Accession ID: MIRT006561 [miRNA, hsa-miR-199a-5p :: SMARCA2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-199a-1LinkOut: [miRBase ]
Synonyms MIRN199A1, MIR199A1
Description Homo sapiens miR-199a-1 stem-loop
Comment Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-199a-5p
Mature Sequence 6| CCCAGUGUUCAGACUACCUGUUC |28
Evidence Experimental
Experiments Cloned
Putative hsa-miR-199a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SMARCA2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BAF190, BRM, FLJ36757, MGC74511, SNF2, SNF2L2, SNF2LA, SWI2, Sth1p, hBRM, hSNF2a
Description SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Transcript NM_0030    LinkOut: [ RefSeq ]
Other Transcripts NM_1390   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SMARCA2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SMARCA2
(miRNA target sites are highlighted)
>SMARCA2|NM_0030|3'UTR
   1 GAGGAAGAGAGTGAGGATGAAAGCAATGAAGAGGAGGAAGAGGAAGATGAAGAAGAGTCAGAGTCCGAGGCAAAATCAGT
  81 CAAGGTGAAAATTAAGCTCAATAAAAAAGATGACAAAGGCCGGGACAAAGGGAAAGGCAAGAAAAGGCCAAATCGAGGAA
 161 AAGCCAAACCTGTAGTGAGCGATTTTGACAGCGATGAGGAGCAGGATGAACGTGAACAGTCAGAAGGAAGTGGGACGGAT
 241 GATGAGTGATCAGTATGGACCTTTTTCCTTGGTAGAACTGAATTCCTTCCTCCCCTGTCTCATTTCTACCCAGTGAGTTC
 321 ATTTGTCATATAGGCACTGGGTTGTTTCTATATCATCATCGTCTATAAACTAGCTTTAGGATAGTGCCAGACAAACATAT
 401 GATATCATGGTGTAAAAAACACACACATACACAAATATTTGTAACATATTGTGACCAAATGGGCCTCAAAGATTCAGATT
 481 GAAACAAACAAAAAGCTTTTGATGGAAAATATGTGGGTGGATAGTATATTTCTATGGGTGGGTCTAATTTGGTAACGGTT
 561 TGATTGTGCCTGGTTTTATCACCTGTTCAGATGAGAAGATTTTTGTCTTTTGTAGCACTGATAACCAGGAGAAGCCATTA
 641 AAAGCCACTGGTTATTTTATTTTTCATCAGGCAATTTTCGAGGTTTTTATTTGTTCGGTATTGTTTTTTTACACTGTGGT
 721 ACATATAAGCAACTTTAATAGGTGATAAATGTACAGTAGTTAGATTTCACCTGCATATACATTTTTCCATTTTATGCTCT
 801 ATGATCTGAACAAAAGCTTTTTGAATTGTATAAGATTTATGTCTACTGTAAACATTGCTTAATTTTTTTGCTCTTGATTT
 881 AAAAAAAAGTTTTGTTGAAAGCGCTATTGAATATTGCAATCTATATAGTGTATTGGATGGCTTCTTTTGTCACCCTGATC
 961 TCCTATGTTACCAATGTGTATCGTCTCCTTCTCCCTAAAGTGTACTTAATCTTTGCTTTCTTTGCACAATGTCTTTGGTT
1041 GCAAGTCATAAGCCTGAGGCAAATAAAATTCCAGTAATTTCGAAGAATGTGGTGTTGGTGCTTTCCTAATAAAGAAATAA
1121 TTTAGCTTGACAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cuugucCAUCAGACUUGUGACCc 5'
                ||  | | ::|||||| 
Target 5' tcatttGTCATATAGGCACTGGg 3'
319 - 341 133.00 -14.80
2
miRNA  3' cuuguCCAU--C--AGACUUGUGACcc 5'
               ||||  |  |:|  ||||||  
Target 5' tgttcGGTATTGTTTTTTTACACTGtg 3'
692 - 718 130.00 -12.10
3
miRNA  3' cuugucCAUCAGAC-UUGUGACcc 5'
                ||  |:|| |:|||||  
Target 5' atttttGTCTTTTGTAGCACTGat 3'
599 - 622 121.00 -8.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-199a-5p :: SMARCA2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions MDA-MB-435 , 293FT
Location of target site 3'UTR
Tools used in this research PicTar
Original Description (Extracted from the article) ... Either miR-199a-5p or miR-199a-3p targets Brm mRNA. ...

