Accession ID: MIRT007191 [miRNA, hsa-miR-205-5p :: LRRK2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-205LinkOut: [miRBase ]
Description Homo sapiens miR-205 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-205-5p
Mature Sequence 34| UCCUUCAUUCCACCGGAGUCUG |55
Evidence Experimental
Experiments Cloned
Putative hsa-miR-205-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LRRK2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AURA17, DARDARIN, PARK8, RIPK7, ROCO2
Description leucine-rich repeat kinase 2
Transcript NM_198578    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LRRK2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LRRK2
(miRNA target sites are highlighted)
>LRRK2|NM_198578|3'UTR
   1 GAGAGAAATAGGAATTGTCTTTGGATAGGAAAATTATTCTCTCCTCTTGTAAATATTTATTTTAAAAATGTTCACATGGA
  81 AAGGGTACTCACATTTTTTGAAATAGCTCGTGTGTATGAAGGAATGTTATTATTTTTAATTTAAATATATGTAAAAATAC
 161 TTACCAGTAAATGTGTATTTTAAAGAACTATTTAAAACACAATGTTATATTTCTTATAAATACCAGTTACTTTCGTTCAT
 241 TAATTAATGAAAATAAATCTGTGAAGTACCTAATTTAAGTACTCATACTAAAATTTATAAGGCCGATAATTTTTTGTTTT
 321 CTTGTCTGTAATGGAGGTAAACTTTATTTTAAATTCTGTGCTTAAGACAGGACTATTGCTTGTCGATTTTTCTAGAAATC
 401 TGCACGGTATAATGAAAATATTAAGACAGTTTCCCATGTAATGTATTCCTTCTTAGATTGCATCGAAATGCACTATCATA
 481 TATGCTTGTAAATATTCAAATGAATTTGCACTAATAAAGTCCTTTGTTGGTATGTGAATTCTCTTTGTTGCTGTTGCAAA
 561 CAGTGCATCTTACACAACTTCACTCAATTCAAAAGAAAACTCCATTAAAAGTACTAATGAAAAAACATGACATACTGTCA
 641 AAGTCCTCATATCTAGGAAAGACACAGAAACTCTCTTTGTCACAGAAACTCTCTGTGTCTTTCCTAGACATAATAGAGTT
 721 GTTTTTCAACTCTATGTTTGAATGTGGATACCCTGAATTTTGTATAATTAGTGTAAATACAGTGTTCAGTCCTTCAAGTG
 801 ATATTTTTATTTTTTTATTCATACCACTAGCTACTTGTTTTCTAATCTGCTTCATTCTAATGCTTATATTCATCTTTTCC
 881 CTAAATTTGTGATGCTGCAGATCCTACATCATTCAGATAGAAACCTTTTTTTTTTTCAGAATTATAGAATTCCACAGCTC
 961 CTACCAAGACCATGAGGATAAATATCTAACACTTTTCAGTTGCTGAAGGAGAAAGGAGCTTTAGTTATGATGGATAAAAA
1041 TATCTGCCACCCTAGGCTTCCAAATTATACTTAAATTGTTTACATAGCTTACCACAATAGGAGTATCAGGGCCAAATACC
1121 TATGTAATAATTTGAGGTCATTTCTGCTTTAGGAAAAGTACTTTCGGTAAATTCTTTGGCCCTGACCAGTATTCATTATT
1201 TCAGATAATTCCCTGTGATAGGACAACTAGTACATTTAATATTCTCAGAACTTATGGCATTTTACTATGTGAAAACTTTA
1281 AATTTATTTATATTAAGGGTAATCAAATTCTTAAAGATGAAAGATTTTCTGTATTTTAAAGGAAGCTATGCTTTAACTTG
1361 TTATGTAATTAACAAAAAAATCATATATAATAGAGCTCTTTGTTCCAGTGTTATCTCTTTCATTGTTACTTTGTATTTGC
1441 AATTTTTTTTACCAAAGACAAATTAAAAAAATGAATACCATATTTAAATGGAATAATAAAGGTTTTTTAAAAACTTTAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gucUGAGGCCAC-CUUACUUCCu 5'
             :|||  ||| | ||||||| 
Target 5' ataGCTC--GTGTGTATGAAGGa 3'
103 - 123 155.00 -17.90
2
miRNA  3' gucuGAGGCC--ACCUUACUUCCu 5'
              :||: |  || ||||:||| 
Target 5' tgttTTCTTGTCTGTAATGGAGGt 3'
315 - 338 140.00 -11.10
3
miRNA  3' gucuGAGGCCACCUUACUUCCu 5'
              :|:| || |  |||||| 
Target 5' cactTTTCAGTTG-CTGAAGGa 3'
990 - 1010 121.00 -10.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-205-5p :: LRRK2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions HEK293T , HeLa , M17
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... These results demonstrate that miR-205 suppresses the expression of LRRK2 protein through the direct targeting the 3′-UTR of LRRK2. ...

