Accession ID: MIRT006446 [miRNA, hsa-miR-449a :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-449aLinkOut: [miRBase ]
Description Homo sapiens miR-449a stem-loop
Comment Xie et al. refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MIR:MI0000025).
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-449a
Mature Sequence 16| UGGCAGUGUAUUGUUAGCUGGU |37
Evidence Experimental
Experiments Cloned
Putative hsa-miR-449a Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description Notch homolog 1, translocation-associated (Drosophila)
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 TAAACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCC
  81 GACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTAT
 161 GTACTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCT
 241 ATTCTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATAT
 321 AAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGA
 401 AGGGAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCA
 481 AGCCAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCT
 561 CACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTT
 641 AGATGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCAT
 721 GAATCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCC
 801 CCCTGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACA
 881 CGGAGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACA
 961 GTGTCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTC
1041 CCGTGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCC
1121 CGCAGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTT
1201 GGGAGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTT
1281 TGTTTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCC
1361 TTAGCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGG
1441 CCGCGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTG
1521 TAGTTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACT
1601 GATTTGCAATAAAAATGATACTGATGGTGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uggucGAU-UGU-UAUGUGACGGu 5'
               :|| ||| | |||||||| 
Target 5' ttattTTACACAGAAACACTGCCt 3'
167 - 190 157.00 -13.70
2
miRNA  3' uggucgauugUUAUGUGACGGu 5'
                    || |||||||| 
Target 5' tttctggggaAAGACACTGCCt 3'
898 - 919 152.00 -15.60
3
miRNA  3' ugGUCGAUUGUUAUGUGACGGu 5'
            | |  :||: | |:||||| 
Target 5' caCTGGGGACGCTCCGCTGCCg 3'
1374 - 1395 136.00 -18.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-449a :: NOTCH1    [ Functional MTI ]
Validation Method ChIP-seq , Luciferase reporter assay
Conditions KASUMI-1 , UCSD-AML1 , ME-1 , NB-4 , TF-1 , MOLM-13
Location of target site 3'UTR
Original Description (Extracted from the article) ... In conclusion, this study reveals MIR449A as a crucial direct target of the MECOM locus protein EVI1 involved in the pathogenesis of MECOM-rearranged leukaemias and unravels NOTCH1 and BCL2 as important novel targets of MIR449A. In this study, we show for the first time that BCL2 and NOTCH1 are direct MIR449A targets. ...

- De Weer, A. Van der Meulen, J. Rondou, P. et al., 2011, British Journal of Haematology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' uggucGAU-UGU-UAUGUGACGGu 5'
               :|| ||| | |||||||| 
Target 5' -uauuUUACACAGAAACACUGCCu 3'
1 - 23
Article - De Weer, A. Van der Meulen, J. Rondou, P. et al.
- British Journal of Haematology, 2011
Chromosomal rearrangements involving the MECOM (MDS1 and EVI1 complex) locus are recurrent genetic events in myeloid leukaemia and are associated with poor prognosis. In this study, we assessed the role of MECOM locus protein EVI1 in the transcriptional regulation of microRNAs (miRNAs) involved in the leukaemic phenotype. For this, we profiled expression of 366 miRNAs in 38 MECOM-rearranged patient samples, normal bone marrow controls and MECOM (EVI1) knock down/re-expression models. Cross-comparison of these miRNA expression profiling data showed that MECOM rearranged leukaemias are characterized by down regulation of MIR449A. Reconstitution of MIR449A expression in MECOM-rearranged cell line models induced apoptosis resulting in a strong decrease in cell viability. These effects might be mediated in part by MIR449A regulation of NOTCH1 and BCL2, which are shown here to be bona fide MIR449A targets. Finally, we confirmed that MIR449A repression is mediated through direct promoter occupation of the EVI1 transcriptional repressor. In conclusion, this study reveals MIR449A as a crucial direct target of the MECOM locus protein EVI1 involved in the pathogenesis of MECOM-rearranged leukaemias and unravels NOTCH1 and BCL2 as important novel targets of MIR449A. This EVI1-MIR449A-NOTCH1/BCL2 regulatory axis might open new possibilities for the development of therapeutic strategies in this poor prognostic leukaemia subgroup.
LinkOut: [PMID: 21569010]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
14 hsa-miR-449a Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003186 CDC25A cell division cycle 25 homolog A (S. pombe) 5 1
MIRT003187 CDK6 cyclin-dependent kinase 6 5 1
MIRT003760 HDAC1 histone deacetylase 1 4 3
MIRT003761 HDAC8 histone deacetylase 8 2 1
MIRT004679 CCND1 cyclin D1 2 1
MIRT006262 HNF4A hepatocyte nuclear factor 4, alpha 2 1
MIRT006345 GMNN geminin, DNA replication inhibitor 2 1
MIRT006346 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT006347 CCNE2 cyclin E2 2 1
MIRT006348 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 2 1
MIRT006445 BCL2 B-cell CLL/lymphoma 2 2 1
MIRT006446 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 2 1
MIRT006502 WISP2 WNT1 inducible signaling pathway protein 2 2 1
MIRT016631 CDK4 cyclin-dependent kinase 4 1 1