Accession ID: MIRT006458 [miRNA, hsa-miR-34b-3p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34bLinkOut: [miRBase ]
Description Homo sapiens miR-34b stem-loop
Comment Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells . Both arms express mature products in mouse.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34b-3p
Mature Sequence 50| CAAUCACUAACUCCACUGCCAU |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-34b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description Notch homolog 1, translocation-associated (Drosophila)
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 TAAACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCC
  81 GACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTAT
 161 GTACTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCT
 241 ATTCTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATAT
 321 AAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGA
 401 AGGGAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCA
 481 AGCCAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCT
 561 CACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTT
 641 AGATGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCAT
 721 GAATCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCC
 801 CCCTGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACA
 881 CGGAGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACA
 961 GTGTCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTC
1041 CCGTGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCC
1121 CGCAGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTT
1201 GGGAGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTT
1281 TGTTTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCC
1361 TTAGCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGG
1441 CCGCGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTG
1521 TAGTTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACT
1601 GATTTGCAATAAAAATGATACTGATGGTGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34b-3p :: NOTCH1    [ Functional MTI ]
Validation Method Other
Article - Ji, Q. Hao, X. Meng, Y. Zhang, M. Desano, et al.
- BMC Cancer, 2008
BACKGROUND: MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. METHODS: Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. RESULTS: Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. CONCLUSION: Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be correlated to the self-renewal of cancer stem cells. The mechanism of miR-34-mediated suppression of self-renewal appears to be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, indicating that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. Our study suggests that restoration of the tumor suppressor miR-34 may provide a novel molecular therapy for p53-mutant gastric cancer.
LinkOut: [PMID: 18803879]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34b-3p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... miRNA-34b and miRNA-34c are up-regulated and directly target Notch1 during BMP2-induced C2C12 osteoblast differentiation ...

- Bae, Y. Yang, T. Zeng, H. C. Campeau, P. M. et al., 2012, Hum Mol Genet.

Article - Bae, Y. Yang, T. Zeng, H. C. Campeau, P. M. et al.
- Hum Mol Genet, 2012
During bone homeostasis, osteoblast and osteoclast differentiation is coupled and regulated by multiple signaling pathways and their downstream transcription factors. Here, we show that microRNA 34 (miR-34) is significantly induced by BMP2 during osteoblast differentiation. In vivo, osteoblast-specific gain of miR-34c in mice leads to an age-dependent osteoporosis due to the defective mineralization and proliferation of osteoblasts and increased osteoclastogenesis. In osteoblasts, miR-34c targets multiple components of the Notch signaling pathway, including Notch1, Notch2 and Jag1 in a direct manner, and influences osteoclast differentiation in a non-cell-autonomous fashion. Taken together, our results demonstrate that miR-34c is critical during osteoblastogenesis in part by regulating Notch signaling in bone homeostasis. Furthermore, miR-34c-mediated post-transcriptional regulation of Notch signaling in osteoblasts is one possible mechanism to modulate the proliferative effect of Notch in the committed osteoblast progenitors which may be important in the pathogenesis of osteosarcomas. Therefore, understanding the functional interaction of miR-34 and Notch signaling in normal bone development and in bone cancer could potentially lead to therapies modulating miR-34 signaling.
LinkOut: [PMID: 22498974]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
18 hsa-miR-34b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003449 BCL2 B-cell CLL/lymphoma 2 1 3
MIRT003450 CDK4 cyclin-dependent kinase 4 4 2
MIRT003579 CDK6 cyclin-dependent kinase 6 3 4
MIRT004519 VEGFA vascular endothelial growth factor A 2 1
MIRT004825 MET met proto-oncogene (hepatocyte growth factor receptor) 5 2
MIRT005319 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 3
MIRT005761 ZAP70 zeta-chain (TCR) associated protein kinase 70kDa 1 1
MIRT006224 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 1
MIRT006226 SOX2 SRY (sex determining region Y)-box 2 2 1
MIRT006229 NANOG Nanog homeobox 2 1
MIRT006290 CCND1 cyclin D1 3 1
MIRT006291 JAG1 jagged 1 (Alagille syndrome) 3 1
MIRT006458 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 5 2
MIRT020342 CREB1 cAMP responsive element binding protein 1 1 1
MIRT035573 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT035574 HMGA2 high mobility group AT-hook 2 1 1
MIRT035575 NOTCH4 Notch homolog 4 (Drosophila) 1 1
MIRT038536 ENOSF1 enolase superfamily member 1 1 1