Accession ID: MIRT006459 [miRNA, hsa-miR-34c-5p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34cLinkOut: [miRBase ]
Description Homo sapiens miR-34c stem-loop
Comment Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells , and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34c-5p
Mature Sequence 13| AGGCAGUGUAGUUAGCUGAUUGC |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-34c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_017617    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_017617|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cguuAG-UCGAUUGAUGUGACGGa 5'
              || :|  ||  |||||||| 
Target 5' ctttTCTGGGGAAAGACACTGCCt 3'
893 - 916 151.00 -15.40
2
miRNA  3' cguuaGUCGAUUGAUGUGACGGa 5'
               |||  ||  |||||||| 
Target 5' ttacaCAG--AA--ACACTGCCt 3'
169 - 187 150.00 -16.00
3
miRNA  3' cgUUAGUCGAUUGAUGUGACGGa 5'
            | | :|   :|| |:||||| 
Target 5' gcACTGGGGACGCTCCGCTGCCg 3'
1370 - 1392 133.00 -13.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34c-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... miRNA-34b and miRNA-34c are up-regulated and directly target Notch1 during BMP2-induced C2C12 osteoblast differentiation ...

- Bae, Y. Yang, T. Zeng, H. C. Campeau, P. M. et al., 2012, Hum Mol Genet.

Article - Bae, Y. Yang, T. Zeng, H. C. Campeau, P. M. et al.
- Hum Mol Genet, 2012
During bone homeostasis, osteoblast and osteoclast differentiation is coupled and regulated by multiple signaling pathways and their downstream transcription factors. Here, we show that microRNA 34 (miR-34) is significantly induced by BMP2 during osteoblast differentiation. In vivo, osteoblast-specific gain of miR-34c in mice leads to an age-dependent osteoporosis due to the defective mineralization and proliferation of osteoblasts and increased osteoclastogenesis. In osteoblasts, miR-34c targets multiple components of the Notch signaling pathway, including Notch1, Notch2 and Jag1 in a direct manner, and influences osteoclast differentiation in a non-cell-autonomous fashion. Taken together, our results demonstrate that miR-34c is critical during osteoblastogenesis in part by regulating Notch signaling in bone homeostasis. Furthermore, miR-34c-mediated post-transcriptional regulation of Notch signaling in osteoblasts is one possible mechanism to modulate the proliferative effect of Notch in the committed osteoblast progenitors which may be important in the pathogenesis of osteosarcomas. Therefore, understanding the functional interaction of miR-34 and Notch signaling in normal bone development and in bone cancer could potentially lead to therapies modulating miR-34 signaling.
LinkOut: [PMID: 22498974]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34c-5p :: NOTCH1    [ Functional MTI ]
Validation Method
Article - Cama, A. Verginelli, F. Lotti, L. V. et al.
- Acta Neuropathol, 2013
Head and neck paragangliomas, rare neoplasms of the paraganglia composed of nests of neurosecretory and glial cells embedded in vascular stroma, provide a remarkable example of organoid tumor architecture. To identify genes and pathways commonly deregulated in head and neck paraganglioma, we integrated high-density genome-wide copy number variation (CNV) analysis with microRNA and immunomorphological studies. Gene-centric CNV analysis of 24 cases identified a list of 104 genes most significantly targeted by tumor-associated alterations. The "NOTCH signaling pathway" was the most significantly enriched term in the list (P = 0.002 after Bonferroni or Benjamini correction). Expression of the relevant NOTCH pathway proteins in sustentacular (glial), chief (neuroendocrine) and endothelial cells was confirmed by immunohistochemistry in 47 head and neck paraganglioma cases. There were no relationships between level and pattern of NOTCH1/JAG2 protein expression and germline mutation status in the SDH genes, implicated in paraganglioma predisposition, or the presence/absence of immunostaining for SDHB, a surrogate marker of SDH mutations. Interestingly, NOTCH upregulation was observed also in cases with no evidence of CNVs at NOTCH signaling genes, suggesting altered epigenetic modulation of this pathway. To address this issue we performed microarray-based microRNA expression analyses. Notably 5 microRNAs (miR-200a,b,c and miR-34b,c), including those most downregulated in the tumors, correlated to NOTCH signaling and directly targeted NOTCH1 in in vitro experiments using SH-SY5Y neuroblastoma cells. Furthermore, lentiviral transduction of miR-200s and miR-34s in patient-derived primary tympano-jugular paraganglioma cell cultures was associated with NOTCH1 downregulation and increased levels of markers of cell toxicity and cell death. Taken together, our results provide an integrated view of common molecular alterations associated with head and neck paraganglioma and reveal an essential role of NOTCH pathway deregulation in this tumor type.
