Accession ID: MIRT006561 [miRNA, hsa-miR-199a-5p :: SMARCA2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-199a-1LinkOut: [miRBase ]
Synonyms MIRN199A1, MIR199A1
Description Homo sapiens miR-199a-1 stem-loop
Comment Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-199a-5p
Mature Sequence 6| CCCAGUGUUCAGACUACCUGUUC |28
Evidence Experimental
Experiments Cloned
Putative hsa-miR-199a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-199a-5p :: SMARCA2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions MDA-MB-435 , 293FT
Location of target site 3'UTR
Tools used in this research PicTar
Original Description (Extracted from the article) ... Either miR-199a-5p or miR-199a-3p targets Brm mRNA. ...

- Sakurai, K. Furukawa, C. Haraguchi, T. et al., 2011, Cancer research.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cuuGUCCAUCAG---ACUUGUGACCc 5'
             ||  | |||   | ::|||||| 
Target 5' guuCAUUUUGUCAUAUAGGCACUGGg 3'
7 - 32
Article - Sakurai, K. Furukawa, C. Haraguchi, T. et al.
- Cancer research, 2011
The chromatin remodeling complex SWI/SNF is an important epigenetic regulator that includes one Brm or BRG1 molecule as catalytic subunit. Brm and BRG1 do not function identically, so this complex can regulate gene expression either positively or negatively, depending on the promoter to which it is recruited. Notably, Brm attenuation due to posttranscription suppression occurs often in human tumor cells, in which this event contributes to their oncogenic potential. Here, we report that the 3'-untranslated region of Brm mRNA has two sites that are efficiently targeted by the microRNAs miR-199a-5p and -3p, revealing a novel mechanism for modulation of Brm-type SWI/SNF activity. Computational mapping of the putative promoter region of miR-199a-2 (miPPR-199a-2) has defined it as the major contributing genetic locus for miR-199a-5p and-3p production in these tumor cell lines. We validated this predicted region by direct promoter analysis to confirm that Egr1 is a strong positive regulator of the miR-199a-2 gene. Importantly, we also showed that Egr1, miR-199a-5p, and miR-199a-3p are expressed at high levels in Brm-deficient tumor cell lines but only marginally in Brm-expressing tumor cells. Finally, we also obtained evidence that Brm negatively regulates Egr1. Together, our results reveal that miR-199a and Brm form a double-negative feedback loop through Egr1, leading to the generation of these two distinct cell types during carcinogenesis. This mechanism may offer a partial explanation for why miR-199a-5p and -3p have been reported to be either upregulated or downregulated in a variety of tumors. Cancer Res; 71(5); 1680-9. (c)2010 AACR.
LinkOut: [PMID: 21189327]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
136 hsa-miR-199a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003809 EZH2 enhancer of zeste homolog 2 (Drosophila) 2 1
MIRT003828 IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 4 1
MIRT003963 CCNL1 cyclin L1 2 2
MIRT004325 LIF leukemia inhibitory factor 3 2
MIRT004391 JUNB jun B proto-oncogene 2 1
MIRT004393 MED6 mediator complex subunit 6 2 1
MIRT004395 MECP2 methyl CpG binding protein 2 (Rett syndrome) 2 1
MIRT004398 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 2 1
MIRT004674 DDR1 discoidin domain receptor tyrosine kinase 1 3 1
MIRT005432 EDN1 endothelin 1 2 1
MIRT005873 MAP3K11 mitogen-activated protein kinase kinase kinase 11 3 1
MIRT006138 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 3 3
