Accession ID: MIRT007031 [miRNA, hsa-miR-214-3p :: CTNNB1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-214LinkOut: [miRBase ]
Synonyms MIRN214, miRNA214, mir-214, MIR214
Description Homo sapiens miR-214 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-214-3p
Mature Sequence 71| ACAGCAGGCACAGACAGGCAGU |92
Evidence Experimental
Experiments Cloned
Putative hsa-miR-214-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTNNB1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CTNNB, DKFZp686D02253, FLJ25606, FLJ37923
Description catenin (cadherin-associated protein), beta 1, 88kDa
Transcript NM_0019    LinkOut: [ RefSeq ]
Other Transcripts NM_0010982 , NM_0010982   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTNNB1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTNNB1
(miRNA target sites are highlighted)
>CTNNB1|NM_0019|3'UTR
   1 TAAATCATCCTTTAGGTAAGAAGTTTTAAAAAGCCAGTTTGGGTAAAATACTTTTACTCTGCCTACAGAACTTCAGAAAG
  81 ACTTGGTTGGTAGGGTGGGAGTGGTTTAGGCTATTTGTAAATCTGCCACAAAAACAGGTATATACTTTGAAAGGAGATGT
 161 CTTGGAACATTGGAATGTTCTCAGATTTCTGGTTGTTATGTGATCATGTGTGGAAGTTATTAACTTTAATGTTTTTTGCC
 241 ACAGCTTTTGCAACTTAATACTCAAATGAGTAACATTTGCTGTTTTAAACATTAATAGCAGCCTTTCTCTCTTTATACAG
 321 CTGTATTGTCTGAACTTGCATTGTGATTGGCCTGTAGAGTTGCTGAGAGGGCTCGAGGGGTGGGCTGGTATCTCAGAAAG
 401 TGCCTGACACACTAACCAAGCTGAGTTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGG
 481 AGTAACAATACAAATGGATTTTGGGAGTGACTCAAGAAGTGAAGAATGCACAAGAATGGATCACAAGATGGAATTTATCA
 561 AACCCTAGCCTTGCTTGTTAAATTTTTTTTTTTTTTTTTTTAAGAATATCTGTAATGGTACTGACTTTGCTTGCTTTGAA
 641 GTAGCTCTTTTTTTTTTTTTTTTTTTTTTTTTGCAGTAACTGTTTTTTAAGTCTCTCGTAGTGTTAAGTTATAGTGAATA
 721 CTGCTACAGCAATTTCTAATTTTTAAGAATTGAGTAATGGTGTAGAACACTAATTCATAATCACTCTAATTAATTGTAAT
 801 CTGAATAAAGTGTAACAATTGTGTAGCCTTTTTGTATAAAATAGACAAATAGAAAATGGTCCAATTAGTTTCCTTTTTAA
 881 TATGCTTAAAATAAGCAGGTGGATCTATTTCATGTTTTTGATCAAAAACTATTTGGGATATGTATGGGTAGGGTAAATCA
 961 GTAAGAGGTGTTATTTGGAACCTTGTTTTGGACAGTTTACCAGTTGCCTTTTATCCCAAAGTTGTTGTAACCTGCTGTGA
1041 TACGATGCTTCAAGAGAAAATGCGGTTATAAAAAATGGTTCAGAATTAAACTTTTAATTCATTCGATTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugacgGACAGACA-CGGACGACa 5'
               :||| |||  ||||||| 
Target 5' caaagTTGT-TGTAACCTGCTGt 3'
1017 - 1038 152.00 -16.20
2
miRNA  3' ugacgGACAGACACGGACGAca 5'
               ||| || |||:||||  
Target 5' tggtaCTGACTTTGCTTGCTtt 3'
616 - 637 133.00 -13.90
3
miRNA  3' ugACG-GACA--GACACGGACGACa 5'
            ||| :|||  :|| |||||: | 
Target 5' ctTGCATTGTGATTG-GCCTGTAGa 3'
335 - 358 113.00 -13.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-214-3p :: CTNNB1    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions HuH-7 , Hep G2
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... b-catenin is a direct target of miR-214 in HCC cells ...

- Wang, X. Chen, J. Li, F. Lin, Y. Zhang, X. et al., 2012, Biochem Biophys Res Commun.

Article - Wang, X. Chen, J. Li, F. Lin, Y. Zhang, X. et al.
- Biochem Biophys Res Commun, 2012
Mounting evidence has shown that microRNAs (miRNAs) are implicated in carcinogenesis and can function as oncogenes or tumor suppressor genes in human cancers. Recent profile studies of miRNA expression have documented a deregulation of miRNA (miR-214) in hepatocellular carcinoma (HCC). However, its potential functions and underlying mechanisms in hepatocarcinogenesis remain largely unknown. Here, we confirmed that miR-214 is significantly downregulated in HCC cells and specimens. Ectopic overexpression of miR-214 inhibited proliferation of HCC cells in vitro and tumorigenicity in vivo. Further studies revealed that miR-214 could directly target the 3'-untranslated region (3'-UTR) of beta-catenin mRNA and suppress its protein expression. Similar to the restoring miR-214 expression, beta-catenin downregulation inhibited cell growth, whereas restoring the beta-catenin expression abolished the function of miR-214. Moreover, miR-214-mediated reduction of beta-catenin resulted in suppression of several downstream genes including c-Myc, cyclinD1, TCF-1, and LEF-1. These findings indicate that miR-214 serves as tumor suppressor and plays substantial roles in inhibiting the tumorigenesis of HCC through suppression of beta-catenin. Given these, miR-214 may serve as a useful prognostic or therapeutic target for treatment of HCC.
LinkOut: [PMID: 23068095]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
29 hsa-miR-214-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000148 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 2
MIRT000799 PTEN phosphatase and tensin homolog 5 5
MIRT004738 DAPK1 death-associated protein kinase 1 3 1
MIRT005426 MAP2K3 mitogen-activated protein kinase kinase 3 5 1
MIRT005427 MAPK8 mitogen-activated protein kinase 8 5 1
MIRT005551 POU4F2 POU class 4 homeobox 2 4 1
MIRT005765 PLXNB1 plexin B1 5 2
MIRT005811 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 3 1
MIRT006028 ING4 inhibitor of growth family, member 4 2 1
MIRT006375 XBP1 X-box binding protein 1 3 1
MIRT006644 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT006731 TWIST1 twist homolog 1 (Drosophila) 3 1
MIRT006816 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 4 2
MIRT006881 TP53 tumor protein p53 1 2
MIRT007031 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT007201 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) 1 1
MIRT007294 BCL2L2 BCL2-like 2 3 1
MIRT024958 FLOT1 flotillin 1 2 1
MIRT024959 MAP2K5 mitogen-activated protein kinase kinase 5 2 1
MIRT024960 HSPD1 heat shock 60kDa protein 1 (chaperonin) 2 1
MIRT024961 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 2 1
MIRT024962 CPNE7 copine VII 2 1
MIRT024963 RASA1 RAS p21 protein activator (GTPase activating protein) 1 2 1
MIRT024964 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 2 1
MIRT024965 ARL2 ADP-ribosylation factor-like 2 2 1
MIRT024966 AP3B1 adaptor-related protein complex 3, beta 1 subunit 2 1
MIRT024967 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT035545 PSMD10 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 1 1
MIRT035546 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1