Accession ID: MIRT007031 [miRNA, hsa-miR-214-3p :: CTNNB1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-214LinkOut: [miRBase ]
Synonyms MIRN214, miRNA214, mir-214, MIR214
Description Homo sapiens miR-214 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-214-3p
Mature Sequence 71| ACAGCAGGCACAGACAGGCAGU |92
Evidence Experimental
Experiments Cloned
Putative hsa-miR-214-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTNNB1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CTNNB
Description catenin (cadherin-associated protein), beta 1, 88kDa
Transcript NM_001904    LinkOut: [ RefSeq ]
Other Transcripts NM_001098210 , NM_001098209   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTNNB1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTNNB1
(miRNA target sites are highlighted)
>CTNNB1|NM_001904|3'UTR
   1 ATCATCCTTTAGGTAAGAAGTTTTAAAAAGCCAGTTTGGGTAAAATACTTTTACTCTGCCTACAGAACTTCAGAAAGACT
  81 TGGTTGGTAGGGTGGGAGTGGTTTAGGCTATTTGTAAATCTGCCACAAAAACAGGTATATACTTTGAAAGGAGATGTCTT
 161 GGAACATTGGAATGTTCTCAGATTTCTGGTTGTTATGTGATCATGTGTGGAAGTTATTAACTTTAATGTTTTTTGCCACA
 241 GCTTTTGCAACTTAATACTCAAATGAGTAACATTTGCTGTTTTAAACATTAATAGCAGCCTTTCTCTCTTTATACAGCTG
 321 TATTGTCTGAACTTGCATTGTGATTGGCCTGTAGAGTTGCTGAGAGGGCTCGAGGGGTGGGCTGGTATCTCAGAAAGTGC
 401 CTGACACACTAACCAAGCTGAGTTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGGAGT
 481 AACAATACAAATGGATTTTGGGAGTGACTCAAGAAGTGAAGAATGCACAAGAATGGATCACAAGATGGAATTTATCAAAC
 561 CCTAGCCTTGCTTGTTAAATTTTTTTTTTTTTTTTTTTAAGAATATCTGTAATGGTACTGACTTTGCTTGCTTTGAAGTA
 641 GCTCTTTTTTTTTTTTTTTTTTTTTTTTTGCAGTAACTGTTTTTTAAGTCTCTCGTAGTGTTAAGTTATAGTGAATACTG
 721 CTACAGCAATTTCTAATTTTTAAGAATTGAGTAATGGTGTAGAACACTAATTCATAATCACTCTAATTAATTGTAATCTG
 801 AATAAAGTGTAACAATTGTGTAGCCTTTTTGTATAAAATAGACAAATAGAAAATGGTCCAATTAGTTTCCTTTTTAATAT
 881 GCTTAAAATAAGCAGGTGGATCTATTTCATGTTTTTGATCAAAAACTATTTGGGATATGTATGGGTAGGGTAAATCAGTA
 961 AGAGGTGTTATTTGGAACCTTGTTTTGGACAGTTTACCAGTTGCCTTTTATCCCAAAGTTGTTGTAACCTGCTGTGATAC
1041 GATGCTTCAAGAGAAAATGCGGTTATAAAAAATGGTTCAGAATTAAACTTTTAATTCATTCGATTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugacgGACAGACA-CGGACGACa 5'
               :||| |||  ||||||| 
Target 5' caaagTTGT-TGTAACCTGCTGt 3'
1014 - 1035 152.00 -16.20
2
miRNA  3' ugacgGACAGACACGGACGAca 5'
               ||| || |||:||||  
Target 5' tggtaCTGACTTTGCTTGCTtt 3'
613 - 634 133.00 -13.90
3
miRNA  3' ugACG-GACA--GACACGGACGACa 5'
            ||| :|||  :|| |||||: | 
Target 5' ctTGCATTGTGATTG-GCCTGTAGa 3'
332 - 355 113.00 -13.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-214-3p :: CTNNB1    [ Functional MTI ]
Validation Method
Article - Xia, H. Ooi, L. L. Hui, K. M.