MIRT006193 SOX9 SRY (sex determining region Y)-box 9 1 1
MIRT006561 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 3 1
MIRT006786 CD44 CD44 molecule (Indian blood group) 1 1
MIRT006832 TMEM54 transmembrane protein 54 2 1
MIRT007013 SMAD4 SMAD family member 4 1 2
MIRT007036 SULT1E1 sulfotransferase family 1E, estrogen-preferring, member 1 1 1
MIRT007061 GPR78 G protein-coupled receptor 78 1 1
MIRT007265 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 3 2
MIRT007303 UNG uracil-DNA glycosylase 1 1
MIRT026024 ALOX5AP arachidonate 5-lipoxygenase-activating protein 1 1
MIRT035548 CAV1 caveolin 1, caveolae protein, 22kDa 5 2
MIRT052646 SIRT1 sirtuin 1 3 2
MIRT053102 HSPA5 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) 3 1
MIRT053103 ATF6 activating transcription factor 6 3 2
MIRT053104 ERN1 endoplasmic reticulum to nucleus signaling 1 3 1
MIRT053233 KL klotho 4 1
MIRT053553 APOE apolipoprotein E 2 1
MIRT053557 DNAJA4 DnaJ (Hsp40) homolog, subfamily A, member 4 2 1
MIRT053607 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 2 1
MIRT054132 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 4 1
MIRT054370 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 2 1
MIRT071779 RNF11 ring finger protein 11 1 1
MIRT235493 ZNF544 zinc finger protein 544 1 1
MIRT305208 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT346922 ZNF844 zinc finger protein 844 1 1
MIRT358311 PANK3 pantothenate kinase 3 1 1
MIRT401907 COL19A1 collagen, type XIX, alpha 1 1 1
MIRT437380 LIN7A lin-7 homolog A (C. elegans) 1 1
MIRT437381 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT437382 CTSC cathepsin C 1 1
MIRT437383 RND1 Rho family GTPase 1 1 1
MIRT437384 PVRL1 poliovirus receptor-related 1 (herpesvirus entry mediator C) 1 1
MIRT437763 DRAM1 DNA-damage regulated autophagy modulator 1 2 1
MIRT437764 BECN1 beclin 1, autophagy related 2 1
MIRT438003 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 2 1
MIRT438173 WNK1 WNK lysine deficient protein kinase 1 3 1
MIRT438174 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 3 1
MIRT438286 ACVR1B activin A receptor, type IB 3 1
MIRT438293 Grb10 growth factor receptor bound protein 10 1 1
MIRT438498 VEGFA vascular endothelial growth factor A 1 1
MIRT438531 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 2 1
MIRT438532 SNAI1 snail homolog 1 (Drosophila) 2 1
MIRT438593 GSK3B glycogen synthase kinase 3 beta 5 1
MIRT438594 FZD4 frizzled family receptor 4 5 1
MIRT438595 WNT2 wingless-type MMTV integration site family member 2 5 1
MIRT438596 JAG1 jagged 1 5 1
MIRT444920 PSG11 pregnancy specific beta-1-glycoprotein 11 1 1
MIRT446723 PSG3 pregnancy specific beta-1-glycoprotein 3 1 1
MIRT451199 PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 1 1
MIRT452706 C1orf226 chromosome 1 open reading frame 226 1 1
MIRT453348 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 1
MIRT460285 PDE11A phosphodiesterase 11A 1 1
MIRT467427 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 2
MIRT467693 SLC38A2 solute carrier family 38, member 2 1 2
MIRT468521 SESN2 sestrin 2 1 1
MIRT469384 RER1 RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) 1 1
MIRT470854 PLXND1 plexin D1 1 1
MIRT473744 MAP3K9 mitogen-activated protein kinase kinase kinase 9 1 1
MIRT477786 E2F3 E2F transcription factor 3 1 1
MIRT478955 COX15 cytochrome c oxidase assembly homolog 15 (yeast) 1 1
MIRT486476 TSC22D1 TSC22 domain family, member 1 1 1
MIRT494268 CEP120 centrosomal protein 120kDa 1 1
MIRT497442 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) 1 1
