Accession ID: MIRT007090 [miRNA, hsa-miR-15a-5p :: RECK, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-15aLinkOut: [miRBase ]
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Mature Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-15a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol RECK LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ST15
Description reversion-inducing-cysteine-rich protein with kazal motifs
Transcript NM_021111    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on RECK LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of RECK
(miRNA target sites are highlighted)
>RECK|NM_021111|3'UTR
   1 CTGCCCACGGAAAGTGCAGAATGCTCCTCCACCTCACTCTCCTGCCTTGAAAAAGACATTCAGGACTGCTGGTTTGTAGT
  81 TGAATATTGGCCAAGGAAAGGCACATGTCACCTCTATTCGCCACACAGTATTTTTTTTTTTAATCCGCCAATATTAGTAG
 161 GATTTTTGTTTTGTTTTTACAAATGTTAAAATGTGTTGTTCCAAATACTAATGAAAACAGAATGTCTCTTCCTGGTAGAC
 241 CACTGCCATATGATTTACATTTCCTCACCATAAGGGTCCCCCACTCTAAAGCAAATTTATCGCTGGGAAATGAGATGACC
 321 ACTTTTTAGAAAGATAATTCACTGTACTATCAGGTTCACAAACTTCATTTCAGAGTTCTTTTTGAAGTATTTAAGGTTCC
 401 CGTTGCATTTGTTTTGTTTACAGATAATTACCTACTCTGGCTAGAAGCTAGGGGTCCCAGTGAAGAGCCACTGCCATTAA
 481 AGAATATGAAACATAGATAAAACATCTTTGAAATTATGTAAATTATGTAAATTATCAGGCAAATTTGCATTAAATTACAG
 561 AAATTTAATTCAGAACCCCAACTACTGTGTTATGCAAAAGCAAGCTGATTAAATGACACTCATATAATTATATGTTGTAA
 641 GCAACAGGCTCACTGGTCACGGATTTGTGTCTGTGACTTTTGTGAAAGGGAGAAGTGACATTGCATCAAAGCATCTTGCA
 721 TTATGCAATTTTTATATTAACCAGATATATATTCATCGGTATTCATCCAAGTTAAATGTAGAGTTTTTAAACATCAATCT
 801 TTAAACCAATTGCTGCTACTTATATAATTGCCAAAAAGTGAAATAATGTGTAGTTCATGTAAATAATACATTATATTTCT
 881 ATTTTATTATGAAGAAGGTGAATAGCCATATTTGTAAAATGACAATCATGTGTGTTAACCCAGTGCTTTCCATTCGTGAA
 961 AACACATTTGCTTTTTGTGATATGCACAATGTAGATAAGTGTTCTGTCTGACTTTCTTTTTTGATATAGAAGTATAAAGA
1041 ATTGTGGTTTATATATTTAAAAGTGTCAAGCTGAGTATTAAAATGTATGCATGTTGTCTAAGAAATTGAATACTTTGAAT
1121 GTGTTTCACAGTTTGAAATAAGCTATTTGATGTAATACTTCTTGTGTGTATGCACATGAACTTAGATTTTACATGAAGTA
1201 TTTTTTCAGTATTATATGTACCCTCTGAAATACATAGGGATATGCGTATTATACCAAAATGTTGCTGAAAAATGGGCACT
1281 TAAAGCTTTCAGAATATGTCAGTGCTGATGTAGCATGCTTGTTGCAATTGCCTTTTTTCTGTATAAATGTCTTTAATGCA
1361 ATATACTGGAAAGCTTTTCTATTTTAATAAAAATAATTTTTATATGATCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||||||  || ||||||| 
Target 5' ttTAAACCA--AT-TGCTGCTa 3'
800 - 818 163.00 -15.40
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :| ||||  |  ||:|||| 
Target 5' atTATACCA--AAATGTTGCTg 3'
1248 - 1267 136.00 -11.20
3
miRNA  3' guGUUUGGUAA---UACACGACGAu 5'
            |||| ::||   |||||:||:| 
Target 5' taCAAA-TGTTAAAATGTGTTGTTc 3'
178 - 201 135.00 -12.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: RECK    [ Functional MTI ]
Validation Method PAR-CLIP
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nat Methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nat Methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: RECK    [ Functional MTI ]
Validation Method GFP reporter assay , qRT-PCR
Conditions SK-N-SH , GI-LA-N
Location of target site 3'UTR
Tools used in this research PicTar , TargetScan
Original Description (Extracted from the article) ... MicroRNA-15a directly targets the RECK 3 ′ -UTR and negatively regulates its expression ...

