Accession ID: MIRT006501 [miRNA, hsa-miR-217 :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-217LinkOut: [miRBase ]
Synonyms MIRN217, mir-217, MIR217
Description Homo sapiens miR-217 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-217
Mature Sequence 35| UACUGCAUCAGGAACUGAUUGGA |57
Evidence Experimental
Experiments Cloned
Putative hsa-miR-217 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RASK2
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_0333    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRAS
(miRNA target sites are highlighted)
>KRAS|NM_0333|3'UTR
   1 TCTGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAA
  81 AGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAAATACAATTTGTACTTTTTTCTTAAGGCATACTAGTACAA
 161 GTGGTAATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAGCATTACCTAATTTTTTTCCTGCTCCATGCAGACT
 241 GTTAGCTTTTACCTTAAATGCTTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCCCAGAGTT
 321 TTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATACCTAAGATTTCTGTCTTGGGGTTTTTGGTGCATGCAG
 401 TTGATTACTTCTTATTTTTCTTACCAATTGTGAATGTTGGTGTGAAACAAATTAATGAAGCTTTTGAATCATCCCTATTC
 481 TGTGTTTTATCTAGTCACATAAATGGATTAATTACTAATTTCAGTTGAGACCTTCTAATTGGTTTTTACTGAAACATTGA
 561 GGGAACACAAATTTATGGGCTTCCTGATGATGATTCTTCTAGGCATCATGTCCTATAGTTTGTCATCCCTGATGAATGTA
 641 AAGTTACACTGTTCACAAAGGTTTTGTCTCCTTTCCACTGCTATTAGTCATGGTCACTCTCCCCAAAATATTATATTTTT
 721 TCTATAAAAAGAAAAAAATGGAAAAAAATTACAAGGCAATGGAAACTATTATAAGGCCATTTCCTTTTCACATTAGATAA
 801 ATTACTATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTATTATAGCAACCATTTTG
 881 GGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGATTTTAACAAGTATAAAAAATTCTCATAGGAATTAA
 961 ATGTAGTCTCCCTGTGTCAGACTGCTCTTTCATAGTATAACTTTAAATCTTTTCTTCAACTTGAGTCTTTGAAGATAGTT
1041 TTAATTCTGCTTGTGACATTAAAAGATTATTTGGGCCAGTTATAGCTTATTAGGTGTTGAAGAGACCAAGGTTGCAAGGC
1121 CAGGCCCTGTGTGAACCTTTGAGCTTTCATAGAGAGTTTCACAGCATGGACTGTGTCCCCACGGTCATCCAGTGTTGTCA
1201 TGCATTGGTTAGTCAAAATGGGGAGGGACTAGGGCAGTTTGGATAGCTCAACAAGATACAATCTCACTCTGTGGTGGTCC
1281 TGCTGACAAATCAAGAGCATTGCTTTTGTTTCTTAAGAAAACAAACTCTTTTTTAAAAATTACTTTTAAATATTAACTCA
1361 AAAGTTGAGATTTTGGGGTGGTGGTGTGCCAAGACATTAATTTTTTTTTTAAACAATGAAGTGAAAAAGTTTTACAATCT
1441 CTAGGTTTGGCTAGTTCTCTTAACACTGGTTAAATTAACATTGCATAAACACTTTTCAAGTCTGATCCATATTTAATAAT
1521 GCTTTAAAATAAAAATAAAAACAATCCTTTTGATAAATTTAAAATGTTACTTATTTTAAAATAAATGAAGTGAGATGGCA
1601 TGGTGAGGTGAAAGTATCACTGGACTAGGAAGAAGGTGACTTAGGTTCTAGATAGGTGTCTTTTAGGACTCTGATTTTGA
1681 GGACATCACTTACTATCCATTTCTTCATGTTAAAAGAAGTCATCTCAAACTCTTAGTTTTTTTTTTTTACAACTATGTAA
1761 TTTATATTCCATTTACATAAGGATACACTTATTTGTCAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACACCAT
1841 CTTCAGTGCCAGTCTTGGGCAAAATTGTGCAAGAGGTGAAGTTTATATTTGAATATCCATTCTCGTTTTAGGACTCTTCT
1921 TCCATATTAGTGTCATCTTGCCTCCCTACCTTCCACATGCCCCATGACTTGATGCAGTTTTAATACTTGTAATTCCCCTA
2001 ACCATAAGATTTACTGCTGCTGTGGATATCTCCATGAAGTTTTCCCACTGAGTCACATCAGAAATGCCCTACATCTTATT
2081 TCCTCAGGGCTCAAGAGAATCTGACAGATACCATAAAGGGATTTGACCTAATCACTAATTTTCAGGTGGTGGCTGATGCT
