Accession ID: MIRT006446 [miRNA, hsa-miR-449a :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-449aLinkOut: [miRBase ]
Description Homo sapiens miR-449a stem-loop
Comment Xie et al. refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MIR:MI0000025).
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-449a
Mature Sequence 16| UGGCAGUGUAUUGUUAGCUGGU |37
Evidence Experimental
Experiments Cloned
Putative hsa-miR-449a Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_017617    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_017617|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uggucGAU-UGU-UAUGUGACGGu 5'
               :|| ||| | |||||||| 
Target 5' ttattTTACACAGAAACACTGCCt 3'
164 - 187 157.00 -13.70
2
miRNA  3' uggucgauugUUAUGUGACGGu 5'
                    || |||||||| 
Target 5' tttctggggaAAGACACTGCCt 3'
895 - 916 152.00 -15.60
3
miRNA  3' ugGUCGAUUGUUAUGUGACGGu 5'
            | |  :||: | |:||||| 
Target 5' caCTGGGGACGCTCCGCTGCCg 3'
1371 - 1392 136.00 -18.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-449a :: NOTCH1    [ Functional MTI ]
Validation Method ChIP-seq , Luciferase reporter assay
Conditions KASUMI-1 , UCSD-AML1 , ME-1 , NB-4 , TF-1 , MOLM-13
Location of target site 3'UTR
Original Description (Extracted from the article) ... In conclusion, this study reveals MIR449A as a crucial direct target of the MECOM locus protein EVI1 involved in the pathogenesis of MECOM-rearranged leukaemias and unravels NOTCH1 and BCL2 as important novel targets of MIR449A. In this study, we show for the first time that BCL2 and NOTCH1 are direct MIR449A targets. ...

- De Weer, A. Van der Meulen, J. Rondou, P. et al., 2011, British Journal of Haematology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' uggucGAU-UGU-UAUGUGACGGu 5'
               :|| ||| | |||||||| 
Target 5' -uauuUUACACAGAAACACUGCCu 3'
1 - 23
Article - De Weer, A. Van der Meulen, J. Rondou, P. et al.
- British Journal of Haematology, 2011
Chromosomal rearrangements involving the MECOM (MDS1 and EVI1 complex) locus are recurrent genetic events in myeloid leukaemia and are associated with poor prognosis. In this study, we assessed the role of MECOM locus protein EVI1 in the transcriptional regulation of microRNAs (miRNAs) involved in the leukaemic phenotype. For this, we profiled expression of 366 miRNAs in 38 MECOM-rearranged patient samples, normal bone marrow controls and MECOM (EVI1) knock down/re-expression models. Cross-comparison of these miRNA expression profiling data showed that MECOM rearranged leukaemias are characterized by down regulation of MIR449A. Reconstitution of MIR449A expression in MECOM-rearranged cell line models induced apoptosis resulting in a strong decrease in cell viability. These effects might be mediated in part by MIR449A regulation of NOTCH1 and BCL2, which are shown here to be bona fide MIR449A targets. Finally, we confirmed that MIR449A repression is mediated through direct promoter occupation of the EVI1 transcriptional repressor. In conclusion, this study reveals MIR449A as a crucial direct target of the MECOM locus protein EVI1 involved in the pathogenesis of MECOM-rearranged leukaemias and unravels NOTCH1 and BCL2 as important novel targets of MIR449A. This EVI1-MIR449A-NOTCH1/BCL2 regulatory axis might open new possibilities for the development of therapeutic strategies in this poor prognostic leukaemia subgroup.
LinkOut: [PMID: 21569010]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-449a :: NOTCH1    [ Functional MTI ]
Validation Method
miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' uggucGAU-UGU-UAUGUGACGGu 5'
               :|| ||| | |||||||| 
Target 5' -uauuUUACACAGAAACACUGCCu 3'
1 - 23
Article - Sarma, N. J. Tiriveedhi, V. Subramanian, V. et al.
