Accession ID: MIRT006458 [miRNA, hsa-miR-34b-3p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34bLinkOut: [miRBase ]
Description Homo sapiens miR-34b stem-loop
Comment Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells . Both arms express mature products in mouse.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34b-3p
Mature Sequence 50| CAAUCACUAACUCCACUGCCAU |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-34b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_017617    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_017617|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uaccgucacCUCAA----UCACUAac 5'
                   || ||    ||||||  
Target 5' acagaaaaaGACTTTAAAAGTGATct 3'
1524 - 1549 123.00 -5.30
2
miRNA  3' uacCGUCAC-CUCAAUC-ACUAAc 5'
             ||  || |  |||| ||:|| 
Target 5' gttGCCATGTGTTTTAGATGGTTt 3'
623 - 646 107.00 -6.40
3
miRNA  3' uaCCGUCACCUCA----A---UCACUaac 5'
            | | || | ||    |   |||||   
Target 5' gaGTCTGTTGTGTGTCATGCCAGTGAggg 3'
1300 - 1328 102.00 -9.43
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34b-3p :: NOTCH1    [ Functional MTI ]
Validation Method Other
Article - Ji, Q. Hao, X. Meng, Y. Zhang, M. Desano, et al.
- BMC Cancer, 2008
BACKGROUND: MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. METHODS: Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. RESULTS: Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. CONCLUSION: Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be correlated to the self-renewal of cancer stem cells. The mechanism of miR-34-mediated suppression of self-renewal appears to be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, indicating that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. Our study suggests that restoration of the tumor suppressor miR-34 may provide a novel molecular therapy for p53-mutant gastric cancer.
LinkOut: [PMID: 18803879]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34b-3p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... miRNA-34b and miRNA-34c are up-regulated and directly target Notch1 during BMP2-induced C2C12 osteoblast differentiation ...

- Bae, Y. Yang, T. Zeng, H. C. Campeau, P. M. et al., 2012, Hum Mol Genet.

Article - Bae, Y. Yang, T. Zeng, H. C. Campeau, P. M. et al.
- Hum Mol Genet, 2012
During bone homeostasis, osteoblast and osteoclast differentiation is coupled and regulated by multiple signaling pathways and their downstream transcription factors. Here, we show that microRNA 34 (miR-34) is significantly induced by BMP2 during osteoblast differentiation. In vivo, osteoblast-specific gain of miR-34c in mice leads to an age-dependent osteoporosis due to the defective mineralization and proliferation of osteoblasts and increased osteoclastogenesis. In osteoblasts, miR-34c targets multiple components of the Notch signaling pathway, including Notch1, Notch2 and Jag1 in a direct manner, and influences osteoclast differentiation in a non-cell-autonomous fashion. Taken together, our results demonstrate that miR-34c is critical during osteoblastogenesis in part by regulating Notch signaling in bone homeostasis. Furthermore, miR-34c-mediated post-transcriptional regulation of Notch signaling in osteoblasts is one possible mechanism to modulate the proliferative effect of Notch in the committed osteoblast progenitors which may be important in the pathogenesis of osteosarcomas. Therefore, understanding the functional interaction of miR-34 and Notch signaling in normal bone development and in bone cancer could potentially lead to therapies modulating miR-34 signaling.
LinkOut: [PMID: 22498974]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34b-3p :: NOTCH1    [ Functional MTI ]
Validation Method
Article - Cama, A. Verginelli, F. Lotti, L. V. et al.
- Acta Neuropathol, 2013
Head and neck paragangliomas, rare neoplasms of the paraganglia composed of nests of neurosecretory and glial cells embedded in vascular stroma, provide a remarkable example of organoid tumor architecture. To identify genes and pathways commonly deregulated in head and neck paraganglioma, we integrated high-density genome-wide copy number variation (CNV) analysis with microRNA and immunomorphological studies. Gene-centric CNV analysis of 24 cases identified a list of 104 genes most significantly targeted by tumor-associated alterations. The "NOTCH signaling pathway" was the most significantly enriched term in the list (P = 0.002 after Bonferroni or Benjamini correction). Expression of the relevant NOTCH pathway proteins in sustentacular (glial), chief (neuroendocrine) and endothelial cells was confirmed by immunohistochemistry in 47 head and neck paraganglioma cases. There were no relationships between level and pattern of NOTCH1/JAG2 protein expression and germline mutation status in the SDH genes, implicated in paraganglioma predisposition, or the presence/absence of immunostaining for SDHB, a surrogate marker of SDH mutations. Interestingly, NOTCH upregulation was observed also in cases with no evidence of CNVs at NOTCH signaling genes, suggesting altered epigenetic modulation of this pathway. To address this issue we performed microarray-based microRNA expression analyses. Notably 5 microRNAs (miR-200a,b,c and miR-34b,c), including those most downregulated in the tumors, correlated to NOTCH signaling and directly targeted NOTCH1 in in vitro experiments using SH-SY5Y neuroblastoma cells. Furthermore, lentiviral transduction of miR-200s and miR-34s in patient-derived primary tympano-jugular paraganglioma cell cultures was associated with NOTCH1 downregulation and increased levels of markers of cell toxicity and cell death. Taken together, our results provide an integrated view of common molecular alterations associated with head and neck paraganglioma and reveal an essential role of NOTCH pathway deregulation in this tumor type.
