Accession ID: MIRT006857 [miRNA, hsa-miR-203a :: TNF, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-203aLinkOut: [miRBase ]
Description Homo sapiens miR-203a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-203a
Mature Sequence 65| GUGAAAUGUUUAGGACCACUAG |86
Evidence Experimental
Experiments Cloned
Putative hsa-miR-203a Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TNF LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DIF, TNF-alpha, TNFA, TNFSF2
Description tumor necrosis factor
Transcript NM_0005    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TNF LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TNF
(miRNA target sites are highlighted)
>TNF|NM_0005|3'UTR
   1 TGAGGAGGACGAACATCCAACCTTCCCAAACGCCTCCCCTGCCCCAATCCCTTTATTACCCCCTCCTTCAGACACCCTCA
  81 ACCTCTTCTGGCTCAAAAAGAGAATTGGGGGCTTAGGGTCGGAACCCAAGCTTAGAACTTTAAGCAACAAGACCACCACT
 161 TCGAAACCTGGGATTCAGGAATGTGTGGCCTGCACAGTGAAGTGCTGGCAACCACTAAGAATTCAAACTGGGGCCTCCAG
 241 AACTCACTGGGGCCTACAGCTTTGATCCCTGACATCTGGAATCTGGAGACCAGGGAGCCTTTGGTTCTGGCCAGAATGCT
 321 GCAGGACTTGAGAAGACCTCACCTAGAAATTGACACAAGTGGACCTTAGGCCTTCCTCTCTCCAGATGTTTCCAGACTTC
 401 CTTGAGACACGGAGCCCAGCCCTCCCCATGGAGCCAGCTCCCTCTATTTATGTTTGCACTTGTGATTATTTATTATTTAT
 481 TTATTATTTATTTATTTACAGATGAATGTATTTATTTGGGAGACCGGGGTATCCTGGGGGACCCAATGTAGGAGCTGCCT
 561 TGGCTCAGACATGTTTTCCGTGAAAACGGAGCTGAACAATAGGCTGTTCCCATGTAGCCCCCTGGCCTCTGTGCCTTCTT
 641 TTGATTATGTTTTTTAAAATATTTATCTGATTAAGTTGTCTAAACAATGCTGATTTGGTGACCAACTGTCACTCATTGCT
 721 GAGCCTCTGCTCCCCAGGGGAGTTGTGTCTGTAATCGCCCTACTATTCAGTGGCGAGAAATAAAGTTTGCTTAGAAAAGA
 801 A
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaucaccAGGAUUUGUAAAGug 5'
                 ||| |:|::||||  
Target 5' tcctctcTCC-AGATGTTTCca 3'
374 - 394 106.00 -6.50
2
miRNA  3' gaUCACCAGGAUUUGUAAAGug 5'
            ||| || ||||||| | |  
Target 5' taAGTTGT-CTAAACAATGCtg 3'
672 - 692 95.00 -7.51
3
miRNA  3' gaucACCAGGAUUUGUAAAGug 5'
              ||| |: |:|||| |:  
Target 5' gcctTGG-CTCAGACATGTTtt 3'
557 - 577 93.00 -5.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-203a :: TNF    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions HEK293
Location of target site 3'UTR
Tools used in this research PicTar , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... SOCS6, TNFa, and IL24 mRNA transcripts are direct targets of miR- 203 ...

- Primo, M. N. Bak, R. O. Schibler, B. et al., 2012, Cytokine.

Article - Primo, M. N. Bak, R. O. Schibler, B. et al.
- Cytokine, 2012
Cutaneous homeostasis and innate immunity is procured by a complex circuitry of intercellular cytokine signaling. MicroRNAs are important posttranscriptional regulators of keratinocyte gene expression and assist in modulating the fine balance between cell proliferation and differentiation in skin. A characteristic microRNA profile in inflammatory skin suggests putative functions of microRNAs in perturbed cytokine production and signaling during chronic inflammatory skin conditions such as psoriasis. It remains unclear, however, why certain microRNAs are aberrantly expressed during skin inflammation and if they serve pro- and/or anti-inflammatory functions. In this report, we focus on cytokine regulation by microRNA-203 (miR-203), which is highly abundant in keratinocytes and upregulated in psoriatic lesions. By screening a panel of cytokines that are upregulated in psoriatic skin for regulation by miR-203, we identify the genes encoding the pro-inflammatory cytokines TNFalpha and IL24 as direct targets of miR-203. Studies of miR-203 overexpression, inhibition, and mutagenesis validate posttranscriptional regulation of TNFalpha and IL24 by miR-203 in cell lines and primary keratinocytes. Our findings suggest that miR-203 serves to fine-tune cytokine signaling and may dampen skin immune responses by repressing key pro-inflammatory cytokines.
LinkOut: [PMID: 22917968]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
32 hsa-miR-203a Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000947 UVRAG UV radiation resistance associated gene 1 1
MIRT003032 ABL1 c-abl oncogene 1, receptor tyrosine kinase 2 2
MIRT004248 TP63 tumor protein p63 4 2
MIRT004713 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 4 1
MIRT004723 CDK6 cyclin-dependent kinase 6 4 1
MIRT005062 SOCS3 suppressor of cytokine signaling 3 5 3
MIRT005453 BCL2L2 BCL2-like 2 4 1
MIRT005684 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT005747 GDAP1 ganglioside-induced differentiation-associated protein 1 2 1
MIRT005749 EDNRA endothelin receptor type A 3 1
MIRT005750 EYA4 eyes absent homolog 4 (Drosophila) 3 1
MIRT006035 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT006036 BMI1 BMI1 polycomb ring finger oncogene 4 2
MIRT006037 RUNX2 runt-related transcription factor 2 3 1
MIRT006038 SMAD4 SMAD family member 4 3 1
MIRT006039 E2F1 E2F transcription factor 1 3 1
MIRT006040 MMP10 matrix metallopeptidase 10 (stromelysin 2) 3 1
MIRT006041 DLX5 distal-less homeobox 5 3 1
MIRT006061 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT006062 MMP1 matrix metallopeptidase 1 (interstitial collagenase) 1 1
MIRT006104 AKT2 v-akt murine thymoma viral oncogene homolog 2 2 1
MIRT006256 BIRC5 baculoviral IAP repeat-containing 5 2 2
MIRT006268 E2F3 E2F transcription factor 3 1 1
MIRT006269 ZNF148 zinc finger protein 148 1 1
MIRT006496 CREB1 cAMP responsive element binding protein 1 2 1
MIRT006684 TJP2 tight junction protein 2 (zona occludens 2) 2 1
MIRT006856 SOCS6 suppressor of cytokine signaling 6 1 1
MIRT006857 TNF tumor necrosis factor 1 1
MIRT006858 IL24 interleukin 24 1 1
MIRT007227 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT007353 CBLL1 Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1 2 1
MIRT007368 MYD88 myeloid differentiation primary response gene (88) 3 1