Accession ID: MIRT006978 [miRNA, hsa-miR-182-5p :: CYLD, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-182LinkOut: [miRBase ]
Description Homo sapiens miR-182 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-182-5p
Mature Sequence 23| UUUGGCAAUGGUAGAACUCACACU |46
Evidence Experimental
Experiments Cloned
Putative hsa-miR-182-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CYLD LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDMT, CYLD1, CYLDI, EAC, FLJ20180, FLJ31664, FLJ78684, KIAA0849, MFT, MFT1, SBS, TEM, USPL2
Description cylindromatosis (turban tumor syndrome)
Transcript NM_0010423    LinkOut: [ RefSeq ]
Other Transcripts NM_0010424 , NM_0152   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CYLD LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CYLD
(miRNA target sites are highlighted)
>CYLD|NM_0010423|3'UTR
   1 TAACTGGGGTCATCGGGAAAGGCAAAGAAACTGAAGGCAGAGTCCTAACGTTGCATCTTATTCGAGCTGGCAGTTCTGTT
  81 CACGTCCATTGCCGGCAATGGATGTCTTTGTGGTGATGATCCTTCAGAAAAGGATGCCTCTGTTTAAAAACAAATTGCTT
 161 TTGTGTCCCTGAAGTATTTAATAAGAAGCATTTTGCACTCTAGAAAGTATGTTTGTGTTGGTTTTTTAAGAAGTCTAAAT
 241 GAAGTTATTAATACCTGAAGCTTTAAGTTAAGTGCATTGATCATATGATATTTTTGGAAGCATACAATTTTAATTGTGGA
 321 AGTTTAAAGCCTCTTTTAGTCCATTGAGAATGTAAATAAATGTGTCTTCTTTATGGACCAAGGATATGAAATCATTTTTC
 401 TTTTGTAGCTAACGGTTGCCTTGAGGAAGAAATAATTTGGTTTTATTAAGAGTCTACTCTCAATCCAGTTATTAGAGATG
 481 TACTGAGTTTGATTTGTTAATCCTTTCTATATACTGCTGATCTTGCATGTCTACAATCTGCTCAGTTTTTCTGTGTTTCT
 561 GCAATAGTGGTCAGAAAAATACTTAAATTCCCTTAATGGTGTTGTTTTCTATTTGTTCTGGTTTTGAGATAAATGAGTGA
 641 TTCTGTCCCCAAATGTCCATTTTTGAAGTGATTTTCCTGGAGGATTAGGGTATTTAGCAGTTGAAGCTCTTCATTCATAG
 721 TAGTTACTGTCAGCTAACAGGTTTTTTAAGGCTTTTAACTATTAATATTTTATGGAATGGGGCAAAGTAAATTGATGAAA
 801 GAATTGGAGTGATAATAGTCCTTTACAAACATACAGTCCATAAGAAAATGAATTTGGCATATAGAATTATTACAATTTCC
 881 TGGGAGAGATGGATATTTAAACCTCTATTATTTTAGACAAGACTGTCTAGAACTTAAGTTTGATCTGTCAGCCAGTACTC
 961 CCATTAAATTCAGTGTAGTTTCACTTGATAGAATCAGATATGTTATCGAAATGTTAGCAGCAGCTTCATCCTCCTTCTGA
1041 TTAAAGTAAGTAGAAATGGGATGTTTTGTTTAATAACAGCCATAGTGTGTGTTTAGACCACAGCGGATGTTGTAGACCAG
