Accession ID: MIRT006401 [miRNA, hsa-let-7i-5p :: IL13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7iLinkOut: [miRBase ]
Synonyms LET7I, MIRNLET7I, hsa-let-7i, MIRLET7I
Description Homo sapiens let-7i stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7i-5p
Mature Sequence 6| UGAGGUAGUAGUUUGUGCUGUU |27
Evidence Experimental
Experiments Cloned
Putative hsa-let-7i-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ALRH, BHR1, IL-13, P600
Description interleukin 13
Transcript NM_002188    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL13
(miRNA target sites are highlighted)
>IL13|NM_002188|3'UTR
   1 AACTTCGAAAGCATCATTATTTGCAGAGACAGGACCTGACTATTGAAGTTGCAGATTCATTTTTCTTTCTGATGTCAAAA
  81 ATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTCTTC
 161 AGCCTAGCCGACCTCAGCCTTCCCCTTGCCCAGGGCTCAGCCTGGTGGGCCTCCTCTGTCCAGGGCCCTGAGCTCGGTGG
 241 ACCCAGGGATGACATGTCCCTACACCCCTCCCCTGCCCTAGAGCACACTGTAGCATTACAGTGGGTGCCCCCCTTGCCAG
 321 ACATGTGGTGGGACAGGGACCCACTTCACACACAGGCAACTGAGGCAGACAGCAGCTCAGGCACACTTCTTCTTGGTCTT
 401 ATTTATTATTGTGTGTTATTTAAATGAGTGTGTTTGTCACCGTTGGGGATTGGGGAAGACTGTGGCTGCTAGCACTTGGA
 481 GCCAAGGGTTCAGAGACTCAGGGCCCCAGCACTAAAGCAGTGGACACCAGGAGTCCCTGGTAATAAGTACTGTGTACAGA
 561 ATTCTGCTACCTCACTGGGGTCCTGGGGCCTCGGAGCCTCATCCGAGGCAGGGTCAGGAGAGGGGCAGAACAGCCGCTCC
 641 TGTCTGCCAGCCAGCAGCCAGCTCTCAGCCAACGAGTAATTTATTGTTTTTCCTTGTATTTAAATATTAAATATGTTAGC
 721 AAAGAGTTAATATATAGAAGGGTACCTTGAACACTGGGGGAGGGGACATTGAACAAGTTGTTTCATTGACTATCAAACTG
 801 AAGCCAGAAATAAAGTTGGTGACAGAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuguCGUGUUU---GAUGAUGGAGu 5'
              |:|||:|   ||:||||||| 
Target 5' ctgtGTACAGAATTCTGCTACCTCa 3'
550 - 574 166.00 -21.60
2
miRNA  3' uuGUCGUGUUUGAUGAUGGAGu 5'
            |||| | |:|  | ||||| 
Target 5' ttCAGC-CTAGC--CGACCTCa 3'
158 - 176 123.00 -14.00
3
miRNA  3' uuGUCGUGUUUG-AUGAUGGAGu 5'
            |||| ||::|  ||| |:|| 
Target 5' agCAGCTCAGGCACACTTCTTCt 3'
371 - 393 120.00 -15.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7i-5p :: IL13    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions A549
Location of target site 3'UTR
Tools used in this research miRanda , RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Let-7 targets IL13 3 ' UTR ...

- Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al., 2011, The Journal of allergy and clinical immunology.

Article - Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al.
- The Journal of allergy and clinical immunology, 2011
BACKGROUND: IL-13, a cytokine secreted by T(H)2 lymphocytes and other cells, critically modulates allergic inflammation and tissue remodeling in allergic asthma. Although much is known about transcriptional regulation of IL-13, posttranscriptional regulation is poorly understood. OBJECTIVE: Because many inflammatory pathways are known to be regulated by microRNAs, permitting a rapid and fine-tuned response, the role of microRNA-mediated regulation of IL-13 was investigated using both in vitro and in vivo studies. METHODS: A combination of in silico approaches and in vitro transfections in A549 cells and primary cultured T cells was used to demonstrate the involvement of let-7 in IL-13 regulation. Furthermore, intranasal delivery of let-7 microRNA mimic in mice was performed to study its effects in allergic airway inflammatory conditions. RESULTS: Using a combination of bioinformatics and molecular approaches, we demonstrate that the let-7 family of microRNAs regulates IL-13 expression. Induced levels of IL-13 in cultured T cells were inversely related to let-7 levels. In an IL-13-dependent murine model of allergic airway inflammation, we observed that inflammation was associated with a reduction in most of the members of the let-7 family. Exogenous administration of let-7 mimic to lungs of mice with allergic inflammation resulted in a decrease in IL-13 levels, resolution of airway inflammation, reduction in airway hyperresponsiveness, and attenuation of mucus metaplasia and subepithelial fibrosis. CONCLUSION: Let-7 microRNAs inhibit IL-13 expression and represent a major regulatory mechanism for modulating IL-13 secretion in IL-13-producing cell types and thereby T(H)2 inflammation.
