Accession ID: MIRT006560 [miRNA, hsa-miR-199a-3p :: SMARCA2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-199a-1LinkOut: [miRBase ]
Synonyms MIRN199A1, MIR199A1
Description Homo sapiens miR-199a-1 stem-loop
Comment Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-199a-3p
Mature Sequence 47| ACAGUAGUCUGCACAUUGGUUA |68
Evidence Experimental
Experiments Cloned
Putative hsa-miR-199a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SMARCA2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BAF190, BRM, FLJ36757, MGC74511, SNF2, SNF2L2, SNF2LA, SWI2, Sth1p, hBRM, hSNF2a
Description SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Transcript NM_0030    LinkOut: [ RefSeq ]
Other Transcripts NM_1390   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SMARCA2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SMARCA2
(miRNA target sites are highlighted)
>SMARCA2|NM_0030|3'UTR
   1 GAGGAAGAGAGTGAGGATGAAAGCAATGAAGAGGAGGAAGAGGAAGATGAAGAAGAGTCAGAGTCCGAGGCAAAATCAGT
  81 CAAGGTGAAAATTAAGCTCAATAAAAAAGATGACAAAGGCCGGGACAAAGGGAAAGGCAAGAAAAGGCCAAATCGAGGAA
 161 AAGCCAAACCTGTAGTGAGCGATTTTGACAGCGATGAGGAGCAGGATGAACGTGAACAGTCAGAAGGAAGTGGGACGGAT
 241 GATGAGTGATCAGTATGGACCTTTTTCCTTGGTAGAACTGAATTCCTTCCTCCCCTGTCTCATTTCTACCCAGTGAGTTC
 321 ATTTGTCATATAGGCACTGGGTTGTTTCTATATCATCATCGTCTATAAACTAGCTTTAGGATAGTGCCAGACAAACATAT
 401 GATATCATGGTGTAAAAAACACACACATACACAAATATTTGTAACATATTGTGACCAAATGGGCCTCAAAGATTCAGATT
 481 GAAACAAACAAAAAGCTTTTGATGGAAAATATGTGGGTGGATAGTATATTTCTATGGGTGGGTCTAATTTGGTAACGGTT
 561 TGATTGTGCCTGGTTTTATCACCTGTTCAGATGAGAAGATTTTTGTCTTTTGTAGCACTGATAACCAGGAGAAGCCATTA
 641 AAAGCCACTGGTTATTTTATTTTTCATCAGGCAATTTTCGAGGTTTTTATTTGTTCGGTATTGTTTTTTTACACTGTGGT
 721 ACATATAAGCAACTTTAATAGGTGATAAATGTACAGTAGTTAGATTTCACCTGCATATACATTTTTCCATTTTATGCTCT
 801 ATGATCTGAACAAAAGCTTTTTGAATTGTATAAGATTTATGTCTACTGTAAACATTGCTTAATTTTTTTGCTCTTGATTT
 881 AAAAAAAAGTTTTGTTGAAAGCGCTATTGAATATTGCAATCTATATAGTGTATTGGATGGCTTCTTTTGTCACCCTGATC
 961 TCCTATGTTACCAATGTGTATCGTCTCCTTCTCCCTAAAGTGTACTTAATCTTTGCTTTCTTTGCACAATGTCTTTGGTT
1041 GCAAGTCATAAGCCTGAGGCAAATAAAATTCCAGTAATTTCGAAGAATGTGGTGTTGGTGCTTTCCTAATAAAGAAATAA
1121 TTTAGCTTGACAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' auUGGUUACACGUCUGAUGACa 5'
            |:: ||||     |||||| 
Target 5' agATTTATGT-----CTACTGt 3'
833 - 849 122.00 -8.70
2
miRNA  3' auugguuAC-AC-GUC-UGAUGACa 5'
                 || ||  || :|||:|| 
Target 5' aaagtttTGTTGAAAGCGCTATTGa 3'
886 - 910 111.00 -7.30
3
miRNA  3' auuGGUUACACGUCUGAUGACa 5'
             | :||| | |||:| :|| 
Target 5' gttCAGATGAGAAGATTTTTGt 3'
585 - 606 103.00 -8.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-199a-3p :: SMARCA2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions MDA-MB-435 , 293FT
Location of target site 3'UTR
Tools used in this research PicTar
Original Description (Extracted from the article) ... Either miR-199a-5p or miR-199a-3p targets Brm mRNA. ...

- Sakurai, K. Furukawa, C. Haraguchi, T. et al., 2011, Cancer research.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' auUGGUUACACGUCUGAUGACa 5'
            |:: ||||     |||||| 
Target 5' agAUUUAUGU-----CUACUGu 3'
19 - 35
Article - Sakurai, K. Furukawa, C. Haraguchi, T. et al.
- Cancer research, 2011
The chromatin remodeling complex SWI/SNF is an important epigenetic regulator that includes one Brm or BRG1 molecule as catalytic subunit. Brm and BRG1 do not function identically, so this complex can regulate gene expression either positively or negatively, depending on the promoter to which it is recruited. Notably, Brm attenuation due to posttranscription suppression occurs often in human tumor cells, in which this event contributes to their oncogenic potential. Here, we report that the 3'-untranslated region of Brm mRNA has two sites that are efficiently targeted by the microRNAs miR-199a-5p and -3p, revealing a novel mechanism for modulation of Brm-type SWI/SNF activity. Computational mapping of the putative promoter region of miR-199a-2 (miPPR-199a-2) has defined it as the major contributing genetic locus for miR-199a-5p and-3p production in these tumor cell lines. We validated this predicted region by direct promoter analysis to confirm that Egr1 is a strong positive regulator of the miR-199a-2 gene. Importantly, we also showed that Egr1, miR-199a-5p, and miR-199a-3p are expressed at high levels in Brm-deficient tumor cell lines but only marginally in Brm-expressing tumor cells. Finally, we also obtained evidence that Brm negatively regulates Egr1. Together, our results reveal that miR-199a and Brm form a double-negative feedback loop through Egr1, leading to the generation of these two distinct cell types during carcinogenesis. This mechanism may offer a partial explanation for why miR-199a-5p and -3p have been reported to be either upregulated or downregulated in a variety of tumors. Cancer Res; 71(5); 1680-9. (c)2010 AACR.
LinkOut: [PMID: 21189327]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
17 hsa-miR-199a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000775 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 1 1
MIRT000779 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT000781 MED6 mediator complex subunit 6 1 1
MIRT000783 JUNB jun B proto-oncogene 1 1
MIRT001969 MET met proto-oncogene (hepatocyte growth factor receptor) 3 1
MIRT003324 KRT7 keratin 7 1 2
MIRT003790 CD44 CD44 molecule (Indian blood group) 4 1
MIRT003982 MAPK9 mitogen-activated protein kinase 9 2 1
MIRT003983 MAPK1 mitogen-activated protein kinase 1 3 1
MIRT003984 AKT1 v-akt murine thymoma viral oncogene homolog 1 2 1
MIRT003985 MAPK8 mitogen-activated protein kinase 8 2 1
MIRT003986 MAPK14 mitogen-activated protein kinase 14 2 1
MIRT006453 FUT4 fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific) 3 1
MIRT006560 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 3 1
MIRT006586 CCNL1 cyclin L1 1 1
MIRT006655 CAV2 caveolin 2 3 1
MIRT026023 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1