1121 GACCATAGATGATACATGTCAGTGCTGTGGAATGTGCATTCTCTGAGTGTTGTTTTGTGGTATCATTGTCTTTCCTGAAT
1201 GACTTTCTAACTGTGCAGAAAGGCAGAAAAGTCATCATATGTATATGTCATATGACTTTATAAAATATTTAATGTGACAA
1281 AAAGTGGAAAGAATCTTTACAAACCCTGCAATTACTTTTTTAAAGGCACTTTTACTCTTTGGTTTTATCATTCCATTTTG
1361 CTAATATTTACTAGCTTTATAAATTACAGTAAGGTACAAAAACTCATCTTGTAATATTTTCATTTTTGAAGTGAAAAAGT
1441 ACATATATTTTGCACAAGGTTTTATACTGCTAAGTGCTTGGTTGGGGTGGTGAGATGATGATTAGATCAGGGGTGAGGCT
1521 GAGAGACTCTGGGTTTAGGGCTAGCCCTGCCTCCATCTCCCTTGGGTAAAATGAAGGGTGTGGGGTAAAAGATGCATAAG
1601 GCCTTTTCTAGCTCTGACAGCCTAGAAGTCCAATCACCCTGTAATAAATATGTGTTGAATGAAGAAATGGGTGAATGAGC
1681 TTGTCAATGTGATTTTAAAAAATTGACTACCTGGAGGAATGATTAGGAATCTAAATGAAGCCAGCCCTCGGTATCTGCAG
1761 GTTTCTCATCCATGGATTCAACCAACTGCAAATGGAAAATACGATTTTTTTTAAAAAAAGGATGGTTACATCCGTATTGA
1841 ACATGTACAGACTTTTTTCTTGTCATTATTCTCTGAACAATACAAGAACTCTTTATGTAGCATTTACATTTATTAGGTAT
1921 TATAAGTAATCTAGAGATTATTTAATTAAAATATACAGGAGGATGTGTGTCAGTTATATGCAAATTCTGTACCATTTTGT
2001 ATCAGGGAATTGAGCATCTTCAGATGTTGGTATCTGCAGGGATCCTGGAACCAAACCCCTGCAGATACTAAGGGCTGACG
2081 ATCTAGGTAAGACTGGATTTAACAGTTGGAAAAAAAAAAAAAAAAGGAGAGAGAAGACAGTTCCTTTCCTGTAGAAATTA
2161 AAACAAAATACAAATTGAGGAAGCTCTGCTACCCAGGCTGTCATGGTAGAGAACTTGAAGAAGACCTGTTTGGATGGACA
2241 CCTGGTTTCAAAAGTCAGGTGTGGAGACTGTTAAATGGGAGGGCCTCATCCATAAATGATTTCTGGCAACGTCTTCTTCA
2321 GGTGGAGCTTGACGTCTTTTTAATGTTACTTGGGGAGGGAGTGCTCATTAAGGGATGCCAGGGCCAGCTCTGGTGGTTCC
2401 TGGGGAGGCTGCGTCCTTCCCTGCTTCTGCATGTCATGAGGCAGCAGGAAGGTTTCCCCTGCACCTGTCTGTCCTGGCTC
2481 CCTCTGGGTAGCCCCCTACTGTTCTGTGCTTCAGCACAGCCTGGTTTGTCAAGAGGCACATAGTTGGGGCTGGGCTGCAT
2561 GGCACAGGGGCTTATGTGCCTGCTGGTTATTTAATTTTCAGCCTTAAGTTTTCTTTAATATTTTCCTGTTGGCTATTTAA
2641 AGGTTTTGGTTATCTTTTATTCCTTATCTACAATCAAGATGACAATGTAATTGAATTATCTTATTTATAACACGGTTCGT
2721 GATTCATGATTCATGATTACAAGTAGAAAATATGTCATGTTCCTCACCTCCAAATAAATATGTGTGTGTCTGTGTGTGTG
2801 TATATATGTATGTGGCGGAGAGGGAGAGAGTGGGGAAGGAGAGCAGTGTTATCATACATAGAGAGGCTAAATGTGTCCCA
2881 TCCCTCACTGTCAGCTTTATAAAGGAGTTTGACTCCATCCACAGAAGAATGTTTTATAAGACTAGGAAAACACGTTGAAA
2961 ACTAGGATAAACAGCAACAAAAATCAACTAAATATGTTGTTACTGTTGCTAAGGATTTTCTCCTTAGAATAATTTAGGAT
3041 TTTTAAAAATTTCTGTTTGCCAAATGCTGTAGATAAATGGCCAGATTCTTCCTATCCCTAGGATTCCTTTATTATTTTTT