2161 TTGAACATCTCTTTGCTGCCCAATCCATTAGCGACAGTAGGATTTTTCAAACCTGGTATGAATAGACAGAACCCTATCCA
2241 GTGGAAGGAGAATTTAATAAAGATAGTGCTGAAAGAATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACAGTA
2321 ATACATTCCATTGTTTTAGTAACCAGAAATCTTCATGCAATGAAAAATACTTTAATTCATGAAGCTTACTTTTTTTTTTT
2401 GGTGTCAGAGTCTCGCTCTTGTCACCCAGGCTGGAATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCCAGG
2481 TTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTGTAT
2561 TTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATTCACCCACCTTGGCC
2641 TCATAAACCTGTTTTGCAGAACTCATTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAAGGC
2721 ACTGGGTATATGGTATCCCCAAACAAGAGACATAATCCCGGTCCTTAGGTAGTGCTAGTGTGGTCTGTAATATCTTACTA
2801 AGGCCTTTGGTATACGACCCAGAGATAACACGATGCGTATTTTAGTTTTGCAAAGAAGGGGTTTGGTCTCTGTGCCAGCT
2881 CTATAATTGTTTTGCTACGATTCCACTGAAACTCTTCGATCAAGCTACTTTATGTAAATCACTTCATTGTTTTAAAGGAA
2961 TAAACTTGATTATATTGTTTTTTTATTTGGCATAACTGTGATTCTTTTAGGACAATTACTGTACACATTAAGGTGTATGT
3041 CAGATATTCATATTGACCCAAATGTGTAATATTCCAGTTTTCTCTGCATAAGTAATTAAAATATACTTAAAAATTAATAG
3121 TTTTATCTGGGTACAAATAAACAGGTGCCTGAACTAGTTCACAGACAAGGAAACTTCTATGTAAAAATCACTATGATTTC
3201 TGAATTGCTATGTGAAACTACAGATCTTTGGAACACTGTTTAGGTAGGGTGTTAAGACTTACACAGTACCTCGTTTCTAC
3281 ACAGAGAAAGAAATGGCCATACTTCAGGAACTGCAGTGCTTATGAGGGGATATTTAGGCCTCTTGAATTTTTGATGTAGA
3361 TGGGCATTTTTTTAAGGTAGTGGTTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGTAGAGA
3441 TTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAAGACAAAAATCCTTGTTGAAGTTTTT
3521 TTAAAAAAAGCTAAATTACATAGACTTAGGCATTAACATGTTTGTGGAAGAATATAGCAGACGTATATTGTATCATTTGA
3601 GTGAATGTTCCCAAGTAGGCATTCTAGGCTCTATTTAACTGAGTCACACTGCATAGGAATTTAGAACCTAACTTTTATAG
3681 GTTATCAAAACTGTTGTCACCATTGCACAATTTTGTCCTAATATATACATAGAAACTTTGTGGGGCATGTTAAGTTACAG
3761 TTTGCACAAGTTCATCTCATTTGTATTCCATTGATTTTTTTTTTCTTCTAAACATTTTTTCTTCAAACAGTATATAACTT
3841 TTTTTAGGGGATTTTTTTTTAGACAGCAAAAACTATCTGAAGATTTCCATTTGTCAAAAAGTAATGATTTCTTGATAATT
3921 GTGTAGTAATGTTTTTTAGAACCCAGCAGTTACCTTAAAGCTGAATTTATATTTAGTAACTTCTGTGTTAATACTGGATA
4001 GCATGAATTCTGCATTGAGAAACTGAATAGCTGTCATAAAATGAAACTTTCTTTCTAAAGAAAGATACTCACATGAGTTC
4081 TTGAAGAATAGTCATAACTAGATTAAGATCTGTGTTTTAGTTTAATAGTTTGAAGTGCCTGTTTGGGATAATGATAGGTA
4161 ATTTAGATGAATTTAGGGGAAAAAAAAGTTATCTGCAGATATGTTGAGGGCCCATCTCTCCCCCCACACCCCCACAGAGC
4241 TAACTGGGTTACAGTGTTTTATCCGAAAGTTTCCAATTCCACTGTCTTGTGTTTTCATGTTGAAAATACTTTTGCATTTT
4321 TCCTTTGAGTGCCAATTTCTTACTAGTACTATTTCTTAATGTAACATGTTTACCTGGAATGTATTTTAACTATTTTTGTA
4401 TAGTGTAAACTGAAACATGCACATTTTGTACATTGTGCTTTCTTTTGTGGGACATATGCAGTGTGATCCAGTTGTTTTCC
4481 ATCATTTGGTTGCGCTGACCTAGGAATGTTGGTCATATCAAACATTAAAAATGACCACTCTTTTAATTGAAATTAACTTT
4561 TAAATGTTTATAGGAGTATGTGCTGTGAAGTGATCTAAAATTTGTAATATTTTTGTCATGAACTGTACTACTCCTAATTA
4641 TTGTAATGTAATAAAAATAGTTACAGTGAC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agGUUAGUCAAGGACUACGUCAu 5'
            | || |   |:||||||||| 
Target 5' ccCCATGA---CTTGATGCAGTt 3'
1960 - 1979 158.00 -16.40
2
miRNA  3' agguuagUCAAGGAC----UACGUCAu 5'
                 :|||::||    ||||||| 
Target 5' gtcttggGGTTTTTGGTGCATGCAGTt 3'
376 - 402 154.00 -13.10
3
