Accession ID: MIRT006560 [miRNA, hsa-miR-199a-3p :: SMARCA2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-199a-1LinkOut: [miRBase ]
Synonyms MIRN199A1, MIR199A1
Description Homo sapiens miR-199a-1 stem-loop
Comment Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-199a-3p
Mature Sequence 47| ACAGUAGUCUGCACAUUGGUUA |68
Evidence Experimental
Experiments Cloned
Putative hsa-miR-199a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-199a-3p :: SMARCA2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions MDA-MB-435 , 293FT
Location of target site 3'UTR
Tools used in this research PicTar
Original Description (Extracted from the article) ... Either miR-199a-5p or miR-199a-3p targets Brm mRNA. ...

- Sakurai, K. Furukawa, C. Haraguchi, T. et al., 2011, Cancer research.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' auUGGUUACACGUCUGAUGACa 5'
            |:: ||||     |||||| 
Target 5' agAUUUAUGU-----CUACUGu 3'
19 - 35
Article - Sakurai, K. Furukawa, C. Haraguchi, T. et al.
- Cancer research, 2011
The chromatin remodeling complex SWI/SNF is an important epigenetic regulator that includes one Brm or BRG1 molecule as catalytic subunit. Brm and BRG1 do not function identically, so this complex can regulate gene expression either positively or negatively, depending on the promoter to which it is recruited. Notably, Brm attenuation due to posttranscription suppression occurs often in human tumor cells, in which this event contributes to their oncogenic potential. Here, we report that the 3'-untranslated region of Brm mRNA has two sites that are efficiently targeted by the microRNAs miR-199a-5p and -3p, revealing a novel mechanism for modulation of Brm-type SWI/SNF activity. Computational mapping of the putative promoter region of miR-199a-2 (miPPR-199a-2) has defined it as the major contributing genetic locus for miR-199a-5p and-3p production in these tumor cell lines. We validated this predicted region by direct promoter analysis to confirm that Egr1 is a strong positive regulator of the miR-199a-2 gene. Importantly, we also showed that Egr1, miR-199a-5p, and miR-199a-3p are expressed at high levels in Brm-deficient tumor cell lines but only marginally in Brm-expressing tumor cells. Finally, we also obtained evidence that Brm negatively regulates Egr1. Together, our results reveal that miR-199a and Brm form a double-negative feedback loop through Egr1, leading to the generation of these two distinct cell types during carcinogenesis. This mechanism may offer a partial explanation for why miR-199a-5p and -3p have been reported to be either upregulated or downregulated in a variety of tumors. Cancer Res; 71(5); 1680-9. (c)2010 AACR.
LinkOut: [PMID: 21189327]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
93 hsa-miR-199a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000775 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 1 1
MIRT000779 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT000781 MED6 mediator complex subunit 6 1 1
MIRT000783 JUNB jun B proto-oncogene 1 1
MIRT001969 MET met proto-oncogene (hepatocyte growth factor receptor) 5 2
MIRT003324 KRT7 keratin 7 1 2
MIRT003790 CD44 CD44 molecule (Indian blood group) 4 1
MIRT003982 MAPK9 mitogen-activated protein kinase 9 2 1
MIRT003983 MAPK1 mitogen-activated protein kinase 1 3 1
MIRT003984 AKT1 v-akt murine thymoma viral oncogene homolog 1 2 1
MIRT003985 MAPK8 mitogen-activated protein kinase 8 2 1
MIRT003986 MAPK14 mitogen-activated protein kinase 14 2 1
MIRT006453 FUT4 fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific) 3 1
MIRT006560 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 3 1
MIRT006586 CCNL1 cyclin L1 1 1
MIRT006655 CAV2 caveolin 2 3 1
MIRT026023 MTOR mechanistic target of rapamycin (serine/threonine kinase) 5 3
MIRT052942 STK11 serine/threonine kinase 11 2 1
MIRT052956 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 3 1
MIRT053556 DNAJA4 DnaJ (Hsp40) homolog, subfamily A, member 4 2 1
MIRT053558 APOE apolipoprotein E 2 1
MIRT054230 ZHX1 zinc fingers and homeoboxes 1 3 1
