Accession ID: MIRT006602 [miRNA, hsa-miR-1826 :: CTNNB1, target gene]
miRNA Infomation
miRNA namehsa-miR-1826
Gene Information
Gene Symbol CTNNB1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CTNNB, DKFZp686D02253, FLJ25606, FLJ37923
Description catenin (cadherin-associated protein), beta 1, 88kDa
Transcript NM_0019    LinkOut: [ RefSeq ]
Other Transcripts NM_0010982 , NM_0010982   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTNNB1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTNNB1
(miRNA target sites are highlighted)
>CTNNB1|NM_0019|3'UTR
   1 TAAATCATCCTTTAGGTAAGAAGTTTTAAAAAGCCAGTTTGGGTAAAATACTTTTACTCTGCCTACAGAACTTCAGAAAG
  81 ACTTGGTTGGTAGGGTGGGAGTGGTTTAGGCTATTTGTAAATCTGCCACAAAAACAGGTATATACTTTGAAAGGAGATGT
 161 CTTGGAACATTGGAATGTTCTCAGATTTCTGGTTGTTATGTGATCATGTGTGGAAGTTATTAACTTTAATGTTTTTTGCC
 241 ACAGCTTTTGCAACTTAATACTCAAATGAGTAACATTTGCTGTTTTAAACATTAATAGCAGCCTTTCTCTCTTTATACAG
 321 CTGTATTGTCTGAACTTGCATTGTGATTGGCCTGTAGAGTTGCTGAGAGGGCTCGAGGGGTGGGCTGGTATCTCAGAAAG
 401 TGCCTGACACACTAACCAAGCTGAGTTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGG
 481 AGTAACAATACAAATGGATTTTGGGAGTGACTCAAGAAGTGAAGAATGCACAAGAATGGATCACAAGATGGAATTTATCA
 561 AACCCTAGCCTTGCTTGTTAAATTTTTTTTTTTTTTTTTTTAAGAATATCTGTAATGGTACTGACTTTGCTTGCTTTGAA
 641 GTAGCTCTTTTTTTTTTTTTTTTTTTTTTTTTGCAGTAACTGTTTTTTAAGTCTCTCGTAGTGTTAAGTTATAGTGAATA
 721 CTGCTACAGCAATTTCTAATTTTTAAGAATTGAGTAATGGTGTAGAACACTAATTCATAATCACTCTAATTAATTGTAAT
 801 CTGAATAAAGTGTAACAATTGTGTAGCCTTTTTGTATAAAATAGACAAATAGAAAATGGTCCAATTAGTTTCCTTTTTAA
 881 TATGCTTAAAATAAGCAGGTGGATCTATTTCATGTTTTTGATCAAAAACTATTTGGGATATGTATGGGTAGGGTAAATCA
 961 GTAAGAGGTGTTATTTGGAACCTTGTTTTGGACAGTTTACCAGTTGCCTTTTATCCCAAAGTTGTTGTAACCTGCTGTGA
1041 TACGATGCTTCAAGAGAAAATGCGGTTATAAAAAATGGTTCAGAATTAAACTTTTAATTCATTCGATTG
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1826 :: CTNNB1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions J82 , T24
Location of target site 3'UTR
Tools used in this research microRNA.org , miRDB
Original Description (Extracted from the article) ... MicroRNA-1826 targets VEGFC, beta-catenin (CTNNB1) and MEK1 (MAP2K1) in human bladder cancer ...

- Hirata, H. Hinoda, Y. Ueno, K. Shahryari, et al., 2012, Carcinogenesis.

Article - Hirata, H. Hinoda, Y. Ueno, K. Shahryari, et al.
- Carcinogenesis, 2012
The Wnt/beta-catenin (CTNNB1) and Ras-Raf-MEK-ERK signaling pathway play an important role in bladder cancer (BC) progression. Tumor-suppressive microRNAs (miRNAs) targeting these cancer pathways may provide a new therapeutic approach for BC. We initially identified miRNA-1826 potentially targeting CTNNB1, VEGFC and MEK1 using several target scan algorithms. Also 3' untranslated region luciferase activity and protein expression of these target genes were significantly downregulated in miR-1826-transfected BC cells (J82 and T24). The expression of miR-1826 was lower in BC tissues and inverse correlation of miR-1826 with several clinical parameters (pT, grade) was observed. Also the expression of miR-1826 was much lower in three BC cell lines (J82, T24 and TCCSUP) compared with a normal bladder cell line (SV-HUC-1). We then performed analyses to look at miR-1826 function and found that miR-1826 inhibited BC cell viability, invasion and migration. We also found increased apoptosis and G(1) cell cycle arrest in miR-1826-transfected BC cells. To examine whether the effect of miR-1826 was through CTNNB1 (beta-catenin) or MEK1 knockdown, we knocked down CTNNB1/MEK1 messenger RNA using a small interfering RNA (siRNA) technique. We observed that CTNNB1 or MEK1 siRNA knockdown resulted in effects similar to those with miR-1826 in BC cells. In conclusion, our data suggest that the miR-1826 plays an important role as tumor suppressor via CTNNB1/MEK1/VEGFC downregulation in BC.
LinkOut: [PMID: 22049531]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1826 :: CTNNB1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions CAKI-1 , 786-O , A-498
Location of target site 3'UTR
Tools used in this research microRNA.org , miRDB , TargetScan
Original Description (Extracted from the article) ... These results suggest that CTNNB1 and MEK1 mRNAs are target oncogenes of miR-1826. ...

- Hirata, H. Hinoda, Y. Ueno, K. Nakajima, K. et al., 2012, Carcinogenesis.

Article - Hirata, H. Hinoda, Y. Ueno, K. Nakajima, K. et al.
- Carcinogenesis, 2012
The aim of this project is to identify new therapeutic microRNAs (miRNAs) for von Hippel-Lindau (VHL)-inactivated renal cancer cells. We initially identified several potential miRNAs targeting CTNNB1 and MEK1 using several targets scan algorithms. Only miR-1826 was found to target CTNNB1 and MEK1. Therefore, we focused on miRNA-1826 and performed 3' untranslated region (UTR) luciferase assay, functional analyses and association study between miR-1826 expression and renal cancer patient outcomes. miR-1826 expression was significantly lower in renal cancer tissues compared with non-neoplastic areas and lower expression was significantly associated with overall shorter survival and earlier recurrence after radical nephrectomy. Following miR-1826 transfection, 3' UTR luciferase activity and protein expression of beta-catenin and MEK1 were significantly downregulated in renal cancer cells. Introduction of miR-1826 also inhibited renal cancer cell proliferation, invasion and migration. Additionally, miR-1826 promoted apoptosis and G(1) arrest in VHL-inactivated renal cancer cells. Knockdowns of CTNNB1 and MEK1 by small interfering RNAs reproduced the tumor-suppressive effect of miR-1826. Our data suggest that the miR-1826 plays an important role as a tumor suppressor by downregulating beta-catenin and MEK1 in VHL-inactivated renal cancers.
LinkOut: [PMID: 22180573]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
3 hsa-miR-1826 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006601 MAP2K1 mitogen-activated protein kinase kinase 1 2 2
MIRT006602 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 2 2
MIRT006603 VEGFC vascular endothelial growth factor C 2 1