Accession ID: MIRT006924 [miRNA, hsa-miR-10b-5p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-10bLinkOut: [miRBase ]
Synonyms MIRN10B, hsa-mir-10b, miRNA10B, mir-10b, MIR10B
Description Homo sapiens miR-10b stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-10b-5p
Mature Sequence 27| UACCCUGUAGAACCGAAUUUGUG |49
Evidence Experimental
Experiments Cloned
Putative hsa-miR-10b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description Notch homolog 1, translocation-associated (Drosophila)
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 TAAACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCC
  81 GACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTAT
 161 GTACTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCT
 241 ATTCTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATAT
 321 AAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGA
 401 AGGGAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCA
 481 AGCCAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCT
 561 CACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTT
 641 AGATGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCAT
 721 GAATCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCC
 801 CCCTGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACA
 881 CGGAGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACA
 961 GTGTCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTC
1041 CCGTGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCC
1121 CGCAGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTT
1201 GGGAGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTT
1281 TGTTTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCC
1361 TTAGCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGG
1441 CCGCGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTG
1521 TAGTTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACT
1601 GATTTGCAATAAAAATGATACTGATGGTGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-10b-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions U87-2M1
Original Description (Extracted from the article) ... miRNA-10b’s target genes HOXD10, NOTCH1, TP53 and PAX6 regulate invasiveness of U87-2M1 glioma cells ...

- Lin, J. Teo, S. Lam, D. H. Jeyaseelan, K. Wang, S., 2012, Cell Death Dis.

Article - Lin, J. Teo, S. Lam, D. H. Jeyaseelan, K. Wang, S.
- Cell Death Dis, 2012
Glioblastoma multiforme (GBM) is a heterogeneous disease despite its seemingly uniform pathology. Deconvolution of The Cancer Genome Atlas's GBM gene expression data has unveiled the existence of distinct gene expression signature underlying discrete GBM subtypes. Recent conflicting findings proposed that microRNA (miRNA)-10b exclusively regulates glioma growth or invasion but not both. We showed that silencing of miRNA-10b by baculoviral decoy vectors in a glioma cell line resembling the mesenchymal subtype of GBM reduces its growth, invasion and angiogenesis while promoting apoptosis in vitro. In an orthotopic human glioma mouse model, inhibition of miRNA-10b diminishes the invasiveness, angiogenicity and growth of the mesenchymal subtype-like glioma cells in the brain and significantly prolonged survival of glioma-bearing mice. We demonstrated that the pleiotropic nature of miRNA-10b was due to its suppression of multiple tumor suppressors, including TP53, FOXO3, CYLD, PAX6, PTCH1, HOXD10 and NOTCH1. In particular, siRNA-mediated knockdown experiments identified TP53, PAX6, NOTCH1 and HOXD10 as invasion regulatory genes in our mesenchymal subtype-like glioma cells. By interrogating the REMBRANDT, we noted that dysregulation of many direct targets of miRNA-10b was associated with significantly poorer patient survival. Thus, our study uncovers a novel role for miRNA-10b in regulating angiogenesis and suggests that miRNA-10b may be a pleiotropic regulator of gliomagenesis.
LinkOut: [PMID: 23034333]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
124 hsa-miR-10b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002021 HOXD10 homeobox D10 3 5
MIRT003216 KLF4 Kruppel-like factor 4 (gut) 3 1
MIRT005068 PPARA peroxisome proliferator-activated receptor alpha 4 1
MIRT005455 NCOR2 nuclear receptor corepressor 2 3 1
MIRT005504 NF1 neurofibromin 1 4 1
MIRT006294 PIEZO1 family with sequence similarity 38, member A 1 1
MIRT006366 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 1
MIRT006367 TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) 2 1
MIRT006368 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 3 2
MIRT006369 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2 1
MIRT006538 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT006539 SRSF1 splicing factor, arginine/serine-rich 1 1 1
MIRT006923 TP53 tumor protein p53 1 1
MIRT006924 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 1 1
MIRT006925 PAX6 paired box 6 1 1
MIRT007026 MAPRE1 microtubule-associated protein, RP/EB family, member 1 1 1
MIRT007072 SDC1 syndecan 1 1 1
MIRT025586 NR4A3 nuclear receptor subfamily 4, group A, member 3 1 1
MIRT025587 NRP2 neuropilin 2 1 1
MIRT047400 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT047401 LEMD3 LEM domain containing 3 1 1
MIRT047402 EXTL3 exostoses (multiple)-like 3 1 1
MIRT047403 TXNDC16 thioredoxin domain containing 16 1 1
MIRT047404 STK33 serine/threonine kinase 33 1 1
MIRT047405 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047406 GBAS glioblastoma amplified sequence 1 1