MIRT503643 POLR2F polymerase (RNA) II (DNA directed) polypeptide F 1 2
MIRT504127 RCC1 regulator of chromosome condensation 1 1 3
MIRT513107 DYNAP dynactin associated protein 1 1
MIRT513401 PAX8 paired box 8 1 1
MIRT513936 EXTL3 exostoses (multiple)-like 3 1 2
MIRT516734 ZNF669 zinc finger protein 669 1 3
MIRT518153 ZNF440 zinc finger protein 440 1 2
MIRT518587 ZNF117 zinc finger protein 117 1 2
MIRT519612 ZNF791 zinc finger protein 791 1 3
MIRT519633 ZNF772 zinc finger protein 772 1 2
MIRT519752 ZNF394 zinc finger protein 394 1 2
MIRT520427 TUBG1 tubulin, gamma 1 1 2
MIRT522380 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 1 3
MIRT524205 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT526123 RIC8A resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) 1 1
MIRT527229 C3orf36 chromosome 3 open reading frame 36 1 2
MIRT529563 SNRNP48 small nuclear ribonucleoprotein 48kDa (U11/U12) 1 1
MIRT530106 PSAPL1 prosaposin-like 1 (gene/pseudogene) 1 1
MIRT530298 AKAP17A A kinase (PRKA) anchor protein 17A 1 1
MIRT532447 PLGRKT plasminogen receptor, C-terminal lysine transmembrane protein 1 1
MIRT533617 TNFRSF13C tumor necrosis factor receptor superfamily, member 13C 1 1
MIRT534170 SLC8A1 solute carrier family 8 (sodium/calcium exchanger), member 1 1 1
MIRT538334 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 1 1
MIRT539656 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT540793 TMOD2 tropomodulin 2 (neuronal) 1 1
MIRT541359 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT560016 ZNF525 zinc finger protein 525 1 1
MIRT560081 ZNF195 zinc finger protein 195 1 1
MIRT562711 ZNF415 zinc finger protein 415 1 1
MIRT562737 ZNF468 zinc finger protein 468 1 1
MIRT562810 ZNF611 zinc finger protein 611 1 1
MIRT563135 ZNF215 zinc finger protein 215 1 1
MIRT564722 ZNF286B zinc finger protein 286B 1 1
MIRT570884 ZFP1 zinc finger protein 1 homolog (mouse) 1 1
MIRT571504 ZNF846 zinc finger protein 846 1 1
MIRT571522 ZNF625 zinc finger protein 625 1 1
MIRT572295 ZNF584 zinc finger protein 584 1 1
MIRT572450 TRIM10 tripartite motif containing 10 1 1
MIRT572740 VAV3 vav 3 guanine nucleotide exchange factor 1 3
MIRT575694 Map1b microtubule-associated protein 1B 1 1
MIRT622970 OXSR1 oxidative-stress responsive 1 1 1
MIRT625511 PPAPDC1A phosphatidic acid phosphatase type 2 domain containing 1A 1 1
MIRT628797 A2ML1 alpha-2-macroglobulin-like 1 1 1
MIRT641955 RNF115 ring finger protein 115 1 1
MIRT645316 AGTRAP angiotensin II receptor-associated protein 1 1
MIRT646075 NDUFS2 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) 1 1
MIRT648159 CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion 1 1
MIRT665094 CRIPT cysteine-rich PDZ-binding protein 1 1
MIRT666908 POLA2 polymerase (DNA directed), alpha 2, accessory subunit 1 1
MIRT680435 GATA6 GATA binding protein 6 1 1
MIRT684287 CDK9 cyclin-dependent kinase 9 1 1
MIRT686316 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT691999 PTCD2 pentatricopeptide repeat domain 2 1 1
MIRT695634 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT700705 PODXL podocalyxin-like 1 1
MIRT706011 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT711107 TBC1D21 TBC1 domain family, member 21 1 1
MIRT712557 CENPO centromere protein O 1 1
MIRT720321 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 1 1
MIRT721050 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT724617 SNAP25 synaptosomal-associated protein, 25kDa 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*