- PLoS One, 2012
Liver disease due to hepatitis C virus (HCV) infection is an important health problem worldwide. HCV induced changes in microRNAs (miRNA) are shown to mediate inflammation leading to liver fibrosis. Gene expression analyses identified dysregulation of miRNA-449a in HCV patients but not in alcoholic and non-alcoholic liver diseases. By sequence analysis of the promoter for YKL40, an inflammatory marker upregulated in patients with chronic liver diseases with fibrosis, adjacent binding sites for nuclear factor of Kappa B/P65 and CCAAT/enhancer-binding protein alpha (CEBPalpha) were identified. P65 interacted with CEBPalpha to co-operatively activate YKL40 expression through sequence specific DNA binding. In vitro analysis demonstrated that tumor necrosis factor alpha (TNFalpha) mediated YKL40 expression is regulated by miRNA-449a and its target NOTCH1 in human hepatocytes.NOTCH1 facilitated nuclear localization of P65 in response to TNFalpha. Further, HCV patients demonstrated upregulation of NOTCH1 along with downregulation of miRNA-449a. Taken together it is demonstrated that miRNA-449a plays an important role in modulating expression of YKL40 through targeting the components of the NOTCH signaling pathway following HCV infection. Therefore, defining transcriptional regulatory mechanisms which control inflammatory responses and fibrosis will be important towards developing strategies to prevent hepatic fibrosis especially following HCV recurrence in liver transplant recipients.
LinkOut: [PMID: 23226395]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
117 hsa-miR-449a Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003186 CDC25A cell division cycle 25 homolog A (S. pombe) 5 2
MIRT003187 CDK6 cyclin-dependent kinase 6 6 4
MIRT003760 HDAC1 histone deacetylase 1 4 3
MIRT003761 HDAC8 histone deacetylase 8 2 1
MIRT004679 CCND1 cyclin D1 4 2
MIRT006262 HNF4A hepatocyte nuclear factor 4, alpha 2 2
MIRT006345 GMNN geminin, DNA replication inhibitor 2 1
MIRT006346 MET met proto-oncogene (hepatocyte growth factor receptor) 3 2
MIRT006347 CCNE2 cyclin E2 3 2
MIRT006348 SIRT1 sirtuin 1 2 1
MIRT006445 BCL2 B-cell CLL/lymphoma 2 4 4
MIRT006446 NOTCH1 notch 1 4 2
MIRT006502 WISP2 WNT1 inducible signaling pathway protein 2 2 1
MIRT016631 CDK4 cyclin-dependent kinase 4 1 1
MIRT053005 LEF1 lymphoid enhancer-binding factor 1 3 1
MIRT053065 E2F3 E2F transcription factor 3 4 3
MIRT057738 ZDHHC16 zinc finger, DHHC-type containing 16 1 1
MIRT078633 FAM104A family with sequence similarity 104, member A 1 1
MIRT100406 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT105101 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT115549 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT130106 TXNIP thioredoxin interacting protein 1 2
MIRT142248 DCTN5 dynactin 5 (p25) 1 1
MIRT143719 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT169801 GIGYF1 GRB10 interacting GYF protein 1 1 2
MIRT183693 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT198921 SMAD4 SMAD family member 4 1 1
MIRT202949 TSN translin 1 2
MIRT221562 CBX3 chromobox homolog 3 1 1
MIRT253415 EVI5L ecotropic viral integration site 5-like 1 1
MIRT294758 ZNF551 zinc finger protein 551 1 2
MIRT307052 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 1
MIRT331271 TM9SF3 transmembrane 9 superfamily member 3 1 3
MIRT372292 UBXN2B UBX domain protein 2B 1 1
MIRT374315 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT438777 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 2 1
MIRT438778 MAP2K1 mitogen-activated protein kinase kinase 1 2 1
MIRT445818 DNAAF3 dynein, axonemal, assembly factor 3 1 1
MIRT447159 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT447824 CTIF CBP80/20-dependent translation initiation factor 1 1
MIRT448797 GMFB glia maturation factor, beta 1 1
MIRT451581 HIRIP3 HIRA interacting protein 3 1 1
MIRT452680 GPR156 G protein-coupled receptor 156 1 1
