Accession ID: MIRT006450 [miRNA, hsa-miR-126-3p :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-126LinkOut: [miRBase ]
Description Homo sapiens miR-126 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-126-3p
Mature Sequence 52| UCGUACCGUGAGUAAUAAUGCG |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-126-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RASK2
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_0333    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRAS
(miRNA target sites are highlighted)
>KRAS|NM_0333|3'UTR
   1 TCTGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAA
  81 AGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAAATACAATTTGTACTTTTTTCTTAAGGCATACTAGTACAA
 161 GTGGTAATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAGCATTACCTAATTTTTTTCCTGCTCCATGCAGACT
 241 GTTAGCTTTTACCTTAAATGCTTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCCCAGAGTT
 321 TTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATACCTAAGATTTCTGTCTTGGGGTTTTTGGTGCATGCAG
 401 TTGATTACTTCTTATTTTTCTTACCAATTGTGAATGTTGGTGTGAAACAAATTAATGAAGCTTTTGAATCATCCCTATTC
 481 TGTGTTTTATCTAGTCACATAAATGGATTAATTACTAATTTCAGTTGAGACCTTCTAATTGGTTTTTACTGAAACATTGA
 561 GGGAACACAAATTTATGGGCTTCCTGATGATGATTCTTCTAGGCATCATGTCCTATAGTTTGTCATCCCTGATGAATGTA
 641 AAGTTACACTGTTCACAAAGGTTTTGTCTCCTTTCCACTGCTATTAGTCATGGTCACTCTCCCCAAAATATTATATTTTT
 721 TCTATAAAAAGAAAAAAATGGAAAAAAATTACAAGGCAATGGAAACTATTATAAGGCCATTTCCTTTTCACATTAGATAA
 801 ATTACTATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTATTATAGCAACCATTTTG
 881 GGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGATTTTAACAAGTATAAAAAATTCTCATAGGAATTAA
 961 ATGTAGTCTCCCTGTGTCAGACTGCTCTTTCATAGTATAACTTTAAATCTTTTCTTCAACTTGAGTCTTTGAAGATAGTT
1041 TTAATTCTGCTTGTGACATTAAAAGATTATTTGGGCCAGTTATAGCTTATTAGGTGTTGAAGAGACCAAGGTTGCAAGGC
1121 CAGGCCCTGTGTGAACCTTTGAGCTTTCATAGAGAGTTTCACAGCATGGACTGTGTCCCCACGGTCATCCAGTGTTGTCA
1201 TGCATTGGTTAGTCAAAATGGGGAGGGACTAGGGCAGTTTGGATAGCTCAACAAGATACAATCTCACTCTGTGGTGGTCC
1281 TGCTGACAAATCAAGAGCATTGCTTTTGTTTCTTAAGAAAACAAACTCTTTTTTAAAAATTACTTTTAAATATTAACTCA
1361 AAAGTTGAGATTTTGGGGTGGTGGTGTGCCAAGACATTAATTTTTTTTTTAAACAATGAAGTGAAAAAGTTTTACAATCT
1441 CTAGGTTTGGCTAGTTCTCTTAACACTGGTTAAATTAACATTGCATAAACACTTTTCAAGTCTGATCCATATTTAATAAT
1521 GCTTTAAAATAAAAATAAAAACAATCCTTTTGATAAATTTAAAATGTTACTTATTTTAAAATAAATGAAGTGAGATGGCA
1601 TGGTGAGGTGAAAGTATCACTGGACTAGGAAGAAGGTGACTTAGGTTCTAGATAGGTGTCTTTTAGGACTCTGATTTTGA
1681 GGACATCACTTACTATCCATTTCTTCATGTTAAAAGAAGTCATCTCAAACTCTTAGTTTTTTTTTTTTACAACTATGTAA
1761 TTTATATTCCATTTACATAAGGATACACTTATTTGTCAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACACCAT
1841 CTTCAGTGCCAGTCTTGGGCAAAATTGTGCAAGAGGTGAAGTTTATATTTGAATATCCATTCTCGTTTTAGGACTCTTCT
1921 TCCATATTAGTGTCATCTTGCCTCCCTACCTTCCACATGCCCCATGACTTGATGCAGTTTTAATACTTGTAATTCCCCTA
2001 ACCATAAGATTTACTGCTGCTGTGGATATCTCCATGAAGTTTTCCCACTGAGTCACATCAGAAATGCCCTACATCTTATT
2081 TCCTCAGGGCTCAAGAGAATCTGACAGATACCATAAAGGGATTTGACCTAATCACTAATTTTCAGGTGGTGGCTGATGCT
2161 TTGAACATCTCTTTGCTGCCCAATCCATTAGCGACAGTAGGATTTTTCAAACCTGGTATGAATAGACAGAACCCTATCCA
2241 GTGGAAGGAGAATTTAATAAAGATAGTGCTGAAAGAATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACAGTA
2321 ATACATTCCATTGTTTTAGTAACCAGAAATCTTCATGCAATGAAAAATACTTTAATTCATGAAGCTTACTTTTTTTTTTT
2401 GGTGTCAGAGTCTCGCTCTTGTCACCCAGGCTGGAATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCCAGG
2481 TTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTGTAT
