Accession ID: MIRT006459 [miRNA, hsa-miR-34c-5p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34cLinkOut: [miRBase ]
Description Homo sapiens miR-34c stem-loop
Comment Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells , and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34c-5p
Mature Sequence 13| AGGCAGUGUAGUUAGCUGAUUGC |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-34c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description Notch homolog 1, translocation-associated (Drosophila)
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 TAAACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCC
  81 GACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTAT
 161 GTACTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCT
 241 ATTCTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATAT
 321 AAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGA
 401 AGGGAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCA
 481 AGCCAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCT
 561 CACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTT
 641 AGATGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCAT
 721 GAATCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCC
 801 CCCTGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACA
 881 CGGAGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACA
 961 GTGTCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTC
1041 CCGTGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCC
1121 CGCAGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTT
1201 GGGAGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTT
1281 TGTTTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCC
1361 TTAGCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGG
1441 CCGCGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTG
1521 TAGTTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACT
1601 GATTTGCAATAAAAATGATACTGATGGTGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34c-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... miRNA-34b and miRNA-34c are up-regulated and directly target Notch1 during BMP2-induced C2C12 osteoblast differentiation ...

- Bae, Y. Yang, T. Zeng, H. C. Campeau, P. M. et al., 2012, Hum Mol Genet.

Article - Bae, Y. Yang, T. Zeng, H. C. Campeau, P. M. et al.
- Hum Mol Genet, 2012
During bone homeostasis, osteoblast and osteoclast differentiation is coupled and regulated by multiple signaling pathways and their downstream transcription factors. Here, we show that microRNA 34 (miR-34) is significantly induced by BMP2 during osteoblast differentiation. In vivo, osteoblast-specific gain of miR-34c in mice leads to an age-dependent osteoporosis due to the defective mineralization and proliferation of osteoblasts and increased osteoclastogenesis. In osteoblasts, miR-34c targets multiple components of the Notch signaling pathway, including Notch1, Notch2 and Jag1 in a direct manner, and influences osteoclast differentiation in a non-cell-autonomous fashion. Taken together, our results demonstrate that miR-34c is critical during osteoblastogenesis in part by regulating Notch signaling in bone homeostasis. Furthermore, miR-34c-mediated post-transcriptional regulation of Notch signaling in osteoblasts is one possible mechanism to modulate the proliferative effect of Notch in the committed osteoblast progenitors which may be important in the pathogenesis of osteosarcomas. Therefore, understanding the functional interaction of miR-34 and Notch signaling in normal bone development and in bone cancer could potentially lead to therapies modulating miR-34 signaling.
LinkOut: [PMID: 22498974]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
21 hsa-miR-34c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000746 MYB v-myb myeloblastosis viral oncogene homolog (avian) 2 1
MIRT000752 CAV1 caveolin 1, caveolae protein, 22kDa 2 1
MIRT000757 MET met proto-oncogene (hepatocyte growth factor receptor) 5 4
MIRT000760 E2F3 E2F transcription factor 3 3 3
MIRT000765 CDK4 cyclin-dependent kinase 4 5 3
MIRT000766 CCNE2 cyclin E2 2 2
MIRT003979 BCL2 B-cell CLL/lymphoma 2 4 2
MIRT004402 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 2 2
MIRT004405 SRSF2 splicing factor, arginine/serine-rich 2 2 1
MIRT005762 ZAP70 zeta-chain (TCR) associated protein kinase 70kDa 1 1
MIRT006192 NOTCH4 Notch homolog 4 (Drosophila) 2 1
MIRT006225 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 1
MIRT006227 SOX2 SRY (sex determining region Y)-box 2 2 1
MIRT006228 NANOG Nanog homeobox 2 1
MIRT006263 HNF4A hepatocyte nuclear factor 4, alpha 1 1
MIRT006287 ULBP2 UL16 binding protein 2 2 1
MIRT006459 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 4 1
MIRT006605 Bcl2 B-cell leukemia/lymphoma 2 2 1
MIRT006926 Sgcb sarcoglycan, beta (dystrophin-associated glycoprotein) 1 1
MIRT007189 MAPT microtubule-associated protein tau 1 1
MIRT007302 UNG uracil-DNA glycosylase 1 1