LinkOut: [PMID: 23955600]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
137 hsa-miR-34c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000746 MYB v-myb myeloblastosis viral oncogene homolog (avian) 2 1
MIRT000752 CAV1 caveolin 1, caveolae protein, 22kDa 2 1
MIRT000757 MET met proto-oncogene (hepatocyte growth factor receptor) 5 5
MIRT000760 E2F3 E2F transcription factor 3 5 5
MIRT000765 CDK4 cyclin-dependent kinase 4 5 3
MIRT000766 CCNE2 cyclin E2 3 3
MIRT003979 BCL2 B-cell CLL/lymphoma 2 4 3
MIRT004402 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 5 4
MIRT004405 SRSF2 serine/arginine-rich splicing factor 2 2 1
MIRT004573 CDK6 cyclin-dependent kinase 6 1 3
MIRT005762 ZAP70 zeta-chain (TCR) associated protein kinase 70kDa 1 1
MIRT006192 NOTCH4 notch 4 2 1
MIRT006225 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 1
MIRT006227 SOX2 SRY (sex determining region Y)-box 2 2 1
MIRT006228 NANOG Nanog homeobox 2 1
MIRT006263 HNF4A hepatocyte nuclear factor 4, alpha 1 2
MIRT006287 ULBP2 UL16 binding protein 2 2 1
MIRT006459 NOTCH1 notch 1 4 2
MIRT006605 Bcl2 B cell leukemia/lymphoma 2 2 1
MIRT006926 Sgcb sarcoglycan, beta (dystrophin-associated glycoprotein) 1 1
MIRT007189 MAPT microtubule-associated protein tau 1 1
MIRT007302 UNG uracil-DNA glycosylase 1 1
MIRT052952 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT052978 BMF Bcl2 modifying factor 2 1
MIRT053382 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 3 1
MIRT053384 PDGFRB platelet-derived growth factor receptor, beta polypeptide 3 1
MIRT053470 VEZT vezatin, adherens junctions transmembrane protein 3 1
MIRT054033 YY1 YY1 transcription factor 3 1
MIRT054345 RARG retinoic acid receptor, gamma 2 1
MIRT054925 RUNX2 runt-related transcription factor 2 3 1
MIRT057736 ZDHHC16 zinc finger, DHHC-type containing 16 1 1
MIRT078632 FAM104A family with sequence similarity 104, member A 1 1
MIRT100405 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT115548 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 4 2
MIRT130094 TXNIP thioredoxin interacting protein 1 2
MIRT142246 DCTN5 dynactin 5 (p25) 1 1
MIRT143718 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT169799 GIGYF1 GRB10 interacting GYF protein 1 1 2
MIRT183692 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT198920 SMAD4 SMAD family member 4 1 1
MIRT202948 TSN translin 1 2
MIRT221561 CBX3 chromobox homolog 3 1 1
MIRT253414 EVI5L ecotropic viral integration site 5-like 1 1
MIRT294757 ZNF551 zinc finger protein 551 1 2
MIRT307051 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 1
MIRT331270 TM9SF3 transmembrane 9 superfamily member 3 1 3
MIRT372291 UBXN2B UBX domain protein 2B 1 1
MIRT374314 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT438027 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 1 1
MIRT438028 PTENP1 phosphatase and tensin homolog pseudogene 1 1 1
MIRT438031 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT438315 PABPC1 poly(A) binding protein, cytoplasmic 1 2 1
MIRT438415 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 3 1
MIRT438614 FOSL1 FOS-like antigen 1 2 1
MIRT438702 IL6R interleukin 6 receptor 3 1
MIRT438773 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 2 1
MIRT438774 MAP2K1 mitogen-activated protein kinase kinase 1 2 1
MIRT445819 DNAAF3 dynein, axonemal, assembly factor 3 1 1
MIRT447160 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT447825 CTIF CBP80/20-dependent translation initiation factor 1 1
MIRT448795 GMFB glia maturation factor, beta 1 1
MIRT451582 HIRIP3 HIRA interacting protein 3 1 1
MIRT452681 GPR156 G protein-coupled receptor 156 1 1
MIRT453160 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT453636 SLC4A2 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) 1 1
MIRT455386 PLA2G2D phospholipase A2, group IID 1 1