- Cho, H. J. Liu, G. Jin, S. M. Parisiadou, et al., 2012, Hum Mol Genet.

Article - Cho, H. J. Liu, G. Jin, S. M. Parisiadou, et al.
- Hum Mol Genet, 2012
Recent genome wide association studies indicate that a simple alteration of Leucine-rich repeat kinase 2 (LRRK2) gene expression may contribute to the etiology of sporadic Parkinson's Disease (PD). However, the expression and regulation of LRRK2 protein in the sporadic PD brains remain to be determined. Here, we found that the expression of LRRK2 protein was enhanced in the sporadic PD patients using the frontal cortex tissue from a set of 16 PD patients and 7 control samples. By contrast, no significant difference was detected in the level of LRRK2 mRNA expression between the control and PD cases, suggesting a potential post-transcriptional modification of LRRK2 protein expression in the sporadic PD brains. Indeed, it was identified that microRNA-205 (miR-205) suppressed the expression of LRRK2 protein through a conserved binding site at the 3'-untranslated region (UTR) of LRRK2 gene. Interestingly, miR-205 expression was significantly down-regulated in the brains of patients with sporadic PD showing the enhanced LRRK2 protein levels. Also, in vitro studies in the cell lines and primary neuron cultures further established the role of miR-205 in modulating the expression of LRRK2 protein. In addition, introduction of miR-205 rescued the neurite outgrowth defects in the neurons expressing PD-related LRRK2 R1441G mutant. Together, these findings suggest that down-regulation of miR-205 may contribute to the potential pathogenic elevation of LRRK2 protein in the brains of patients with sporadic PD; while over-expression of miR-205 may provide an applicable therapeutic strategy to suppress the abnormal up-regulation of LRRK2 protein in PD.
LinkOut: [PMID: 23125283]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
173 hsa-miR-205-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001163 LRP1 low density lipoprotein receptor-related protein 1 4 1
MIRT002478 ZEB1 zinc finger E-box binding homeobox 1 6 5
MIRT002479 SIP1 gem (nuclear organelle) associated protein 2 1 1
MIRT003236 DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 2 1
MIRT003238 INPPL1 inositol polyphosphate phosphatase-like 1 3 2
MIRT003239 MED1 mediator complex subunit 1 5 3
MIRT003321 E2F5 E2F transcription factor 5, p130-binding 1 2
MIRT003322 E2F1 E2F transcription factor 1 3 4
MIRT003659 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 5 6
MIRT003666 ZEB2 zinc finger E-box binding homeobox 2 6 4
MIRT003667 PRKCE protein kinase C, epsilon 2 1
MIRT004518 VEGFA vascular endothelial growth factor A 4 4
MIRT004655 SIGMAR1 sigma non-opioid intracellular receptor 1 2 1
MIRT005563 IL24 interleukin 24 4 2
MIRT005564 IL32 interleukin 32 4 1
MIRT006784 EGLN2 egl nine homolog 2 (C. elegans) 4 1
MIRT006897 TP73 tumor protein p73 2 1
MIRT006935 CYR61 cysteine-rich, angiogenic inducer, 61 1 1
MIRT006936 CTGF connective tissue growth factor 1 1
MIRT006982 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 2 1
MIRT007075 LAMC1 laminin, gamma 1 (formerly LAMB2) 3 1
MIRT007191 LRRK2 leucine-rich repeat kinase 2 3 1
MIRT024970 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 2 2
MIRT024971 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 1 1
MIRT052936 BCL2 B-cell CLL/lymphoma 2 3 2
MIRT053377 SMAD1 SMAD family member 1 3 1
MIRT053378 SMAD4 SMAD family member 4 3 1
MIRT053768 YY1 YY1 transcription factor 3 1
MIRT054104 PTPRM protein tyrosine phosphatase, receptor type, M 3 1
MIRT054246 AR androgen receptor 3 2
MIRT054375 BCL6 B-cell CLL/lymphoma 6 2 1
MIRT054569 ACSL4 acyl-CoA synthetase long-chain family member 4 3 1
MIRT054779 ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 3 1
MIRT054854 ACSL1 acyl-CoA synthetase long-chain family member 1 3 1
MIRT063948 STK38L serine/threonine kinase 38 like 1 1