2561 TTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATTCACCCACCTTGGCC
2641 TCATAAACCTGTTTTGCAGAACTCATTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAAGGC
2721 ACTGGGTATATGGTATCCCCAAACAAGAGACATAATCCCGGTCCTTAGGTAGTGCTAGTGTGGTCTGTAATATCTTACTA
2801 AGGCCTTTGGTATACGACCCAGAGATAACACGATGCGTATTTTAGTTTTGCAAAGAAGGGGTTTGGTCTCTGTGCCAGCT
2881 CTATAATTGTTTTGCTACGATTCCACTGAAACTCTTCGATCAAGCTACTTTATGTAAATCACTTCATTGTTTTAAAGGAA
2961 TAAACTTGATTATATTGTTTTTTTATTTGGCATAACTGTGATTCTTTTAGGACAATTACTGTACACATTAAGGTGTATGT
3041 CAGATATTCATATTGACCCAAATGTGTAATATTCCAGTTTTCTCTGCATAAGTAATTAAAATATACTTAAAAATTAATAG
3121 TTTTATCTGGGTACAAATAAACAGGTGCCTGAACTAGTTCACAGACAAGGAAACTTCTATGTAAAAATCACTATGATTTC
3201 TGAATTGCTATGTGAAACTACAGATCTTTGGAACACTGTTTAGGTAGGGTGTTAAGACTTACACAGTACCTCGTTTCTAC
3281 ACAGAGAAAGAAATGGCCATACTTCAGGAACTGCAGTGCTTATGAGGGGATATTTAGGCCTCTTGAATTTTTGATGTAGA
3361 TGGGCATTTTTTTAAGGTAGTGGTTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGTAGAGA
3441 TTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAAGACAAAAATCCTTGTTGAAGTTTTT
3521 TTAAAAAAAGCTAAATTACATAGACTTAGGCATTAACATGTTTGTGGAAGAATATAGCAGACGTATATTGTATCATTTGA
3601 GTGAATGTTCCCAAGTAGGCATTCTAGGCTCTATTTAACTGAGTCACACTGCATAGGAATTTAGAACCTAACTTTTATAG
3681 GTTATCAAAACTGTTGTCACCATTGCACAATTTTGTCCTAATATATACATAGAAACTTTGTGGGGCATGTTAAGTTACAG
3761 TTTGCACAAGTTCATCTCATTTGTATTCCATTGATTTTTTTTTTCTTCTAAACATTTTTTCTTCAAACAGTATATAACTT
3841 TTTTTAGGGGATTTTTTTTTAGACAGCAAAAACTATCTGAAGATTTCCATTTGTCAAAAAGTAATGATTTCTTGATAATT
3921 GTGTAGTAATGTTTTTTAGAACCCAGCAGTTACCTTAAAGCTGAATTTATATTTAGTAACTTCTGTGTTAATACTGGATA
4001 GCATGAATTCTGCATTGAGAAACTGAATAGCTGTCATAAAATGAAACTTTCTTTCTAAAGAAAGATACTCACATGAGTTC
4081 TTGAAGAATAGTCATAACTAGATTAAGATCTGTGTTTTAGTTTAATAGTTTGAAGTGCCTGTTTGGGATAATGATAGGTA
4161 ATTTAGATGAATTTAGGGGAAAAAAAAGTTATCTGCAGATATGTTGAGGGCCCATCTCTCCCCCCACACCCCCACAGAGC
4241 TAACTGGGTTACAGTGTTTTATCCGAAAGTTTCCAATTCCACTGTCTTGTGTTTTCATGTTGAAAATACTTTTGCATTTT
4321 TCCTTTGAGTGCCAATTTCTTACTAGTACTATTTCTTAATGTAACATGTTTACCTGGAATGTATTTTAACTATTTTTGTA
4401 TAGTGTAAACTGAAACATGCACATTTTGTACATTGTGCTTTCTTTTGTGGGACATATGCAGTGTGATCCAGTTGTTTTCC
4481 ATCATTTGGTTGCGCTGACCTAGGAATGTTGGTCATATCAAACATTAAAAATGACCACTCTTTTAATTGAAATTAACTTT
4561 TAAATGTTTATAGGAGTATGTGCTGTGAAGTGATCTAAAATTTGTAATATTTTTGTCATGAACTGTACTACTCCTAATTA
4641 TTGTAATGTAATAAAAATAGTTACAGTGAC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gcgUAAUAA-UGAGUGCCAUGCu 5'
             ||| || |  | :||||:| 
Target 5' aggATTTTTCAAACCTGGTATGa 3'
2199 - 2221 123.00 -11.60
2
miRNA  3' gcGUAAUAAUGAGUGCCAUGCu 5'
            :|| |||::|: :| |||| 
Target 5' tcTATAATTGTTT-TGCTACGa 3'
2880 - 2900 115.00 -7.80
3
miRNA  3' gcGUAAUAAUGA--GUGCCAUGcu 5'
            ::|||  |||  ||| ||||  
Target 5' ggTGTTAAGACTTACACAGTACct 3'
3248 - 3271 114.00 -8.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-126-3p :: KRAS    [ Functional MTI ]
Validation Method Immunohistochemistry , Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions PANC-1 , MIA PaCa-2
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-126 is able to directly target KRAS//re-expression has the potential as a therapeutic strategy against PDAC and other KRAS-driven cancers. KRAS was identified as a direct target of miR-126. //miR-126 is able to directly target KRAS; re-expression has the potential as a therapeutic strategy against PDAC and other KRAS-driven cancers. ...