- PLoS One, 2012
The down-regulation of miR-214 has previously been observed in human hepatocellular carcinoma (HCC). Here, we demonstrated the down-regulation of miR-214 is associated with cell invasion, stem-like traits and early recurrence of HCC. Firstly, we validated the suppression of miR-214 in human HCC by real-time quantitative RT-PCR (qRT-PCR) in 20 paired tumor and non-tumor liver tissues of HCC patients and 10 histologically normal liver tissues from colorectal cancer patients with liver metastases. Further qRT-PCR analysis of 50 HCC tissues from an independent cohort of HCC patients of whom 29 with early recurrent disease (<2 years) and 21 with late recurrent disease demonstrated that the suppression of miR-214 was significantly more suppressed in samples from HCC patients with early recurrent disease compared those from patients with no recurrence. Re-expression of miR-214 significantly suppressed the growth of HCC cells in vitro and reduced their tumorigenicity in vivo. The enhancer of zeste homologue 2 (EZH2) and beta-catenin (CTNNB1) was identified as two potential direct downstream targets of miR-214 through bioinformatics analysis and experimentally validated the miRNA-target interactions with a dual-firefly luciferase reporter assay. In corroborate with this, both EZH2 and CTNNB1 are found to be significantly overexpressed in human HCC biopsies. Since EZH2 can regulate CTNNB1, CTNNB1 can also be an indirect target of miR-214 through EZH2. Silencing EZH2 or CTNNB1 expression suppressed the growth and invasion of HCC cells and induced E-cadherin (CDH1), known to inhibit cell invasion and metastasis. Furthermore, the silencing of miR-214 or overexpression of EZH2 increased EpCAM(+) stem-like cells through the activation of CTNNB1. Interestingly, the up-regulation of EZH2, CTNNB1 and the down-regulation of CDH1 in HCC patients correlated with early recurrent disease and can be an independent predictor of poor survival. Therefore, miR-214 can directly or indirectly target CTNNB1 to modulate the beta-catenin signaling pathway in HCC.
LinkOut: [PMID: 22962603]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-214-3p :: CTNNB1    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions HuH-7 , Hep G2
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... b-catenin is a direct target of miR-214 in HCC cells ...

- Wang, X. Chen, J. Li, F. Lin, Y. Zhang, X. et al., 2012, Biochem Biophys Res Commun.

Article - Wang, X. Chen, J. Li, F. Lin, Y. Zhang, X. et al.
- Biochem Biophys Res Commun, 2012
Mounting evidence has shown that microRNAs (miRNAs) are implicated in carcinogenesis and can function as oncogenes or tumor suppressor genes in human cancers. Recent profile studies of miRNA expression have documented a deregulation of miRNA (miR-214) in hepatocellular carcinoma (HCC). However, its potential functions and underlying mechanisms in hepatocarcinogenesis remain largely unknown. Here, we confirmed that miR-214 is significantly downregulated in HCC cells and specimens. Ectopic overexpression of miR-214 inhibited proliferation of HCC cells in vitro and tumorigenicity in vivo. Further studies revealed that miR-214 could directly target the 3'-untranslated region (3'-UTR) of beta-catenin mRNA and suppress its protein expression. Similar to the restoring miR-214 expression, beta-catenin downregulation inhibited cell growth, whereas restoring the beta-catenin expression abolished the function of miR-214. Moreover, miR-214-mediated reduction of beta-catenin resulted in suppression of several downstream genes including c-Myc, cyclinD1, TCF-1, and LEF-1. These findings indicate that miR-214 serves as tumor suppressor and plays substantial roles in inhibiting the tumorigenesis of HCC through suppression of beta-catenin. Given these, miR-214 may serve as a useful prognostic or therapeutic target for treatment of HCC.