LinkOut: [PMID: 21616524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
300 hsa-let-7i-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003050 TLR4 toll-like receptor 4 4 1
MIRT006373 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT006401 IL13 interleukin 13 2 1
MIRT024110 FANCD2 Fanconi anemia, complementation group D2 1 1
MIRT024111 DAD1 defender against cell death 1 1 1
MIRT024112 BMP2K BMP2 inducible kinase 1 1
MIRT024113 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 2 3
MIRT024114 COPS8 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) 1 1
MIRT024115 COPS6 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) 1 1
MIRT024116 GPS1 G protein pathway suppressor 1 1 1
MIRT046545 LPHN2 latrophilin 2 1 1
MIRT046546 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT046547 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT046548 TNS3 tensin 3 1 1
MIRT046549 RRM1 ribonucleotide reductase M1 1 2
MIRT046550 EP400 E1A binding protein p400 1 1
MIRT046551 ARPC1A actin related protein 2/3 complex, subunit 1A, 41kDa 1 1
MIRT046552 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha 1 1
MIRT046553 KDM5B lysine (K)-specific demethylase 5B 1 1
MIRT046554 DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase 1 1
MIRT053282 BMP4 bone morphogenetic protein 4 3 1
MIRT063200 ADIPOR2 adiponectin receptor 2 1 1
MIRT065692 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 2
MIRT066476 HMGA2 high mobility group AT-hook 2 1 2
MIRT067404 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT068158 TXLNA taxilin alpha 1 1
MIRT068533 NHLRC3 NHL repeat containing 3 1 3
MIRT068793 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT073009 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 3
MIRT073673 IGF1R insulin-like growth factor 1 receptor 1 4
MIRT076228 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT077619 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT080403 ONECUT2 one cut homeobox 2 1 1
MIRT083305 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT084980 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT094165 PCGF3 polycomb group ring finger 3 1 3
MIRT094465 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 2
MIRT095771 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT100097 ABT1 activator of basal transcription 1 1 4
MIRT112246 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 2
MIRT118590 STK4 serine/threonine kinase 4 1 1
MIRT120925 PDE12 phosphodiesterase 12 1 4
MIRT123322 CALU calumenin 1 1
MIRT123981 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT152282 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153857 NCOA3 nuclear receptor coactivator 3 1 1
MIRT168588 HMGA1 high mobility group AT-hook 1 1 2
MIRT180607 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT187722 SUOX sulfite oxidase 1 1
MIRT191408 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT193105 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT215725 C5ORF51 chromosome 5 open reading frame 51 1 5
MIRT218817 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT240334 UBXN2B UBX domain protein 2B 1 1
MIRT243477 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT244075 EDN1 endothelin 1 1 1
MIRT252335 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255319 CDV3 CDV3 homolog (mouse) 1 1
MIRT259281 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT259484 TXLNG taxilin gamma 1 1
MIRT260712 CLDN12 claudin 12 1 3
MIRT264696 C11ORF57 chromosome 11 open reading frame 57 1 2
MIRT266217 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT266630 CHTOP chromatin target of PRMT1 1 1
MIRT268843 C1ORF21 chromosome 1 open reading frame 21 1 1
MIRT284532 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT294450 ZNF264 zinc finger protein 264 1 1
MIRT297017 RRM2 ribonucleotide reductase M2 1 1
MIRT297446 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 2
MIRT300042 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT300897 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT303324 MXD1 MAX dimerization protein 1 1 1
MIRT309850 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT322432 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT324736 ACER2 alkaline ceramidase 2 1 1
MIRT402062 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT437345 IGF1 insulin-like growth factor 1 (somatomedin C) 2 1
MIRT437857 EIF2C1 eukaryotic translation initiation factor 2C, 1 3 1
MIRT438550 NEUROG1 neurogenin 1 3 1
MIRT438551 ASCL1 achaete-scute complex homolog 1 (Drosophila) 3 1
MIRT439133 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT442017 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT445655 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 3
MIRT447133 KIF27 kinesin family member 27 1 1
MIRT448255 ZNF774 zinc finger protein 774 1 1
MIRT449008 ANKRD46 ankyrin repeat domain 46 1 1
MIRT449950 FMNL3 formin-like 3 1 1
MIRT451152 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT451621 MEIS3P1 Meis homeobox 3 pseudogene 1 1 1
MIRT451690 C1RL complement component 1, r subcomponent-like 1 1
MIRT452089 NUCB2 nucleobindin 2 1 1
MIRT452428 QDPR quinoid dihydropteridine reductase 1 1
MIRT452940 DISC1 disrupted in schizophrenia 1 1 1
MIRT453398 RHD Rh blood group, D antigen 1 3
MIRT454161 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT454277 FXN frataxin 1 1
MIRT454536 RABL2A RAB, member of RAS oncogene family-like 2A 1 1
MIRT454851 ACOT9 acyl-CoA thioesterase 9 1 2