- Jiao, L. R. Frampton, A. E. Jacob, J. et al., 2012, PLoS One.

Article - Jiao, L. R. Frampton, A. E. Jacob, J. et al.
- PLoS One, 2012
BACKGROUND: MicroRNA (miRNA) expression profiles have been described in pancreatic ductal adenocarcinoma (PDAC), but these have not been compared with pre-malignant pancreatic tumors. We wished to compare the miRNA expression signatures in pancreatic benign cystic tumors (BCT) of low and high malignant potential with PDAC, in order to identify miRNAs deregulated during PDAC development. The mechanistic consequences of miRNA dysregulation were further evaluated. METHODS: Tissue samples were obtained at a tertiary pancreatic unit from individuals with BCT and PDAC. MiRNA profiling was performed using a custom microarray and results were validated using RT-qPCR prior to evaluation of miRNA targets. RESULTS: Widespread miRNA down-regulation was observed in PDAC compared to low malignant potential BCT. We show that amongst those miRNAs down-regulated, miR-16, miR-126 and let-7d regulate known PDAC oncogenes (targeting BCL2, CRK and KRAS respectively). Notably, miR-126 also directly targets the KRAS transcript at a "seedless" binding site within its 3'UTR. In clinical specimens, miR-126 was strongly down-regulated in PDAC tissues, with an associated elevation in KRAS and CRK proteins. Furthermore, miR-21, a known oncogenic miRNA in pancreatic and other cancers, was not elevated in PDAC compared to serous microcystic adenoma (SMCA), but in both groups it was up-regulated compared to normal pancreas, implicating early up-regulation during malignant change. CONCLUSIONS: Expression profiling revealed 21 miRNAs down-regulated in PDAC compared to SMCA, the most benign lesion that rarely progresses to invasive carcinoma. It appears that miR-21 up-regulation is an early event in the transformation from normal pancreatic tissue. MiRNA expression has the potential to distinguish PDAC from normal pancreas and BCT. Mechanistically the down-regulation of miR-16, miR-126 and let-7d promotes PDAC transformation by post-transcriptional up-regulation of crucial PDAC oncogenes. We show that miR-126 is able to directly target KRAS; re-expression has the potential as a therapeutic strategy against PDAC and other KRAS-driven cancers.
LinkOut: [PMID: 22384141]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
32 hsa-miR-126-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000343 SPRED1 sprouty-related, EVH1 domain containing 1 4 5
MIRT000344 PLK2 polo-like kinase 2 3 2
MIRT000798 SLC45A3 solute carrier family 45, member 3 3 1
MIRT000965 CCNE2 cyclin E2 2 1
MIRT000966 RGS3 regulator of G-protein signaling 3 2 2
MIRT000967 TOM1 target of myb1 (chicken) 4 2
MIRT001918 HOXA9 homeobox A9 4 1
MIRT002993 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 5 6
MIRT003428 VEGFA vascular endothelial growth factor A 4 4
MIRT003894 PIK3R2 phosphoinositide-3-kinase, regulatory subunit 2 (beta) 4 4
MIRT004081 VCAM1 vascular cell adhesion molecule 1 3 1
MIRT004355 IRS1 insulin receptor substrate 1 4 3
MIRT005020 E2F1 E2F transcription factor 1 2 1
MIRT005370 SOX2 SRY (sex determining region Y)-box 2 5 1
MIRT005538 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 5 1
MIRT005540 TWF2 twinfilin, actin-binding protein, homolog 2 (Drosophila) 4 1
MIRT005727 PTPN7 protein tyrosine phosphatase, non-receptor type 7 3 1
MIRT005729 DNMT1 DNA (cytosine-5-)-methyltransferase 1 4 2
MIRT006450 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 4 1
MIRT006543 IGFBP2 insulin-like growth factor binding protein 2, 36kDa 4 1
MIRT006544 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 4 1
MIRT006545 MERTK c-mer proto-oncogene tyrosine kinase 4 1
MIRT006558 EGFL7 EGF-like-domain, multiple 7 4 2
MIRT006679 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 3 1
MIRT006831 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma 3 1
MIRT006883 TEK TEK tyrosine kinase, endothelial 3 1
MIRT007266 ADAM9 ADAM metallopeptidase domain 9 1 1
MIRT007269 MMP7 matrix metallopeptidase 7 (matrilysin, uterine) 1 1
MIRT007381 CXCL12 chemokine (C-X-C motif) ligand 12 1 1
MIRT021281 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT021282 PGR progesterone receptor 2 1
MIRT045695 RBMX RNA binding motif protein, X-linked 1 1