3121 TTCACAGATTTTGAGAACAAGGGGGAGAGATAGTATGGAAGATTAAGATTCCATTAATCTTATAGAACTGTGTTGTCACC
3201 CAAATTCCTGCTTGTTTGAACATGGCATCTTCATAGATTCAGGATTCACTACCCTCTATAGCTGGATCTTGAAAATTATC
3281 TGGCCAGATAATTTTGCATCTGCTTGGATGATTGTAGACTGAGATGTGAGTGGAGGATAAAGTATTAGACTTTTGCTGAG
3361 TAACTGCCAACCAAGAAGTATTTATCGGACACTTACTAGGTGCCTAGGATTGTATCAGAGGGAATATGAAATGTGTCCCT
3441 GCCCTACCTAGTTTTAACGACAGAATATCTATTAAAGGCTACTTAGCTGAAGGGTAAGGGTGACAGGTCTAGGGGAAGCT
3521 TTGGGAGGTGGTGTGCTGTGACAGAAAAAGTGGCAGAGTAGGGACGAGAGACCTGCATTCTAGCCCTGTTTCTGTCACTT
3601 GCTCTGTACACTTAGACAACAGCTTGACCTCTTGAGCTTTAGTTTCCTCCTCTGCATAATGAGAGGGTTAGACTACTGAA
3681 TTGTATGGGAAAAAAATACAAATTCCTGGGTCCTAGGCCATGCCTGCTGAATCCGACTGTTCAGGAAGAGGCCTAGGAAA
3761 TCTGTGAGGGAATCCCCAGGGGAATCTCGTGACCAGCCAGGTGTGAAATCTGCTAACTGGAAGATCTCAAAGCTTCCTTC
3841 ACTTTTTGTGATTTTGTGGTCATGTAACGTTACTGTATTATTCTACGTAAATGTGGGTACTTGGATGTTTATCATACTGT
3921 TTCTCTGTGTTTACATACTAATTTGTGTAAGAAATGCATTTTAGTCTGTGTACCTCAACCTGCTGTTTGTTTCCTAGAGG
4001 TGTTAGTAGTCTTTAAATACAAGTAAGACTTAAGAGGATATTTGATGTTATTTACCTGGATATTTTCTTCCCCTTTTATT
4081 TATTTAGAGGAAATTGAGATTCTAGGAGCCAAAAAAATGAAAACAAAATTCTAAGGCAAAGTTAAAGAAAAAAATTACAT
4161 TATTTCTTACCATTTGCTACTTTATAATGAAAATTTAAAAATTATATGGGAAGATTTTTCTCTGGGATAACAAATCCTTG
4241 TCATAAAGTAAGAGGTCTTTTTAAAGTAGGTAGGCTATAAGGCCTGTAATTTAAAATAATACTCCTTTCTCTAGGGTTTG
4321 GTGCAATTCTCCATTAATGAAGATAACATTTGAATTCCCCAAAGCAGGTGAGGAGTCGGGGAGGAGAAAGCGATGTTAAA
4401 ATGAAAACTCACTGCAAAAGAGGAGGCAGAGGAAGAAGGAATGTAAACCCCTTAAAGCAGATGTGTGTGGGGCCTTATGA
4481 AGACCAGGATTCTGCGGGTGTCAGGGGATTGCCCCTCTTGACAGAGACTAGGGTTTTAGACTGAGGCTTCCTGCAGGGTG
4561 TTCGCATTGCCCTTCTCCGTTCCCCTTCAGACCTTTCTGGGGAGAAGAGGTGGGAGGAGGGGAGAAAGACTGTTCATCTT
4641 ATTCTGAATCCTGGAGCAGCTGAAGGTTTTCTCTTGAGTCAGGATGCAGTGGTAATGCATTAACCAGCAAGTGTGGCCAA
4721 GGATAATGAAAAAGTGGGAAAGGAAGGTCCTCCTCCTCCCTGATTGTAGCATCCAGCAGTCTCTGTAGCCAGGTTACTCA
4801 AGAACCACATTTGATTTCCTGGCCCTTTGCCTTGGCAGTGATGGCATTTTTATTTCACTGTGTTTTAAAGTCTTCATTTA
4881 TTTTTATAACATGGGTTAGGGAGAAGGGCCACAAATGGAGGGATTGTCCTTTCAAGCACCACAGCTTCAGATAAAATTAG
4961 TACTTTCAAATATTGTCCACTTTAACTTAAAAAATTCTAGAGGGATTATATTGGAGACTCAACTGCCCTTGGTTTTAGTT