- Xin, C. Buhe, B. Hongting, L. Chuanmin, Y. et al., 2012, FEBS J.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||||||  || ||||||| 
Target 5' uuUAAACCA--AU-UGCUGCUa 3'
5 - 23
Article - Xin, C. Buhe, B. Hongting, L. Chuanmin, Y. et al.
- FEBS J, 2012
In this study, we found the expression of miR-15a was positively correlated with NB clinical pathological stage and negatively correlated with RECK expression. Using the EGFP reporter construct carrying the 3'-untranslated region of RECK, we identified RECK as a direct target of miR-15a. Suppression of miR-15a significantly decreased migration ability of GI-LA-N and SK-N-SH cell lines, while over-expression of miR-15a increased migration ability, all of which can be partly rescued by RECK inhibition or ectopic expression. Moreover, inhibition of miR-15a significantly increased secreted MMP-9 expression in culture medium through regulating the expression of RECK. These findings may account for a new insight into the characteristic of miR-15a/RECK/MMP-9 axis in NB progression, especially in NB migration and invasion.
LinkOut: [PMID: 23176145]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000377966.3 | 3UTR | UUUUUAAACAUCAAUCUUUAAACCAAUUGCUGCUACUUAUAUAAUUGCCAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
690 hsa-miR-15a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 polycomb ring finger oncogene 3 1
MIRT000282 WNT3A wingless-type MMTV integration site family, member 3A 3 2
MIRT000283 MYB v-myb myeloblastosis viral oncogene homolog (avian) 5 3
MIRT000284 CDC25A cell division cycle 25 homolog A (S. pombe) 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 B-cell CLL/lymphoma 2 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2 (Drosophila) 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family, member 8 2 1
MIRT000827 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63kDa 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein-like 2 3 3
MIRT000835 ECHDC1 enoyl CoA hydratase domain containing 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3-like 2 1
MIRT000851 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 2 1
MIRT000853 H3F3B H3 histone, family 3B (H3.3B) 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase-like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 heat-responsive protein 12 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock 70kDa protein 1A 2 1
MIRT000868 JUN jun proto-oncogene 2 1
MIRT000878 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 2 1
MIRT000880 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase homolog (S. cerevisiae) 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase-like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase, beta 2 1
MIRT000892 PMS1 PMS1 postmeiotic segregation increased 1 (S. cerevisiae) 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 primase, DNA, polypeptide 1 (49kDa) 2 1
MIRT000898 RAD51C RAD51 homolog C (S. cerevisiae) 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 2 1
MIRT000906 SLC35A1 solute carrier family 35 (CMP-sialic acid transporter), member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35, member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-site APP-cleaving enzyme 1 2 1
MIRT002946 DMTF1 cyclin D binding myb-like transcription factor 1 3 3
MIRT003333 BRCA1 breast cancer 1, early onset 2 2
MIRT003334 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family, member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 2 1
MIRT003874 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69, member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 coiled-coil domain containing 111 2 1
MIRT003883 C2orf43 chromosome 2 open reading frame 43 2 1
MIRT003884 C4orf27 chromosome 4 open reading frame 27 2 1
MIRT003885 NIPAL2 NIPA-like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog (S. cerevisiae) 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta (A4) precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 (mitochondrial, proton carrier) 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 5 10
MIRT004680 TSPYL2 TSPY-like 2 2 1
MIRT004829 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride channel, voltage-sensitive 3 4 1
MIRT006177 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 5 2
MIRT006181 MN1 meningioma (disrupted in balanced translocation) 1 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon, gamma 2 1
MIRT006998 PURA purine-rich element binding protein A 2 2
MIRT007090 RECK reversion-inducing-cysteine-rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta-like 1 homolog (Drosophila) 2 1
MIRT051311 PLA2G2D phospholipase A2, group IID 1 1
MIRT051312 ACVR1B activin A receptor, type IB 1 1
MIRT051313 IKBKG inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase, modifier subunit 1 1
MIRT051315 PCF11 PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) 1 1
MIRT051316 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP 30kDa subunit 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y-like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3, acidic 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT051329 CCT6B chaperonin containing TCP1, subunit 6B (zeta 2) 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC-like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT051349 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel-like factor 4 (gut) 1 1
MIRT054283 YAP1 Yes-associated protein 1 3 1
MIRT054424 CARM1 coactivator-associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY (sex determining region Y)-box 5 2 1
MIRT055421 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT057514 CEP55 centrosomal protein 55kDa 1 4
MIRT057729 ZDHHC16 zinc finger, DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG family, member 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TAR (HIV-1) RNA binding protein 2 1 2
MIRT066291 MTFR1L family with sequence similarity 54, member B 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT071206 FCF1 FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) 1 1
MIRT072822 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate-rich protein 1 1 2
