Accession ID: MIRT006401 [miRNA, hsa-let-7i-5p :: IL13, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7iLinkOut: [miRBase ]
Synonyms LET7I, MIRNLET7I, hsa-let-7i, MIRLET7I
Description Homo sapiens let-7i stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7i-5p
Mature Sequence 6| UGAGGUAGUAGUUUGUGCUGUU |27
Evidence Experimental
Experiments Cloned
Putative hsa-let-7i-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL13 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ALRH, BHR1, IL-13, MGC116786, MGC116788, MGC116789, P600
Description interleukin 13
Transcript NM_0021    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL13 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL13
(miRNA target sites are highlighted)
>IL13|NM_0021|3'UTR
   1 TGAAACTTCGAAAGCATCATTATTTGCAGAGACAGGACCTGACTATTGAAGTTGCAGATTCATTTTTCTTTCTGATGTCA
  81 AAAATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTC
 161 TTCAGCCTAGCCGACCTCAGCCTTCCCCTTGCCCAGGGCTCAGCCTGGTGGGCCTCCTCTGTCCAGGGCCCTGAGCTCGG
 241 TGGACCCAGGGATGACATGTCCCTACACCCCTCCCCTGCCCTAGAGCACACTGTAGCATTACAGTGGGTGCCCCCCTTGC
 321 CAGACATGTGGTGGGACAGGGACCCACTTCACACACAGGCAACTGAGGCAGACAGCAGCTCAGGCACACTTCTTCTTGGT
 401 CTTATTTATTATTGTGTGTTATTTAAATGAGTGTGTTTGTCACCGTTGGGGATTGGGGAAGACTGTGGCTGCTAGCACTT
 481 GGAGCCAAGGGTTCAGAGACTCAGGGCCCCAGCACTAAAGCAGTGGACACCAGGAGTCCCTGGTAATAAGTACTGTGTAC
 561 AGAATTCTGCTACCTCACTGGGGTCCTGGGGCCTCGGAGCCTCATCCGAGGCAGGGTCAGGAGAGGGGCAGAACAGCCGC
 641 TCCTGTCTGCCAGCCAGCAGCCAGCTCTCAGCCAACGAGTAATTTATTGTTTTTCCTTGTATTTAAATATTAAATATGTT
 721 AGCAAAGAGTTAATATATAGAAGGGTACCTTGAACACTGGGGGAGGGGACATTGAACAAGTTGTTTCATTGACTATCAAA
 801 CTGAAGCCAGAAATAAAGTTGGTGACAGAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuguCGUGUUU---GAUGAUGGAGu 5'
              |:|||:|   ||:||||||| 
Target 5' ctgtGTACAGAATTCTGCTACCTCa 3'
553 - 577 166.00 -21.60
2
miRNA  3' uuGUCGUGUUUGAUGAUGGAGu 5'
            |||| | |:|  | ||||| 
Target 5' ttCAGC-CTAGC--CGACCTCa 3'
161 - 179 123.00 -14.00
3
miRNA  3' uuGUCGUGUUUG-AUGAUGGAGu 5'
            |||| ||::|  ||| |:|| 
Target 5' agCAGCTCAGGCACACTTCTTCt 3'
374 - 396 120.00 -15.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7i-5p :: IL13    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions A549
Location of target site 3'UTR
Tools used in this research miRanda , RNA22 , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Let-7 targets IL13 3 ' UTR ...

- Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al., 2011, The Journal of allergy and clinical immunology.

Article - Kumar, M. Ahmad, T. Sharma, A. Mabalirajan, et al.
- The Journal of allergy and clinical immunology, 2011
BACKGROUND: IL-13, a cytokine secreted by T(H)2 lymphocytes and other cells, critically modulates allergic inflammation and tissue remodeling in allergic asthma. Although much is known about transcriptional regulation of IL-13, posttranscriptional regulation is poorly understood. OBJECTIVE: Because many inflammatory pathways are known to be regulated by microRNAs, permitting a rapid and fine-tuned response, the role of microRNA-mediated regulation of IL-13 was investigated using both in vitro and in vivo studies. METHODS: A combination of in silico approaches and in vitro transfections in A549 cells and primary cultured T cells was used to demonstrate the involvement of let-7 in IL-13 regulation. Furthermore, intranasal delivery of let-7 microRNA mimic in mice was performed to study its effects in allergic airway inflammatory conditions. RESULTS: Using a combination of bioinformatics and molecular approaches, we demonstrate that the let-7 family of microRNAs regulates IL-13 expression. Induced levels of IL-13 in cultured T cells were inversely related to let-7 levels. In an IL-13-dependent murine model of allergic airway inflammation, we observed that inflammation was associated with a reduction in most of the members of the let-7 family. Exogenous administration of let-7 mimic to lungs of mice with allergic inflammation resulted in a decrease in IL-13 levels, resolution of airway inflammation, reduction in airway hyperresponsiveness, and attenuation of mucus metaplasia and subepithelial fibrosis. CONCLUSION: Let-7 microRNAs inhibit IL-13 expression and represent a major regulatory mechanism for modulating IL-13 secretion in IL-13-producing cell types and thereby T(H)2 inflammation.
LinkOut: [PMID: 21616524]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
20 hsa-let-7i-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003050 TLR4 toll-like receptor 4 4 1
MIRT006373 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT006401 IL13 interleukin 13 2 1
MIRT024110 FANCD2 Fanconi anemia, complementation group D2 1 1
MIRT024111 DAD1 defender against cell death 1 1 1
MIRT024112 BMP2K BMP2 inducible kinase 1 1
MIRT024113 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT024114 COPS8 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) 1 1
MIRT024115 COPS6 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) 1 1
MIRT024116 GPS1 G protein pathway suppressor 1 1 1
MIRT046545 LPHN2 latrophilin 2 1 1
MIRT046546 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT046547 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT046548 TNS3 tensin 3 1 1
MIRT046549 RRM1 ribonucleotide reductase M1 1 1
MIRT046550 EP400 E1A binding protein p400 1 1
MIRT046551 ARPC1A actin related protein 2/3 complex, subunit 1A, 41kDa 1 1
MIRT046552 PIK3C2A phosphoinositide-3-kinase, class 2, alpha polypeptide 1 1
MIRT046553 KDM5B lysine (K)-specific demethylase 5B 1 1
MIRT046554 DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase 1 1