MIRT047407 COPS5 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) 1 1
MIRT047408 ADRA1B adrenergic, alpha-1B-, receptor 1 1
MIRT047409 RTKN2 rhotekin 2 1 1
MIRT047410 COL6A2 collagen, type VI, alpha 2 1 1
MIRT047411 ZNF318 zinc finger protein 318 1 1
MIRT047412 INHBA inhibin, beta A 1 1
MIRT047413 SYT11 synaptotagmin XI 1 1
MIRT047414 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT047415 IGSF1 immunoglobulin superfamily, member 1 1 1
MIRT047416 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047417 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 1 1
MIRT047418 APLNR apelin receptor 1 1
MIRT047419 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT047420 SLC25A30 solute carrier family 25, member 30 1 1
MIRT047421 CAMSAP3 KIAA1543 1 1
MIRT047422 XPO7 exportin 7 1 1
MIRT047423 STT3A STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) 1 1
MIRT047424 UROD uroporphyrinogen decarboxylase 1 1
MIRT047425 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047426 GLB1L3 galactosidase, beta 1-like 3 1 1
MIRT047427 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT047428 CLPTM1 cleft lip and palate associated transmembrane protein 1 1 1
MIRT047429 FAM13A family with sequence similarity 13, member A 1 1
MIRT047430 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT047431 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT047432 KIF21A kinesin family member 21A 1 1
MIRT047433 HK1 hexokinase 1 1 1
MIRT047434 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047435 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT047436 HIST1H2AL histone cluster 1, H2al 1 1
MIRT047437 ARFGEF1 ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) 1 1
MIRT047438 RUNDC3B RUN domain containing 3B 1 1
MIRT047439 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT047440 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT047441 SCMH1 sex comb on midleg homolog 1 (Drosophila) 1 1
MIRT047442 LRRC59 leucine rich repeat containing 59 1 1
MIRT047443 ERLIN1 ER lipid raft associated 1 1 1
MIRT047444 FUT6 fucosyltransferase 6 (alpha (1,3) fucosyltransferase) 1 1
MIRT047445 CDK2 cyclin-dependent kinase 2 1 1
MIRT047446 DDHD2 DDHD domain containing 2 1 1
MIRT047447 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT047448 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT047449 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047450 ACLY ATP citrate lyase 1 1
MIRT047451 PARL presenilin associated, rhomboid-like 1 1
MIRT047452 DIAPH2 diaphanous homolog 2 (Drosophila) 1 1
MIRT047453 RPS9 ribosomal protein S9 1 1
MIRT047454 FASN fatty acid synthase 1 1
MIRT047455 ESYT1 extended synaptotagmin-like protein 1 1 1
MIRT047456 TENM3 odz, odd Oz/ten-m homolog 3 (Drosophila) 1 1
MIRT047457 GRINA glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 1 1
MIRT047458 TUBA1B tubulin, alpha 1b 1 1
MIRT047459 CDK12 cyclin-dependent kinase 12 1 1
MIRT047460 PPP3CB protein phosphatase 3, catalytic subunit, beta isozyme 1 1
MIRT047461 RPS8 ribosomal protein S8 1 1
MIRT047462 ATG13 KIAA0652 1 1
MIRT047463 PIK3CD phosphoinositide-3-kinase, catalytic, delta polypeptide 1 1
MIRT047464 C9orf114 chromosome 9 open reading frame 114 1 1
MIRT047465 PLA2G4F phospholipase A2, group IVF 1 1
MIRT047466 USP3 ubiquitin specific peptidase 3 1 1
MIRT047467 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT047468 DMWD dystrophia myotonica, WD repeat containing 1 1
MIRT047469 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047470 RGP1 RGP1 retrograde golgi transport homolog (S. cerevisiae) 1 1
MIRT047471 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047472 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT047473 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT047474 SURF6 surfeit 6 1 1
MIRT047475 GLOD4 glyoxalase domain containing 4 1 1
MIRT047476 PRMT7 protein arginine methyltransferase 7 1 1
MIRT047477 MSTO1 misato homolog 1 (Drosophila) 1 1
MIRT047478 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT047479 EPHA4 EPH receptor A4 1 1
MIRT047480 ACTG1 actin, gamma 1 1 1
MIRT047481 KIAA0100 KIAA0100 1 1
MIRT047482 TSPAN33 tetraspanin 33 1 1
MIRT047483 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT047484 THUMPD1 THUMP domain containing 1 1 1
MIRT047485 DLAT dihydrolipoamide S-acetyltransferase 1 1
MIRT047486 LRP3 low density lipoprotein receptor-related protein 3 1 1
MIRT047487 AASDH aminoadipate-semialdehyde dehydrogenase 1 1
MIRT047488 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT047489 RBM17 RNA binding motif protein 17 1 1
MIRT047490 GK glycerol kinase 1 1
MIRT047491 LMF2 lipase maturation factor 2 1 1
MIRT047492 CHPF2 chondroitin polymerizing factor 2 1 1
MIRT047493 CTBP1 C-terminal binding protein 1 1 1
MIRT047494 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT047495 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT047496 RALBP1 ralA binding protein 1 1 1
MIRT047497 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT047498 LSS lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) 1 1
MIRT047499 NPTX1 neuronal pentraxin I 1 1
MIRT047500 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT047501 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT047502 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT047503 PSMD13 proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 1 1
MIRT047504 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1