LinkOut: [PMID: 23068095]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
170 hsa-miR-214-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000148 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 5
MIRT000799 PTEN phosphatase and tensin homolog 5 7
MIRT004738 DAPK1 death-associated protein kinase 1 3 1
MIRT005426 MAP2K3 mitogen-activated protein kinase kinase 3 5 1
MIRT005427 MAPK8 mitogen-activated protein kinase 8 5 1
MIRT005551 POU4F2 POU class 4 homeobox 2 4 1
MIRT005765 PLXNB1 plexin B1 5 2
MIRT005811 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 3 1
MIRT006028 ING4 inhibitor of growth family, member 4 2 1
MIRT006375 XBP1 X-box binding protein 1 3 1
MIRT006644 QKI QKI, KH domain containing, RNA binding 1 1
MIRT006731 TWIST1 twist homolog 1 (Drosophila) 3 1
MIRT006816 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 4 2
MIRT006881 TP53 tumor protein p53 1 2
MIRT007031 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 3 2
MIRT007201 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) 1 1
MIRT007294 BCL2L2 BCL2-like 2 3 1
MIRT024958 FLOT1 flotillin 1 2 1
MIRT024959 MAP2K5 mitogen-activated protein kinase kinase 5 2 1
MIRT024960 HSPD1 heat shock 60kDa protein 1 (chaperonin) 2 1
MIRT024961 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 2 1
MIRT024962 CPNE7 copine VII 2 1
MIRT024963 RASA1 RAS p21 protein activator (GTPase activating protein) 1 2 1
MIRT024964 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 2 1
MIRT024965 ARL2 ADP-ribosylation factor-like 2 2 1
MIRT024966 AP3B1 adaptor-related protein complex 3, beta 1 subunit 2 1
MIRT024967 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT035545 PSMD10 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 1 1
MIRT035546 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT053000 MAPK1 mitogen-activated protein kinase 1 3 1
MIRT053190 MAPK14 mitogen-activated protein kinase 14 2 1
MIRT053289 JAG1 jagged 1 3 1
MIRT053786 CCL5 chemokine (C-C motif) ligand 5 2 1
MIRT053795 UBE2I ubiquitin-conjugating enzyme E2I 3 1
MIRT054096 HDGF hepatoma-derived growth factor 4 2
MIRT054638 FGFR1 fibroblast growth factor receptor 1 4 2
MIRT054716 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 3 1
MIRT054876 BCL2L11 BCL2-like 11 (apoptosis facilitator) 3 1
MIRT076137 WDR81 WD repeat domain 81 1 1
MIRT082986 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT098546 TBPL1 TBP-like 1 1 3
MIRT100569 PIM1 pim-1 oncogene 3 2
MIRT108653 ZBTB33 zinc finger and BTB domain containing 33 1 2
MIRT117657 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT152280 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153855 NCOA3 nuclear receptor coactivator 3 1 1
MIRT181245 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT245860 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 2
MIRT277966 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 1 1
MIRT277972 PABPN1 poly(A) binding protein, nuclear 1 1 1
MIRT302826 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT367265 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT393091 CDK6 cyclin-dependent kinase 6 4 4
MIRT437668 ABLIM3 actin binding LIM protein family, member 3 2 1
MIRT437669 DOCK9 dedicator of cytokinesis 9 2 1
MIRT437670 ARHGAP10 Rho GTPase activating protein 10 2 1
MIRT437671 TRPS1 trichorhinophalangeal syndrome I 2 1
MIRT437672 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 2
MIRT437673 RAB5B RAB5B, member RAS oncogene family 2 1
MIRT437674 CAPN5 calpain 5 2 1
MIRT437675 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 2 1
MIRT437676 KIF1B kinesin family member 1B 2 1
MIRT437811 LTF lactotransferrin 1 1
MIRT438012 RAB15 RAB15, member RAS oncogene family 2 1
MIRT438091 POR P450 (cytochrome) oxidoreductase 1 1
MIRT438092 GSR glutathione reductase 1 1
MIRT438124 BAX BCL2-associated X protein 1 1
MIRT438406 CD274 CD274 molecule 2 1
MIRT438676 ALPK2 alpha-kinase 2 3 1
MIRT438677 PAPPA pregnancy-associated plasma protein A, pappalysin 1 3 1
MIRT438741 LZTS1 leucine zipper, putative tumor suppressor 1 3 1
MIRT438815 CADM1 cell adhesion molecule 1 1 1
MIRT442914 PCBD2 pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 1 1
MIRT443631 CPSF2 cleavage and polyadenylation specific factor 2, 100kDa 1 1
MIRT445668 TNFSF15 tumor necrosis factor (ligand) superfamily, member 15 1 1
MIRT448866 FAM49B family with sequence similarity 49, member B 1 1
MIRT451757 LRTM2 leucine-rich repeats and transmembrane domains 2 1 1
MIRT455569 TRAF1 TNF receptor-associated factor 1 1 1
MIRT455847 C9orf78 chromosome 9 open reading frame 78 1 1
MIRT456706 LDB1 LIM domain binding 1 1 1
MIRT457193 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT458051 TSEN54 tRNA splicing endonuclease 54 homolog (S. cerevisiae) 1 1
MIRT459637 GABARAP GABA(A) receptor-associated protein 1 1
MIRT459713 ZNF641 zinc finger protein 641 1 1