5041 TATAAAATGGCCTAGTACTGTGGAATTTTAATTTTAGAAAGTCTTAGCATCAGATCATAAACATTCATTAAAAGAACTCA
5121 CATCCCATCTGAAACTTCCCAGGGGAGTTGGGATTCTTAGTAGATTGGTAGAAAGGGGCTCATTTTCTACTGCATTTCCC
5201 ATTTTTGGTATCTTGTTCAGCATGTTTTATTTTTATTTCTTGTCTGCAGAACATCCTATATTTATGAGAACATTCTTTAA
5281 GAAGACCACCACATAGAATACCCCTTCCTATCAGCTCGCTCTGATTTAGCCTTAATTTTGTTAAATTTTTTAGAGATGAA
5361 TGAAGTGCTGCTGTGGAAAGAAATGTACATATACTATTTCTGTATCATTAAAATTACATTTTTATGGTTCAAAAAAAAAA
5441 AAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-182-5p :: CYLD    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions U373MG , LN229
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... miR-182 targets CYLD. ...

- Song, L. Liu, L. Wu, Z. Li, Y. Ying, Z. et al., 2012, J Clin Invest.

Article - Song, L. Liu, L. Wu, Z. Li, Y. Ying, Z. et al.
- J Clin Invest, 2012
The strength and duration of NF-kappaB signaling are tightly controlled by multiple negative feedback mechanisms. However, in cancer cells, these feedback loops are overridden through unclear mechanisms to sustain oncogenic activation of NF-kappaB signaling. Previously, we demonstrated that overexpression of miR-30e* directly represses IkappaBalpha expression and leads to hyperactivation of NF-kappaB. Here, we report that miR-182 was overexpressed in a different set of gliomas with relatively lower miR-30e* expression and that miR-182 directly suppressed cylindromatosis (CYLD), an NF-kappaB negative regulator. This suppression of CYLD promoted ubiquitin conjugation of NF-kappaB signaling pathway components and induction of an aggressive phenotype of glioma cells both in vitro and in vivo. Furthermore, we found that TGF-beta induced miR-182 expression, leading to prolonged NF-kappaB activation. Importantly, the results of these experiments were consistent with an identified significant correlation between miR-182 levels with TGF-beta hyperactivation and activated NF-kappaB in a cohort of human glioma specimens. These findings uncover a plausible mechanism for sustained NF-kappaB activation in malignant gliomas and may suggest a new target for clinical intervention in human cancer.