MIRT455673 GLO1 glyoxalase I 1 1
MIRT457245 RABL2B RAB, member of RAS oncogene family-like 2B 1 1
MIRT457674 ZNF587 zinc finger protein 587 1 1
MIRT457884 THEM6 thioesterase superfamily member 6 1 2
MIRT458013 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT458276 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT460450 NOM1 nucleolar protein with MIF4G domain 1 1 2
MIRT460497 FAM105A family with sequence similarity 105, member A 1 3
MIRT460935 NOA1 nitric oxide associated 1 1 2
MIRT461089 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT461166 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 2
MIRT461361 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT462379 YAE1D1 Yae1 domain containing 1 1 1
MIRT462777 ZNF8 zinc finger protein 8 1 1
MIRT463424 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463659 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT464262 VCL vinculin 1 1
MIRT465130 TSC22D2 TSC22 domain family, member 2 1 2
MIRT466189 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466724 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT469099 RNF144B ring finger protein 144B 1 1
MIRT469721 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT470416 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT470682 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 2
MIRT470864 PLXND1 plexin D1 1 1
MIRT471275 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT471961 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472675 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT472733 MTUS1 microtubule associated tumor suppressor 1 1 3
MIRT473136 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT473236 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT473825 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT473937 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT474021 LRRC20 leucine rich repeat containing 20 1 1
MIRT474496 KLHDC8B kelch domain containing 8B 1 1
MIRT474770 KIAA0930 KIAA0930 1 1
MIRT474911 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT475328 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT475376 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT475730 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 2
MIRT476545 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT476980 FAM83G family with sequence similarity 83, member G 1 2
MIRT477685 EFHD2 EF-hand domain family, member D2 1 1
MIRT479753 CCND1 cyclin D1 1 1
MIRT481198 ATXN7L3B ataxin 7-like 3B 1 2
MIRT481240 ATXN7L3 ataxin 7-like 3 1 1
MIRT481360 ATG9A autophagy related 9A 1 1
MIRT481385 ATG12 autophagy related 12 1 1
MIRT481649 AREL1 KIAA0317 1 1
MIRT481847 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT482181 AHR aryl hydrocarbon receptor 1 1
MIRT482217 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT485302 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT486656 ZNF28 zinc finger protein 28 1 1
MIRT489410 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT491860 ZBTB5 zinc finger and BTB domain containing 5 1 4
MIRT492628 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT493326 LIMD2 LIM domain containing 2 1 1
MIRT493898 FAM43A family with sequence similarity 43, member A 1 2
MIRT494260 CEP120 centrosomal protein 120kDa 1 1
MIRT494685 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT495965 TBC1D19 TBC1 domain family, member 19 1 1
MIRT496107 SNX17 sorting nexin 17 1 1
MIRT497872 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT498119 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 2
MIRT499402 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 2
MIRT499490 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT499650 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 1 1
MIRT499939 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT499994 HIST1H2BD histone cluster 1, H2bd 1 2
MIRT500820 THBS1 thrombospondin 1 1 1
MIRT500897 STRN striatin, calmodulin binding protein 1 2
MIRT501112 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 2
MIRT501180 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 3
MIRT501204 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT501245 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 3
MIRT501331 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT501354 RNF44 ring finger protein 44 1 2
MIRT501392 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 5
MIRT501439 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT501751 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT501944 MBD2 methyl-CpG binding domain protein 2 1 4
MIRT502108 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 4
MIRT502126 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 2
MIRT502788 CEP135 centrosomal protein 135kDa 1 1
MIRT502842 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT504786 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT505014 ZNF644 zinc finger protein 644 1 1
MIRT505583 SMC1A structural maintenance of chromosomes 1A 1 3
MIRT506364 NUP155 nucleoporin 155kDa 1 3
MIRT506938 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT507247 FIGN fidgetin 1 4
MIRT507692 COIL coilin 1 3
MIRT508398 C1orf210 chromosome 1 open reading frame 210 1 3
MIRT508662 DIABLO diablo, IAP-binding mitochondrial protein 1 2
MIRT508929 AK4 adenylate kinase 4 1 2
MIRT510397 ZNF566 zinc finger protein 566 1 3
MIRT510520 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT511383 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT512741 CD59 CD59 molecule, complement regulatory protein 1 2