- Sakurai, K. Furukawa, C. Haraguchi, T. et al., 2011, Cancer research.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cuuGUCCAUCAG---ACUUGUGACCc 5'
             ||  | |||   | ::|||||| 
Target 5' guuCAUUUUGUCAUAUAGGCACUGGg 3'
7 - 32
Article - Sakurai, K. Furukawa, C. Haraguchi, T. et al.
- Cancer research, 2011
The chromatin remodeling complex SWI/SNF is an important epigenetic regulator that includes one Brm or BRG1 molecule as catalytic subunit. Brm and BRG1 do not function identically, so this complex can regulate gene expression either positively or negatively, depending on the promoter to which it is recruited. Notably, Brm attenuation due to posttranscription suppression occurs often in human tumor cells, in which this event contributes to their oncogenic potential. Here, we report that the 3'-untranslated region of Brm mRNA has two sites that are efficiently targeted by the microRNAs miR-199a-5p and -3p, revealing a novel mechanism for modulation of Brm-type SWI/SNF activity. Computational mapping of the putative promoter region of miR-199a-2 (miPPR-199a-2) has defined it as the major contributing genetic locus for miR-199a-5p and-3p production in these tumor cell lines. We validated this predicted region by direct promoter analysis to confirm that Egr1 is a strong positive regulator of the miR-199a-2 gene. Importantly, we also showed that Egr1, miR-199a-5p, and miR-199a-3p are expressed at high levels in Brm-deficient tumor cell lines but only marginally in Brm-expressing tumor cells. Finally, we also obtained evidence that Brm negatively regulates Egr1. Together, our results reveal that miR-199a and Brm form a double-negative feedback loop through Egr1, leading to the generation of these two distinct cell types during carcinogenesis. This mechanism may offer a partial explanation for why miR-199a-5p and -3p have been reported to be either upregulated or downregulated in a variety of tumors. Cancer Res; 71(5); 1680-9. (c)2010 AACR.
LinkOut: [PMID: 21189327]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
24 hsa-miR-199a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003809 EZH2 enhancer of zeste homolog 2 (Drosophila) 2 1
MIRT003828 IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 4 1
MIRT003963 CCNL1 cyclin L1 2 2
MIRT004325 LIF leukemia inhibitory factor (cholinergic differentiation factor) 2 1
MIRT004391 JUNB jun B proto-oncogene 2 1
MIRT004393 MED6 mediator complex subunit 6 2 1
MIRT004395 MECP2 methyl CpG binding protein 2 (Rett syndrome) 2 1
MIRT004398 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 2 1
MIRT004674 DDR1 discoidin domain receptor tyrosine kinase 1 3 1
MIRT005432 EDN1 endothelin 1 2 1
MIRT005873 MAP3K11 mitogen-activated protein kinase kinase kinase 11 3 1
MIRT006138 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 3 1
MIRT006193 SOX9 SRY (sex determining region Y)-box 9 1 1
MIRT006561 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 3 1
MIRT006786 CD44 CD44 molecule (Indian blood group) 1 1
MIRT006832 TMEM54 transmembrane protein 54 2 1
MIRT007013 SMAD4 SMAD family member 4 1 2
MIRT007036 SULT1E1 sulfotransferase family 1E, estrogen-preferring, member 1 1 1
MIRT007061 GPR78 G protein-coupled receptor 78 1 1
MIRT007265 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 1 1
MIRT007303 UNG uracil-DNA glycosylase 1 1
MIRT026024 ALOX5AP arachidonate 5-lipoxygenase-activating protein 1 1
MIRT035548 CAV1 caveolin 1, caveolae protein, 22kDa 1 1
MIRT052646 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 2 1