protein 188 1 1
MIRT051400 CCNB2 cyclin B2 1 1
MIRT051401 USP2 ubiquitin specific peptidase 2 1 1
MIRT051402 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT051403 HMGA2 high mobility group AT-hook 2 1 1
MIRT051404 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT051405 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 1
MIRT051406 ASTE1 asteroid homolog 1 (Drosophila) 1 1
MIRT051407 NUDT4 nudix (nucleoside diphosphate linked moiety X)-type motif 4 1 1
MIRT051408 SART3 squamous cell carcinoma antigen recognized by T cells 3 1 1
MIRT051409 ATL1 atlastin GTPase 1 1 1
MIRT051410 THOC5 THO complex 5 1 1
MIRT051411 EDA ectodysplasin A 1 1
MIRT051412 CCNG1 cyclin G1 1 1