MIRT453159 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT453635 SLC4A2 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) 1 1
MIRT455385 PLA2G2D phospholipase A2, group IID 1 1
MIRT456959 SPAM1 sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) 1 1
MIRT462740 EFNB1 ephrin-B1 1 1
MIRT464322 UST uronyl-2-sulfotransferase 1 1
MIRT465640 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 1 5
MIRT466749 SYNGR2 synaptogyrin 2 1 1
MIRT468346 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT469325 RGP1 RGP1 retrograde golgi transport homolog (S. cerevisiae) 1 1
MIRT474359 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT475317 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT477760 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT477825 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478266 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT481039 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT481290 ATXN1L ataxin 1-like 1 1
MIRT482731 COPZ1 coatomer protein complex, subunit zeta 1 1 1
MIRT488779 CYTH3 cytohesin 3 1 1
MIRT489579 SSBP2 single-stranded DNA binding protein 2 1 1
MIRT489660 SHMT1 serine hydroxymethyltransferase 1 (soluble) 1 2
MIRT490528 KIAA1715 KIAA1715 1 1
MIRT492946 NEUROD2 neuronal differentiation 2 1 1
MIRT493155 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT493846 FOXN3 forkhead box N3 1 2
MIRT494744 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT496492 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT503313 FICD FIC domain containing 1 2
MIRT503508 ZNF623 zinc finger protein 623 1 1
MIRT504183 FAM127B family with sequence similarity 127, member B 1 1
MIRT505011 ZNF644 zinc finger protein 644 1 1
MIRT505353 TMEM167A transmembrane protein 167A 1 1
MIRT505646 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT505711 SESN2 sestrin 2 1 1
MIRT505779 SATB2 SATB homeobox 2 1 3
MIRT506210 PHF19 PHD finger protein 19 1 1
MIRT506252 PEG10 paternally expressed 10 1 1
MIRT507787 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT508004 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 2
MIRT508858 ZRSR1 zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1 1 2
MIRT510547 XBP1P1 X-box binding protein 1 pseudogene 1 1 2
MIRT511894 GAS1 growth arrest-specific 1 1 3
MIRT512908 UBL4A ubiquitin-like 4A 1 1
MIRT513601 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT521242 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT521320 RRAGD Ras-related GTP binding D 1 2
MIRT525282 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT528651 RWDD2A RWD domain containing 2A 1 2
MIRT535099 PODXL podocalyxin-like 1 1
MIRT547753 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 2
MIRT547866 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT549172 BMP3 bone morphogenetic protein 3 1 1
MIRT550116 SLC35G2 solute carrier family 35, member G2 1 1
MIRT556098 MOAP1 modulator of apoptosis 1 1 1
MIRT557171 HOXA13 homeobox A13 1 1
MIRT557423 GXYLT2 glucoside xylosyltransferase 2 1 1
MIRT557932 FAM73A family with sequence similarity 73, member A 1 1
MIRT568805 VPS37D vacuolar protein sorting 37 homolog D (S. cerevisiae) 1 1
MIRT571327 TPCN2 two pore segment channel 2 1 1
MIRT572599 PAPLN papilin, proteoglycan-like sulfated glycoprotein 1 1
MIRT573438 APOPT1 apoptogenic 1, mitochondrial 1 1
MIRT574091 VASN vasorin 1 1
MIRT608689 VAV3 vav 3 guanine nucleotide exchange factor 1 2
MIRT608801 ITGA11 integrin, alpha 11 1 2
MIRT610333 SSX5 synovial sarcoma, X breakpoint 5 1 1
MIRT613159 DDA1 DET1 and DDB1 associated 1 1 1
MIRT625408 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT636604 CLIC5 chloride intracellular channel 5 1 1
MIRT638574 IER5 immediate early response 5 1 1
MIRT639687 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT677980 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT685218 POTED POTE ankyrin domain family, member D 1 1
MIRT702571 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT706260 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*