MIRT515951 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT516080 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 2
MIRT521387 RDX radixin 1 2
MIRT522346 NCKIPSD NCK interacting protein with SH3 domain 1 2
MIRT523622 FZD9 frizzled family receptor 9 1 2
MIRT523730 FBXW2 F-box and WD repeat domain containing 2 1 2
MIRT523986 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT524116 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT525724 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT527760 RRAD Ras-related associated with diabetes 1 1
MIRT529724 OPRL1 opiate receptor-like 1 1 1
MIRT533181 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT536375 LEFTY1 left-right determination factor 1 1 1
MIRT543782 RBM12B RNA binding motif protein 12B 1 2
MIRT543865 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT545384 PM20D2 peptidase M20 domain containing 2 1 1
MIRT545893 ZNF200 zinc finger protein 200 1 2
MIRT546332 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547377 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT547575 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT547837 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 2
MIRT548262 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548345 EPHA4 EPH receptor A4 1 1
MIRT548529 DUSP1 dual specificity phosphatase 1 1 1
MIRT548557 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT548784 COLEC12 collectin sub-family member 12 1 1
MIRT548975 CCNT2 cyclin T2 1 1
MIRT549025 CBX5 chromobox homolog 5 1 1
MIRT549211 BEND4 BEN domain containing 4 1 2
MIRT549760 ZNF611 zinc finger protein 611 1 3
MIRT549796 KIAA0391 KIAA0391 1 1
MIRT549844 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT550724 PMPCA peptidase (mitochondrial processing) alpha 1 2
MIRT550895 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT551280 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 3
MIRT551315 GSG2 germ cell associated 2 (haspin) 1 3
MIRT551929 AKAP8 A kinase (PRKA) anchor protein 8 1 2
MIRT552000 RAD18 RAD18 homolog (S. cerevisiae) 1 1
MIRT552407 ZNF460 zinc finger protein 460 1 2
MIRT553011 USP38 ubiquitin specific peptidase 38 1 1
MIRT555542 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT555714 PDZD8 PDZ domain containing 8 1 1
MIRT557374 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT557964 FAM222B family with sequence similarity 222, member B 1 1
MIRT559082 C19orf47 chromosome 19 open reading frame 47 1 2
MIRT559494 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT561773 PEG10 paternally expressed 10 1 1
MIRT564399 EMILIN2 elastin microfibril interfacer 2 1 2
MIRT565449 SURF4 surfeit 4 1 1
MIRT566515 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT567434 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT567711 E2F6 E2F transcription factor 6 1 1
MIRT568650 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT569495 THYN1 thymocyte nuclear protein 1 1 1
MIRT573817 TGOLN2 trans-golgi network protein 2 1 1
MIRT574360 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT574752 GOLGA4 golgin A4 1 1
MIRT574786 FAM104A family with sequence similarity 104, member A 1 1
MIRT576083 Poteg POTE ankyrin domain family, member G 1 1
MIRT576814 Thbs1 thrombospondin 1 1 1
MIRT616367 RWDD1 RWD domain containing 1 1 1
MIRT617848 FMO4 flavin containing monooxygenase 4 1 1
MIRT642391 ZNF556 zinc finger protein 556 1 1
MIRT680516 PRIM2 primase, DNA, polypeptide 2 (58kDa) 1 1
MIRT680544 ZNF584 zinc finger protein 584 1 1
MIRT680797 ZNF578 zinc finger protein 578 1 1
MIRT680835 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT681138 INTS7 integrator complex subunit 7 1 1
MIRT681268 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT681320 ZFAND4 zinc finger, AN1-type domain 4 1 2
MIRT681356 BRI3BP BRI3 binding protein 1 1
MIRT681503 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT681533 ZNF738 zinc finger protein 738 1 1
MIRT681655 DTX3L deltex 3-like (Drosophila) 1 1
MIRT681735 RAB19 RAB19, member RAS oncogene family 1 2
MIRT681758 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT681794 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT681866 DNAH9 dynein, axonemal, heavy chain 9 1 1
MIRT681938 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682099 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 2
MIRT682178 SLC38A7 solute carrier family 38, member 7 1 1
MIRT682235 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT682381 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT682441 MTX3 metaxin 3 1 1
MIRT682601 CPA4 carboxypeptidase A4 1 1
MIRT682637 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT689324 FPR1 formyl peptide receptor 1 1 1
MIRT689727 ATXN2 ataxin 2 1 1
MIRT691033 ZNF799 zinc finger protein 799 1 1
MIRT691932 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT694881 ZNF417 zinc finger protein 417 1 1
MIRT695252 ZNF443 zinc finger protein 443 1 1
MIRT695410 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT700584 PRSS22 protease, serine, 22 1 1
MIRT701433 NHLRC2 NHL repeat containing 2 1 1
MIRT702481 KIAA1328 KIAA1328 1 1
MIRT702707 IPO9 importin 9 1 1
MIRT704034 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT704413 CTPS1 CTP synthase 1 1 1
MIRT705747 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT712364 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT713517 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*