MIRT075249 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen-like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT079655 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 6
MIRT080011 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 2
MIRT082985 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger, CCHC domain containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 2
MIRT090446 CDV3 CDV3 homolog (mouse) 1 1
MIRT090688 U2SURP U2 snRNP-associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor, beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family, member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT100364 HSPA1B heat shock 70kDa protein 1B 2 5
MIRT100566 PIM1 pim-1 oncogene 1 1
MIRT100896 CD2AP CD2-associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B (S. cerevisiae) 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT133769 SKI v-ski sarcoma viral oncogene homolog (avian) 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty-related, EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT142237 DCTN5 dynactin 5 (p25) 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L chromosome 20 open reading frame 112 1 1
MIRT154043 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C, delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 3 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103, member A1 1 3
MIRT194903 RBBP6 retinoblastoma binding protein 6 1 4
MIRT196275 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50kDa 1 4
MIRT211199 FGF2 fibroblast growth factor 2 (basic) 1 2
MIRT211314 HSPA4L heat shock 70kDa protein 4-like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TBP-like 1 1 2
MIRT223681 FZD6 frizzled family receptor 6 1 3
MIRT224965 BAG4 BCL2-associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family, member 6 1 1
MIRT230120 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT234342 MSL1 male-specific lethal 1 homolog (Drosophila) 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 homolog (S. pombe) 1 2
MIRT247236 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT247368 GABARAPL1 GABA(A) receptor-associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7-like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein, light chain, LC8-type 2 1 2
MIRT255333 SRPRB signal recognition particle receptor, B subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein (rabin3) 1 1
MIRT277504 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT286968 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT289625 CBX2 chromobox homolog 2 1 1
MIRT294283 ZFP28 zinc finger protein 28 homolog (mouse) 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor, alpha subunit 60kDa 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 2
MIRT313675 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 4
MIRT319331 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 homolog (Chlamydomonas) 1 1
MIRT326301 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT327962 CHIC1 cysteine-rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel-like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family, member 2 1 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid-like 1 1 1
MIRT449190 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family, member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1, epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 (beta) 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin-related protein 3 homolog B (yeast) 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 4
MIRT464751 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 2
MIRT465165 TSC22D2 TSC22 domain family, member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt-inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3-domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 family, member A (S. cerevisiae) 1 2
MIRT469090 RNF168 ring finger protein 168, E3 ubiquitin protein ligase 1 1
MIRT469415 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D, cAMP-specific 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472263 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT474828 KIAA0226 KIAA0226 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT475843 HDGF hepatoma-derived growth factor 1 2
MIRT476259 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 4
MIRT476276 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 3
MIRT476698 FURIN furin (paired basic amino acid cleaving enzyme) 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 3
MIRT479457 CDK6 cyclin-dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family, member 10 1 1
MIRT481181 AVL9 AVL9 homolog (S. cerevisiase) 1 3
MIRT482370 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT482556 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 1 2
MIRT485215 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 4
MIRT487394 C10orf54 chromosome 10 open reading frame 54 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex, subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2-like 1 4
MIRT499619 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger, matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin-like 1 1 4
MIRT500936 SRPR signal recognition particle receptor (docking protein) 1 4
MIRT500953 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle homolog 2 (Drosophila) 1 1
MIRT502038 LRIG2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin-like complex, subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine/arginine-rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domains 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 pleiomorphic adenoma gene 1 1 5
MIRT506194 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 3
MIRT506487 MYO5A myosin VA (heavy chain 12, myoxin) 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 3
MIRT507820 CDK1 cyclin-dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox homolog 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 2
MIRT509368 DMPK dystrophia myotonica-protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1 2