LinkOut: [PMID: 23955600]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
148 hsa-miR-34b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003449 BCL2 B-cell CLL/lymphoma 2 3 4
MIRT003450 CDK4 cyclin-dependent kinase 4 4 2
MIRT003579 CDK6 cyclin-dependent kinase 6 3 4
MIRT004519 VEGFA vascular endothelial growth factor A 2 1
MIRT004825 MET met proto-oncogene (hepatocyte growth factor receptor) 5 2
MIRT005319 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 5 4
MIRT005761 ZAP70 zeta-chain (TCR) associated protein kinase 70kDa 1 1
MIRT006224 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 1
MIRT006226 SOX2 SRY (sex determining region Y)-box 2 2 1
MIRT006229 NANOG Nanog homeobox 2 1
MIRT006290 CCND1 cyclin D1 3 1
MIRT006291 JAG1 jagged 1 3 1
MIRT006458 NOTCH1 notch 1 5 3
MIRT020342 CREB1 cAMP responsive element binding protein 1 4 2
MIRT035573 NOTCH2 notch 2 1 1
MIRT035574 HMGA2 high mobility group AT-hook 2 1 1
MIRT035575 NOTCH4 notch 4 1 1
MIRT038536 ENOSF1 enolase superfamily member 1 1 1
MIRT052947 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT054032 YY1 YY1 transcription factor 4 4
MIRT256436 SAR1B SAR1 homolog B (S. cerevisiae) 1 1
MIRT375371 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT438416 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 3 1
MIRT438637 TBXAS1 thromboxane A synthase 1 (platelet) 1 1
MIRT438703 IL6R interleukin 6 receptor 3 1
MIRT438775 MAP2K1 mitogen-activated protein kinase kinase 1 2 1
MIRT438776 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 2 1
MIRT451105 ZNF584 zinc finger protein 584 1 1
MIRT454196 AP1S3 adaptor-related protein complex 1, sigma 3 subunit 1 2
MIRT455496 RBM12 RNA binding motif protein 12 1 1
MIRT456484 SERAC1 serine active site containing 1 1 1
MIRT461053 DCPS decapping enzyme, scavenger 1 1
MIRT462192 ACADL acyl-CoA dehydrogenase, long chain 1 1
MIRT462929 ZNRF3 zinc and ring finger 3 1 1
MIRT463366 ZFAND4 zinc finger, AN1-type domain 4 1 1
MIRT463587 ZBTB38 zinc finger and BTB domain containing 38 1 1
MIRT463979 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT466179 TMED5 transmembrane emp24 protein transport domain containing 5 1 3
MIRT471760 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 4
MIRT471779 NUP43 nucleoporin 43kDa 1 1
MIRT479359 CEP97 centrosomal protein 97kDa 1 1
MIRT482764 TMEM126B transmembrane protein 126B 1 1
MIRT499538 ZNF606 zinc finger protein 606 1 1
MIRT508108 AMER1 family with sequence similarity 123B 1 6
MIRT515063 EBNA1BP2 EBNA1 binding protein 2 1 1
MIRT515801 COL4A3BP collagen, type IV, alpha 3 (Goodpasture antigen) binding protein 1 1
MIRT518106 ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide 1 3
MIRT525383 SYNM synemin, intermediate filament protein 1 1
MIRT528460 NXT2 nuclear transport factor 2-like export factor 2 1 2
MIRT528900 MARC1 mitochondrial amidoxime reducing component 1 1 1
MIRT529584 IGBP1 immunoglobulin (CD79A) binding protein 1 1 2
MIRT529916 C1orf64 chromosome 1 open reading frame 64 1 2
MIRT534525 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT535908 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT540312 GFPT1 glutamine--fructose-6-phosphate transaminase 1 1 1
MIRT548553 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT553974 SRSF10 serine/arginine-rich splicing factor 10 1 1
MIRT560042 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT560573 ZNF460 zinc finger protein 460 1 1
MIRT560613 TRIM38 tripartite motif containing 38 1 1
MIRT566393 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT570643 KIAA1549L KIAA1549-like 1 2
MIRT615241 BROX BRO1 domain and CAAX motif containing 1 1
MIRT619106 IFI44L interferon-induced protein 44-like 1 1
MIRT623508 KCNK5 potassium channel, subfamily K, member 5 1 1
MIRT625099 TMEM30B transmembrane protein 30B 1 2
MIRT625503 SMAD9 SMAD family member 9 1 1
MIRT640428 COG6 component of oligomeric golgi complex 6 1 1
MIRT641385 GUF1 GUF1 GTPase homolog (S. cerevisiae) 1 1
MIRT642238 RABAC1 Rab acceptor 1 (prenylated) 1 1
MIRT647333 RPH3AL rabphilin 3A-like (without C2 domains) 1 1
MIRT647892 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 1 1
MIRT647952 F2 coagulation factor II (thrombin) 1 1
MIRT648137 JAGN1 jagunal homolog 1 (Drosophila) 1 1