MIRT116185 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT130344 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT131817 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT133673 ETNK1 ethanolamine kinase 1 1 1
MIRT140253 DMXL2 Dmx-like 2 1 1
MIRT146329 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT146575 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT154852 GNAS GNAS complex locus 1 2
MIRT172529 SQLE squalene epoxidase 1 1
MIRT178361 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT329332 ETF1 eukaryotic translation termination factor 1 1 2
MIRT348004 ZNF585B zinc finger protein 585B 1 1
MIRT437429 HMGB3 high mobility group box 3 3 1
MIRT437791 PTEN phosphatase and tensin homolog 4 3
MIRT437839 ESRRG estrogen-related receptor gamma 1 1
MIRT437840 ESRRG estrogen-related receptor gamma 1 1
MIRT437841 ESRRG estrogen-related receptor gamma 1 1
MIRT437842 ESRRG estrogen-related receptor gamma 1 1
MIRT437843 ESRRG estrogen-related receptor gamma 1 1
MIRT438663 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 4 1
MIRT438674 KCNJ10 potassium inwardly-rectifying channel, subfamily J, member 10 3 1
MIRT439273 YEATS2 YEATS domain containing 2 1 1
MIRT439316 VAMP1 vesicle-associated membrane protein 1 (synaptobrevin 1) 1 1
MIRT439404 TOLLIP toll interacting protein 1 1
MIRT439430 TMEM55B transmembrane protein 55B 1 1
MIRT439441 TMEM123 transmembrane protein 123 1 1
MIRT439488 TAF11 TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa 1 1
MIRT439675 SERTAD2 SERTA domain containing 2 1 1
MIRT439720 RTN3 reticulon 3 1 1
MIRT439778 RFX7 regulatory factor X, 7 1 1
MIRT439820 RAP2B RAP2B, member of RAS oncogene family 1 1
MIRT439953 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT439978 PICALM phosphatidylinositol binding clathrin assembly protein 1 1
MIRT439989 PHC2 polyhomeotic homolog 2 (Drosophila) 1 1
MIRT440042 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT440049 PANK1 pantothenate kinase 1 1 1
MIRT440100 NOTCH2 notch 2 1 1
MIRT440111 NIPA2 non imprinted in Prader-Willi/Angelman syndrome 2 1 1
MIRT440125 NDUFB2 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa 1 1
MIRT440128 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa 1 1
MIRT440225 MMD monocyte to macrophage differentiation-associated 1 1
MIRT440246 MGLL monoglyceride lipase 1 1
MIRT440259 MED13 mediator complex subunit 13 1 1
MIRT440275 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT440298 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT440300 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT440309 LRRC59 leucine rich repeat containing 59 1 1
MIRT440320 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT440436 IPO7 importin 7 1 1
MIRT440621 TMEM66 transmembrane protein 66 1 1
MIRT440697 EZR ezrin 1 1
MIRT440724 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 1
MIRT440854 CUL5 cullin 5 1 1
MIRT440936 CLIP1 CAP-GLY domain containing linker protein 1 1 1
MIRT440962 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT440963 CDK6 cyclin-dependent kinase 6 1 1
MIRT441052 GUCD1 chromosome 22 open reading frame 13 1 1
MIRT441068 C1orf123 chromosome 1 open reading frame 123 1 1
MIRT441130 B4GALT6 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 1 1
MIRT441131 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 1
MIRT441250 AFF4 AF4/FMR2 family, member 4 1 1
MIRT441253 AFF1 AF4/FMR2 family, member 1 1 1
MIRT441863 TEX35 testis expressed 35 1 1
MIRT467500 SMIM13 chromosome 6 open reading frame 228 1 1
MIRT468554 SERINC3 serine incorporator 3 1 5
MIRT469047 RNF217 ring finger protein 217 1 2
MIRT472308 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT474226 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT495294 NPRL3 nitrogen permease regulator-like 3 (S. cerevisiae) 1 1
MIRT496424 ACTRT3 actin-related protein T3 1 1
MIRT497416 GOT1 glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) 1 1
MIRT497778 F2RL2 coagulation factor II (thrombin) receptor-like 2 1 1