MIRT460214 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT462257 LAMA4 laminin, alpha 4 1 1
MIRT465374 TPM3 tropomyosin 3 1 3
MIRT466424 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 4
MIRT466659 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 3
MIRT466847 STX6 syntaxin 6 1 1
MIRT468050 SIK1 salt-inducible kinase 1 1 1
MIRT468079 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 3
MIRT468142 SH3BP4 SH3-domain binding protein 4 1 1
MIRT468371 SETD8 SET domain containing (lysine methyltransferase) 8 1 1
MIRT471522 PCGF3 polycomb group ring finger 3 1 1
MIRT472260 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT472876 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT474648 KLF16 Kruppel-like factor 16 1 1
MIRT474824 KIAA0226 KIAA0226 1 1
MIRT474942 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT475711 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 2
MIRT476269 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 3
MIRT478757 CS citrate synthase 1 1
MIRT479580 CDC42SE1 CDC42 small effector 1 1 1
MIRT480074 CALU calumenin 1 1
MIRT480443 C17orf49 chromosome 17 open reading frame 49 1 1
MIRT480535 C10orf76 chromosome 10 open reading frame 76 1 1
MIRT481483 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT482009 AMER1 family with sequence similarity 123B 1 4
MIRT482366 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT484770 ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 1 2
MIRT484989 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 4
MIRT485026 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT485044 TMEM189 transmembrane protein 189 1 4
MIRT488291 PARS2 prolyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT488503 SFMBT2 Scm-like with four mbt domains 2 1 2
MIRT490235 C9orf3 chromosome 9 open reading frame 3 1 1
MIRT490633 BCAM basal cell adhesion molecule (Lutheran blood group) 1 1
MIRT492577 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT493820 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT494341 CASKIN1 CASK interacting protein 1 1 1
MIRT495138 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT496011 CD180 CD180 molecule 1 1
MIRT504552 ZNF417 zinc finger protein 417 1 3
MIRT506793 KLHL15 kelch-like 15 (Drosophila) 1 3
MIRT507713 CNIH cornichon homolog (Drosophila) 1 1
MIRT507993 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 2
MIRT512511 BTBD19 BTB (POZ) domain containing 19 1 1
MIRT522092 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT522688 LUZP1 leucine zipper protein 1 1 3
MIRT527622 BANP BTG3 associated nuclear protein 1 1
MIRT532199 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT538448 CNNM2 cyclin M2 1 1
MIRT541083 RLIM ring finger protein, LIM domain interacting 1 1
MIRT545364 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT547120 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547316 NPTN neuroplastin 1 1
MIRT547963 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 2
MIRT550758 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT563842 SMDT1 chromosome 22 open reading frame 32 1 1
MIRT565037 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT567665 ERGIC2 ERGIC and golgi 2 1 1
MIRT568571 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT569613 TRIM29 tripartite motif containing 29 1 1
MIRT570838 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT571058 POLQ polymerase (DNA directed), theta 1 1
MIRT610138 FOXI2 forkhead box I2 1 1
MIRT613384 ABCC12 ATP-binding cassette, sub-family C (CFTR/MRP), member 12 1 1
MIRT616463 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618324 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT621584 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT622626 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT631494 RASSF4 Ras association (RalGDS/AF-6) domain family member 4 1 1
MIRT647291 JAG2 jagged 2 1 1
MIRT670695 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 2
MIRT691703 FLOT2 flotillin 2 1 1
MIRT692013 NAP1L4 nucleosome assembly protein 1-like 4 1 1
MIRT698217 TMEM248 transmembrane protein 248 1 1
MIRT703335 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 1 1
MIRT710116 MED23 mediator complex subunit 23 1 1
MIRT711978 HOMER2 homer homolog 2 (Drosophila) 1 1
MIRT714117 TMED9 transmembrane emp24 protein transport domain containing 9 1 1
MIRT718552 PIGQ phosphatidylinositol glycan anchor biosynthesis, class Q 1 1
MIRT719745 SLC39A11 solute carrier family 39 (metal ion transporter), member 11 1 1
MIRT720022 TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) 1 1
MIRT720364 ZBTB8B zinc finger and BTB domain containing 8B 1 1
MIRT721401 LDLRAD4 low density lipoprotein receptor class A domain containing 4 1 1
MIRT721529 DKK3 dickkopf 3 homolog (Xenopus laevis) 1 1
MIRT723091 INSIG1 insulin induced gene 1 1 1
MIRT724670 NCAN neurocan 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*