MIRT649864 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT650539 CCDC77 coiled-coil domain containing 77 1 1
MIRT650983 ZNF831 zinc finger protein 831 1 1
MIRT653109 SRSF1 serine/arginine-rich splicing factor 1 1 1
MIRT654073 RWDD1 RWD domain containing 1 1 1
MIRT655288 PELI2 pellino E3 ubiquitin protein ligase family member 2 1 1
MIRT656466 MAPK14 mitogen-activated protein kinase 14 1 1
MIRT660480 ARSK arylsulfatase family, member K 1 1
MIRT661148 ZNF43 zinc finger protein 43 1 1
MIRT661555 ZNF674 zinc finger protein 674 1 2
MIRT661867 ZNF766 zinc finger protein 766 1 1
MIRT662145 ZC3H8 zinc finger CCCH-type containing 8 1 1
MIRT662328 PAQR5 progestin and adipoQ receptor family member V 1 1
MIRT662895 PCDHA6 protocadherin alpha 6 1 1
MIRT663250 MPHOSPH8 M-phase phosphoprotein 8 1 2
MIRT663278 SIGLEC14 sialic acid binding Ig-like lectin 14 1 1
MIRT663718 ABHD17B family with sequence similarity 108, member B1 1 1
MIRT664949 CARD6 caspase recruitment domain family, member 6 1 2
MIRT665653 TRPM7 transient receptor potential cation channel, subfamily M, member 7 1 1
MIRT665945 TBC1D19 TBC1 domain family, member 19 1 2
MIRT666205 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT667834 IRGQ immunity-related GTPase family, Q 1 1
MIRT667868 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT669017 CHORDC1 cysteine and histidine-rich domain (CHORD) containing 1 1 1
MIRT669108 CDK19 cyclin-dependent kinase 19 1 1
MIRT671727 XIAP X-linked inhibitor of apoptosis 1 1
MIRT672828 GJD3 gap junction protein, delta 3, 31.9kDa 1 1
MIRT673460 ZNF583 zinc finger protein 583 1 1
MIRT673958 ZNF500 zinc finger protein 500 1 1
MIRT674693 PLCE1 phospholipase C, epsilon 1 1 1
MIRT675252 MAK male germ cell-associated kinase 1 1
MIRT675447 CLPB ClpB caseinolytic peptidase B homolog (E. coli) 1 1
MIRT679856 GPR75 G protein-coupled receptor 75 1 1
MIRT684311 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 1
MIRT684531 C1orf174 chromosome 1 open reading frame 174 1 1
MIRT684824 BRIX1 BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) 1 1
MIRT685485 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT687295 PARP2 poly (ADP-ribose) polymerase 2 1 1
MIRT688170 GABPB1 GA binding protein transcription factor, beta subunit 1 1 1
MIRT688588 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT688608 CYCS cytochrome c, somatic 1 1
MIRT688926 C11orf84 chromosome 11 open reading frame 84 1 1
MIRT690227 C5orf45 chromosome 5 open reading frame 45 1 1
MIRT690717 WDR73 WD repeat domain 73 1 1
MIRT691293 CENPM centromere protein M 1 1
MIRT691838 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT691887 GXYLT2 glucoside xylosyltransferase 2 1 1
MIRT691951 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT691974 PLCXD1 phosphatidylinositol-specific phospholipase C, X domain containing 1 1 1
MIRT693079 AS3MT arsenic (+3 oxidation state) methyltransferase 1 1
MIRT693651 ACBD7 acyl-CoA binding domain containing 7 1 1
MIRT694085 RNASEH2B ribonuclease H2, subunit B 1 1
MIRT694714 CD300LG CD300 molecule-like family member g 1 1
MIRT694900 ZNF417 zinc finger protein 417 1 1
MIRT695278 CD209 CD209 molecule 1 1
MIRT696349 SLC35D2 solute carrier family 35, member D2 1 1
MIRT697110 GPKOW G patch domain and KOW motifs 1 1
MIRT698241 TMEM216 transmembrane protein 216 1 1
MIRT699761 SEPHS1 selenophosphate synthetase 1 1 1
MIRT701737 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 1 1
MIRT702294 LDHA lactate dehydrogenase A 1 1
MIRT702799 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT703132 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT703662 FAM60A family with sequence similarity 60, member A 1 1
MIRT703770 FAM118A family with sequence similarity 118, member A 1 1
MIRT704670 CLCC1 chloride channel CLIC-like 1 1 1
MIRT705816 AKNA AT-hook transcription factor 1 1
MIRT706574 EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 1 1
MIRT713127 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 1
MIRT713162 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT719508 LMAN2L lectin, mannose-binding 2-like 1 1
MIRT722992 TOR1A torsin family 1, member A (torsin A) 1 1
MIRT724727 TAS2R4 taste receptor, type 2, member 4 1 1
MIRT724917 RBM28 RNA binding motif protein 28 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*