MIRT511847 GPATCH8 G patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji, AT rich interactive domain 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 (Drosophila) 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal-associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin-B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox homolog 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 (Drosophila) 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine, 21 (testisin) 1 1
MIRT543801 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 polymerase (DNA-directed), delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor-related protein complex 5, zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase 2 family, polypeptide B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl CoA reductase 1, mitochondrial 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 sal-like 1 (Drosophila) 1 2
MIRT546619 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN-interacting serine/arginine-rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain protein 4 1 1
MIRT547546 LRRFIP2 leucine rich repeat (in FLII) interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin alpha 3 (importin alpha 4) 1 1
MIRT547702 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor-bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT548275 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548727 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT548809 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 2
MIRT548946 CDK17 cyclin-dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2-associated, cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase (NAD(P)H) 1 1
MIRT550827 FAM229B chromosome 6 open reading frame 225 1 1
MIRT551383 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) 1 1
MIRT552039 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC domain containing (E. coli) 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type, D 1 1
MIRT555229 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 2
MIRT555278 PRDM4 PR domain containing 4 1 1
MIRT555431 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1-like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2, H2be 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin 1 1 1
MIRT558511 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase VIII 1 1
MIRT559155 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC lantibiotic synthetase component C-like 1 (bacterial) 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 (aspartate/glutamate carrier), member 12 1 2
MIRT563507 DLGAP3 discs, large (Drosophila) homolog-associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 chromosome 22 open reading frame 32 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT565400 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK-associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT567450 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 1
MIRT567482 FZD9 frizzled family receptor 9 1 1
MIRT568025 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor, type IIA 1 1
MIRT570464 TLK1 tousled-like kinase 1 1 2
MIRT571123 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase-like family, member 5 1 1
MIRT571431 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT574207 CLEC2D C-type lectin domain family 2, member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A, member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking protein, kinesin binding 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch repeat and BTB (POZ) domain containing 5 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon-like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin, gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B vacuolar protein sorting 33 homolog B (yeast) 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin, beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B transmembrane protein 55B 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT726322 TKTL1 transketolase-like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) 1 1
MIRT726356 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family, member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family, member 14 1 1
MIRT726384 TASP1 taspase, threonine aspartase, 1 1 1
MIRT726410 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 1 1
MIRT726511 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT726715 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2, E3 ubiquitin protein ligase 1 1
MIRT726764 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT726773 RELT RELT tumor necrosis factor receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 (class I) 1 1
MIRT726853 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT726874 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 polymerase (DNA-directed), epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU domain, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 LYR motif containing 5 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine-rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide-induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT727426 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase, alpha; neutral AB 1 1
MIRT727619 GABARAP GABA(A) receptor-associated protein 1 1
MIRT727647 FRYL FRY-like 1 1
MIRT727701 FAM73A family with sequence similarity 73, member A 1 1
MIRT727719 AMER1 family with sequence similarity 123B 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT727856 DSCR3 Down syndrome critical region gene 3 1 1
MIRT727860 DPP8 dipeptidyl-peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease type III 1 1
MIRT727910 CYLD cylindromatosis (turban tumor syndrome) 1 1
MIRT727913 CYB561A3 cytochrome b, ascorbate dependent 3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT727936 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT727953 CPNE1 copine I 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT728047 CBFA2T3 core-binding factor, runt domain, alpha subunit 2; translocated to, 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT728265 ATP13A3 ATPase type 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1 (Drosophila) 1 1
MIRT728330 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family, member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*