MIRT456960 SPAM1 sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) 1 1
MIRT462741 EFNB1 ephrin-B1 1 1
MIRT464323 UST uronyl-2-sulfotransferase 1 1
MIRT465639 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 1 5
MIRT466750 SYNGR2 synaptogyrin 2 1 1
MIRT468347 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT469326 RGP1 RGP1 retrograde golgi transport homolog (S. cerevisiae) 1 1
MIRT474360 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT475318 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT477761 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT477826 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478267 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT481041 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT481291 ATXN1L ataxin 1-like 1 1
MIRT482732 COPZ1 coatomer protein complex, subunit zeta 1 1 1
MIRT488781 CYTH3 cytohesin 3 1 1
MIRT489580 SSBP2 single-stranded DNA binding protein 2 1 1
MIRT489661 SHMT1 serine hydroxymethyltransferase 1 (soluble) 1 2
MIRT490529 KIAA1715 KIAA1715 1 1
MIRT492948 NEUROD2 neuronal differentiation 2 1 1
MIRT493156 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT493847 FOXN3 forkhead box N3 1 2
MIRT494745 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT496493 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT503314 FICD FIC domain containing 1 2
MIRT503509 ZNF623 zinc finger protein 623 1 1
MIRT504184 FAM127B family with sequence similarity 127, member B 1 1
MIRT505012 ZNF644 zinc finger protein 644 1 1
MIRT505354 TMEM167A transmembrane protein 167A 1 1
MIRT505644 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT505712 SESN2 sestrin 2 1 1
MIRT505778 SATB2 SATB homeobox 2 1 3
MIRT506209 PHF19 PHD finger protein 19 1 1
MIRT506249 PEG10 paternally expressed 10 1 1
MIRT507788 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT508003 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 2
MIRT508859 ZRSR1 zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1 1 2
MIRT510548 XBP1P1 X-box binding protein 1 pseudogene 1 1 2
MIRT511893 GAS1 growth arrest-specific 1 1 3
MIRT512909 UBL4A ubiquitin-like 4A 1 1
MIRT513602 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT521243 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT521319 RRAGD Ras-related GTP binding D 1 2
MIRT525283 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT528652 RWDD2A RWD domain containing 2A 1 2
MIRT535100 PODXL podocalyxin-like 1 1
MIRT547754 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 2
MIRT547867 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT549173 BMP3 bone morphogenetic protein 3 1 1
MIRT550117 SLC35G2 solute carrier family 35, member G2 1 1
MIRT556099 MOAP1 modulator of apoptosis 1 1 1
MIRT557170 HOXA13 homeobox A13 1 1
MIRT557424 GXYLT2 glucoside xylosyltransferase 2 1 1
MIRT557933 FAM73A family with sequence similarity 73, member A 1 1
MIRT568806 VPS37D vacuolar protein sorting 37 homolog D (S. cerevisiae) 1 1
MIRT571328 TPCN2 two pore segment channel 2 1 1
MIRT572600 PAPLN papilin, proteoglycan-like sulfated glycoprotein 1 1
MIRT573439 APOPT1 apoptogenic 1, mitochondrial 1 1
MIRT574093 VASN vasorin 1 1
MIRT608690 VAV3 vav 3 guanine nucleotide exchange factor 1 2
MIRT608802 ITGA11 integrin, alpha 11 1 2
MIRT610334 SSX5 synovial sarcoma, X breakpoint 5 1 1
MIRT613160 DDA1 DET1 and DDB1 associated 1 1 1
MIRT625409 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT636605 CLIC5 chloride intracellular channel 5 1 1
MIRT638575 IER5 immediate early response 5 1 1
MIRT639688 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT677981 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT685219 POTED POTE ankyrin domain family, member D 1 1
MIRT702572 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT706261 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*