MIRT498298 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT504466 EID2B EP300 interacting inhibitor of differentiation 2B 1 1
MIRT505597 SLC38A1 solute carrier family 38, member 1 1 2
MIRT505979 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 2
MIRT514721 C11orf74 chromosome 11 open reading frame 74 1 2
MIRT524097 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 3
MIRT527180 LRRTM4 leucine rich repeat transmembrane neuronal 4 1 1
MIRT527863 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT527892 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 1 1
MIRT528382 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT529399 ICK intestinal cell (MAK-like) kinase 1 1
MIRT529569 PRLR prolactin receptor 1 1
MIRT530245 LOH12CR1 loss of heterozygosity, 12, chromosomal region 1 1 1
MIRT531610 ACP1 acid phosphatase 1, soluble 1 1
MIRT535306 PHF12 PHD finger protein 12 1 1
MIRT536164 MAP3K9 mitogen-activated protein kinase kinase kinase 9 1 3
MIRT536197 MAML2 mastermind-like 2 (Drosophila) 1 1
MIRT549393 AMOT angiomotin 1 1
MIRT557176 HOXA11 homeobox A11 1 1
MIRT573192 IMPAD1 inositol monophosphatase domain containing 1 1 1
MIRT614063 TCF20 transcription factor 20 (AR1) 1 1
MIRT616675 PRR15 proline rich 15 1 1
MIRT616814 PAPPA-AS1 PAPPA antisense RNA 1 1 1
MIRT620655 CCDC108 coiled-coil domain containing 108 1 1
MIRT622593 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT624579 BCL9L B-cell CLL/lymphoma 9-like 1 1
MIRT625310 SHISA6 shisa homolog 6 (Xenopus laevis) 1 1
MIRT640083 JMJD1C jumonji domain containing 1C 1 1
MIRT641897 SMNDC1 survival motor neuron domain containing 1 1 1
MIRT643136 PLCXD2 phosphatidylinositol-specific phospholipase C, X domain containing 2 1 1
MIRT645296 ANGPTL7 angiopoietin-like 7 1 1
MIRT649123 SRD5A1 steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1) 1 1
MIRT650729 TNFSF8 tumor necrosis factor (ligand) superfamily, member 8 1 1
MIRT651667 VPS52 vacuolar protein sorting 52 homolog (S. cerevisiae) 1 1
MIRT652431 TMEM239 transmembrane protein 239 1 1
MIRT653413 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT653519 SLC41A1 solute carrier family 41, member 1 1 1
MIRT654411 RBBP4 retinoblastoma binding protein 4 1 1
MIRT655510 PAIP2B poly(A) binding protein interacting protein 2B 1 1
MIRT655779 NOX5 NADPH oxidase, EF-hand calcium binding domain 5 1 1
MIRT655911 NEK9 NIMA (never in mitosis gene a)- related kinase 9 1 1
MIRT656174 MRPL44 mitochondrial ribosomal protein L44 1 1
MIRT666300 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT668907 CREB1 cAMP responsive element binding protein 1 1 1
MIRT691637 CDK1 cyclin-dependent kinase 1 1 1
MIRT700287 RAN RAN, member RAS oncogene family 1 1
MIRT705258 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT708668 KCTD16 potassium channel tetramerisation domain containing 16 1 1
MIRT708862 TMSB4X thymosin beta 4, X-linked 1 1
MIRT710371 GM2A GM2 ganglioside activator 1 1
MIRT710531 TMEM201 transmembrane protein 201 1 1
MIRT710553 PHF8 PHD finger protein 8 1 1
MIRT712125 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT713124 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 1
MIRT714873 SPDL1 spindle apparatus coiled-coil protein 1 1 1
MIRT715171 MAPK14 mitogen-activated protein kinase 14 1 1
MIRT715287 TXNL1 thioredoxin-like 1 1 1
MIRT715441 RGS6 regulator of G-protein signaling 6 1 1
MIRT717294 KCTD20 potassium channel tetramerisation domain containing 20 1 1
MIRT718305 XPOT exportin, tRNA 1 1
MIRT721583 SLC5A12 solute carrier family 5 (sodium/glucose cotransporter), member 12 1 1
MIRT721730 VTI1A vesicle transport through interaction with t-SNAREs homolog 1A (yeast) 1 1
MIRT721915 C6orf201 chromosome 6 open reading frame 201 1 1
MIRT723899 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT724513 KLHL5 kelch-like 5 (Drosophila) 1 1
MIRT724677 NCAPG non-SMC condensin I complex, subunit G 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*