miRNA  3' agGUUAGUCAAGGAC--UACGUCAu 5'
            ||  |||   |||  ||||||| 
Target 5' gtCACCCAG--GCTGGAATGCAGTg 3'
2421 - 2443 151.00 -15.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-217 :: KRAS    [ Functional MTI ]
Validation Method Luciferase reporter assay , Reporter assay
Conditions PANC-1 , MIAPaCa-2 , AsPC-1 , BxPC-3 , P1 , P3 , P7 w
Disease pancreatic ductal adenocarcinoma;
Location of target site 3'UTR
Tools used in this research miRBase Target Database , miRTar , RNA22
Original Description (Extracted from the article) ... KRAS is a direct target of miR-217 ...

- Zhao, W. G. Yu, S. N. Lu, Z. H. Ma, Y. H. et al., 2010, Carcinogenesis.

Article - Zhao, W. G. Yu, S. N. Lu, Z. H. Ma, Y. H. et al.
- Carcinogenesis, 2010
Aberrantly expressed microRNA (miRNA) is frequently associated with a variety of cancers, including pancreatic ductal adenocarcinoma (PDAC). In this study, we investigated the expression and possible role of miR-217 in PDAC. Data obtained by locked nucleic acid in situ hybridization and real-time quantitative polymerase chain reaction showed that miR-217 was downregulated in 76.2% (16/21) of PDAC tissues and in all tested PDAC cell lines when compared with the corresponding normal pancreatic tissue. Overexpression of miR-217 in PDAC cells inhibited tumor cell growth and anchorage-independent colony formation and miR-217 decreased tumor cell growth in nude mouse xenografts in vivo. Using in silico predictions, KRAS was defined as a potential direct target of miR-217. Data from the dual-luciferase reporter gene assay showed that KRAS was a direct target of miR-217. Upregulation of miR-217 could decrease KRAS protein levels and reduce the constitutive phosphorylation of downstream AKT. Downregulation of miR-217 expression in PDAC cells could increase cell anchorage-independent colony formation and KRAS protein levels. Furthermore, miR-217 expression was observed to be negatively correlated with KRAS protein expression in PDAC cell lines. We conclude that the frequently downregulated miR-217 can regulate KRAS and function as a tumor suppressor in PDAC. Therefore, miR-217 may serve as a useful therapeutic agent for miRNA-based PDAC therapy.
LinkOut: [PMID: 20675343]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
12 hsa-miR-217 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000144 SIRT1 sirtuin 1 3 1
MIRT000481 ROBO1 roundabout, axon guidance receptor, homolog 1 (Drosophila) 4 1
MIRT000533 PTEN phosphatase and tensin homolog 3 3
MIRT003535 NR4A2 nuclear receptor subfamily 4, group A, member 2 3 1
MIRT004010 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 1
MIRT004866 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005685 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT006363 FHIT fragile histidine triad 1 1
MIRT006501 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT007153 SMAD7 SMAD family member 7 1 1
MIRT024253 Pten phosphatase and tensin homolog 1 1
MIRT024254 IRS1 insulin receptor substrate 1 1 1