LinkOut: [PMID: 23006329]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
68 hsa-miR-182-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000576 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 1
MIRT000671 FOXO3 forkhead box O3 3 2
MIRT001086 FOXO1 forkhead box O1 4 1
MIRT001222 RARG retinoic acid receptor, gamma 3 1
MIRT001990 MITF microphthalmia-associated transcription factor 4 4
MIRT001992 ADCY6 adenylate cyclase 6 3 2
MIRT003145 Mitf microphthalmia-associated transcription factor 3 1
MIRT003601 EP300 E1A binding protein p300 2 1
MIRT005358 CLOCK clock homolog (mouse) 3 1
MIRT005359 TSC22D3 TSC22 domain family, member 3 3 1
MIRT006273 CREB1 cAMP responsive element binding protein 1 1 1
MIRT006300 MTSS1 metastasis suppressor 1 1 3
MIRT006823 FGF9 fibroblast growth factor 9 (glia-activating factor) 2 1
MIRT006824 NTM neurotrimin 2 1
MIRT006978 CYLD cylindromatosis (turban tumor syndrome) 3 1
MIRT007063 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT007064 CCND2 cyclin D2 3 1
MIRT007155 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 3 1
MIRT007199 PFN1 profilin 1 1 1
MIRT007226 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT007293 RECK reversion-inducing-cysteine-rich protein with kazal motifs 3 3
MIRT007306 SMAD4 SMAD family member 4 1 1
MIRT007330 FOXF2 forkhead box F2 1 1
MIRT025033 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT047175 CISD2 CDGSH iron sulfur domain 2 1 1
MIRT047176 BRIP1 BRCA1 interacting protein C-terminal helicase 1 1 1
MIRT047177 RBM12 RNA binding motif protein 12 1 1
MIRT047178 CBX6 chromobox homolog 6 1 1
MIRT047179 FMNL3 formin-like 3 1 1
MIRT047180 RPL5 ribosomal protein L5 1 1
MIRT047181 RCC2 regulator of chromosome condensation 2 1 1
MIRT047182 GNL1 guanine nucleotide binding protein-like 1 1 1
MIRT047183 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 'protein-coding 1 1
MIRT047184 C1orf174 chromosome 1 open reading frame 174 1 1
MIRT047185 RLF rearranged L-myc fusion 1 1
MIRT047186 CASC3 cancer susceptibility candidate 3 1 1
MIRT047187 FLOT1 flotillin 1 1 1
MIRT047188 BAG1 BCL2-associated athanogene 1 1
MIRT047189 RBM15B RNA binding motif protein 15B 1 1
MIRT047190 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT047191 RPS4X ribosomal protein S4, X-linked 1 1
MIRT047192 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT047193 RPS3 ribosomal protein S3 1 1
MIRT047194 APITD1 apoptosis-inducing, TAF9-like domain 1 1 1
MIRT047195 TMEM184C transmembrane protein 184C 1 1
MIRT047196 ETV3 ets variant 3 1 1
MIRT047197 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1
MIRT047198 UBP1 upstream binding protein 1 (LBP-1a) 1 1
MIRT047199 USP16 ubiquitin specific peptidase 16 1 1
MIRT047200 ACVR1B activin A receptor, type IB 1 1
MIRT047201 STAG2 stromal antigen 2 1 1
MIRT047202 RAB3IP RAB3A interacting protein (rabin3) 1 1
MIRT047203 ATP5O ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit 1 1
MIRT047204 SLC25A14 solute carrier family 25 (mitochondrial carrier, brain), member 14 1 1
MIRT047205 TTC28 tetratricopeptide repeat domain 28 1 1
MIRT047206 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT047207 TNKS1BP1 tankyrase 1 binding protein 1, 182kDa 1 1
MIRT047208 ACTN4 actinin, alpha 4 1 1
MIRT047209 TUBA1B tubulin, alpha 1b 1 1
MIRT047210 EVI5 ecotropic viral integration site 5 1 1
MIRT047211 VPS51 chromosome 11 open reading frame 2 1 1
MIRT047212 ANO6 anoctamin 6 1 1
MIRT047213 PCOLCE2 procollagen C-endopeptidase enhancer 2 1 1
MIRT047214 LBR lamin B receptor 1 1
MIRT047215 PIK3C2A phosphoinositide-3-kinase, class 2, alpha polypeptide 1 1
MIRT047216 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT047217 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 1 1
MIRT047218 ATP13A3 ATPase type 13A3 1 1