MIRT054477 HGF hepatocyte growth factor (hepapoietin A; scatter factor) 3 1
MIRT057005 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT060356 UCK2 uridine-cytidine kinase 2 1 1
MIRT099168 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT101814 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT128855 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT177954 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT185223 ETNK1 ethanolamine kinase 1 1 1
MIRT264710 C11ORF57 chromosome 11 open reading frame 57 1 1
MIRT284089 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 1
MIRT408636 QKI QKI, KH domain containing, RNA binding 1 1
MIRT438017 IGF1 insulin-like growth factor 1 (somatomedin C) 2 1
MIRT442568 CCDC59 coiled-coil domain containing 59 1 1
MIRT442903 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT448993 ARL15 ADP-ribosylation factor-like 15 1 1
MIRT450890 COL4A5 collagen, type IV, alpha 5 1 1
MIRT456425 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT461290 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 1
MIRT462875 ZXDB zinc finger, X-linked, duplicated B 1 1
MIRT466200 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT469345 RGMB RGM domain family, member B 1 1
MIRT470966 PKM pyruvate kinase, muscle 1 1
MIRT471603 PAQR5 progestin and adipoQ receptor family member V 1 9
MIRT472557 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 2
MIRT473449 MCOLN2 mucolipin 2 1 4
MIRT474145 LIN54 lin-54 homolog (C. elegans) 1 2
MIRT476749 FOXK2 forkhead box K2 1 1
MIRT478698 CSRP2 cysteine and glycine-rich protein 2 1 2
MIRT486961 HLA-B major histocompatibility complex, class I, B 1 1
MIRT491927 WNK2 WNK lysine deficient protein kinase 2 1 1
MIRT492122 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT493771 GNAS GNAS complex locus 1 1
MIRT495574 UNC5C unc-5 homolog C (C. elegans) 1 1
MIRT496527 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 1 1
MIRT497490 RGS17 regulator of G-protein signaling 17 1 1
MIRT499500 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT507636 CREBZF CREB/ATF bZIP transcription factor 1 3
MIRT531400 TMEM18 transmembrane protein 18 1 1
MIRT531450 HSD17B12 hydroxysteroid (17-beta) dehydrogenase 12 1 1
MIRT533964 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 1
MIRT537188 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 2
MIRT540443 RBM43 RNA binding motif protein 43 1 1
MIRT543176 FICD FIC domain containing 1 1
MIRT543290 ZNF585B zinc finger protein 585B 1 1
MIRT546199 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT548051 GOLIM4 golgi integral membrane protein 4 1 1
MIRT548941 CDK17 cyclin-dependent kinase 17 1 1
MIRT552923 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT553306 TSPAN3 tetraspanin 3 1 1
MIRT553556 TMEM161B transmembrane protein 161B 1 1
MIRT553934 STC2 stanniocalcin 2 1 2
MIRT557866 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT558557 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT558788 CEP55 centrosomal protein 55kDa 1 1
MIRT559208 BLOC1S6 biogenesis of lysosomal organelles complex-1, subunit 6, pallidin 1 1
MIRT560315 EFHD2 EF-hand domain family, member D2 1 1
MIRT568418 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT570378 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 1
MIRT570421 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 1
MIRT570454 TMEM189 transmembrane protein 189 1 1
MIRT613448 LUC7L2 LUC7-like 2 (S. cerevisiae) 1 2
MIRT614111 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 1 2
MIRT623042 OCIAD2 OCIA domain containing 2 1 1
MIRT632240 VTA1 Vps20-associated 1 homolog (S. cerevisiae) 1 1
MIRT632984 E2F2 E2F transcription factor 2 1 1
MIRT633319 LINC00346 long intergenic non-protein coding RNA 346 1 1
MIRT651154 ZNF384 zinc finger protein 384 1 1
MIRT696977 CCDC80 coiled-coil domain containing 80 1 1
MIRT699382 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT710556 PHF8 PHD finger protein 8 1 1
MIRT721557 FXN frataxin 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*