Accession ID: MIRT007191 [miRNA, hsa-miR-205-5p :: LRRK2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-205LinkOut: [miRBase ]
Description Homo sapiens miR-205 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-205-5p
Mature Sequence 34| UCCUUCAUUCCACCGGAGUCUG |55
Evidence Experimental
Experiments Cloned
Putative hsa-miR-205-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LRRK2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AURA17, DARDARIN, PARK8, RIPK7, ROCO2
Description leucine-rich repeat kinase 2
Transcript NM_1985    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LRRK2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LRRK2
(miRNA target sites are highlighted)
>LRRK2|NM_1985|3'UTR
   1 TAAGAGAGAAATAGGAATTGTCTTTGGATAGGAAAATTATTCTCTCCTCTTGTAAATATTTATTTTAAAAATGTTCACAT
  81 GGAAAGGGTACTCACATTTTTTGAAATAGCTCGTGTGTATGAAGGAATGTTATTATTTTTAATTTAAATATATGTAAAAA
 161 TACTTACCAGTAAATGTGTATTTTAAAGAACTATTTAAAACACAATGTTATATTTCTTATAAATACCAGTTACTTTCGTT
 241 CATTAATTAATGAAAATAAATCTGTGAAGTACCTAATTTAAGTACTCATACTAAAATTTATAAGGCCGATAATTTTTTGT
 321 TTTCTTGTCTGTAATGGAGGTAAACTTTATTTTAAATTCTGTGCTTAAGACAGGACTATTGCTTGTCGATTTTTCTAGAA
 401 ATCTGCACGGTATAATGAAAATATTAAGACAGTTTCCCATGTAATGTATTCCTTCTTAGATTGCATCGAAATGCACTATC
 481 ATATATGCTTGTAAATATTCAAATGAATTTGCACTAATAAAGTCCTTTGTTGGTATGTGAATTCTCTTTGTTGCTGTTGC
 561 AAACAGTGCATCTTACACAACTTCACTCAATTCAAAAGAAAACTCCATTAAAAGTACTAATGAAAAAACATGACATACTG
 641 TCAAAGTCCTCATATCTAGGAAAGACACAGAAACTCTCTTTGTCACAGAAACTCTCTGTGTCTTTCCTAGACATAATAGA
 721 GTTGTTTTTCAACTCTATGTTTGAATGTGGATACCCTGAATTTTGTATAATTAGTGTAAATACAGTGTTCAGTCCTTCAA
 801 GTGATATTTTTATTTTTTTATTCATACCACTAGCTACTTGTTTTCTAATCTGCTTCATTCTAATGCTTATATTCATCTTT
 881 TCCCTAAATTTGTGATGCTGCAGATCCTACATCATTCAGATAGAAACCTTTTTTTTTTTCAGAATTATAGAATTCCACAG
 961 CTCCTACCAAGACCATGAGGATAAATATCTAACACTTTTCAGTTGCTGAAGGAGAAAGGAGCTTTAGTTATGATGGATAA
1041 AAATATCTGCCACCCTAGGCTTCCAAATTATACTTAAATTGTTTACATAGCTTACCACAATAGGAGTATCAGGGCCAAAT
1121 ACCTATGTAATAATTTGAGGTCATTTCTGCTTTAGGAAAAGTACTTTCGGTAAATTCTTTGGCCCTGACCAGTATTCATT
1201 ATTTCAGATAATTCCCTGTGATAGGACAACTAGTACATTTAATATTCTCAGAACTTATGGCATTTTACTATGTGAAAACT
1281 TTAAATTTATTTATATTAAGGGTAATCAAATTCTTAAAGATGAAAGATTTTCTGTATTTTAAAGGAAGCTATGCTTTAAC
1361 TTGTTATGTAATTAACAAAAAAATCATATATAATAGAGCTCTTTGTTCCAGTGTTATCTCTTTCATTGTTACTTTGTATT
1441 TGCAATTTTTTTTACCAAAGACAAATTAAAAAAATGAATACCATATTTAAATGGAATAATAAAGGTTTTTTAAAAACTTT
1521 AAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gucUGAGGCCAC-CUUACUUCCu 5'
             :|||  ||| | ||||||| 
Target 5' ataGCTC--GTGTGTATGAAGGa 3'
106 - 126 155.00 -17.90
2
miRNA  3' gucuGAGGCC--ACCUUACUUCCu 5'
              :||: |  || ||||:||| 
Target 5' tgttTTCTTGTCTGTAATGGAGGt 3'
318 - 341 140.00 -11.10
3
miRNA  3' gucuGAGGCCACCUUACUUCCu 5'
              :|:| || |  |||||| 
Target 5' cactTTTCAGTTG-CTGAAGGa 3'
993 - 1013 121.00 -10.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-205-5p :: LRRK2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions HEK293T , HeLa , M17
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... These results demonstrate that miR-205 suppresses the expression of LRRK2 protein through the direct targeting the 3′-UTR of LRRK2. ...

- Cho, H. J. Liu, G. Jin, S. M. Parisiadou, et al., 2012, Hum Mol Genet.

Article - Cho, H. J. Liu, G. Jin, S. M. Parisiadou, et al.
- Hum Mol Genet, 2012
Recent genome wide association studies indicate that a simple alteration of Leucine-rich repeat kinase 2 (LRRK2) gene expression may contribute to the etiology of sporadic Parkinson's Disease (PD). However, the expression and regulation of LRRK2 protein in the sporadic PD brains remain to be determined. Here, we found that the expression of LRRK2 protein was enhanced in the sporadic PD patients using the frontal cortex tissue from a set of 16 PD patients and 7 control samples. By contrast, no significant difference was detected in the level of LRRK2 mRNA expression between the control and PD cases, suggesting a potential post-transcriptional modification of LRRK2 protein expression in the sporadic PD brains. Indeed, it was identified that microRNA-205 (miR-205) suppressed the expression of LRRK2 protein through a conserved binding site at the 3'-untranslated region (UTR) of LRRK2 gene. Interestingly, miR-205 expression was significantly down-regulated in the brains of patients with sporadic PD showing the enhanced LRRK2 protein levels. Also, in vitro studies in the cell lines and primary neuron cultures further established the role of miR-205 in modulating the expression of LRRK2 protein. In addition, introduction of miR-205 rescued the neurite outgrowth defects in the neurons expressing PD-related LRRK2 R1441G mutant. Together, these findings suggest that down-regulation of miR-205 may contribute to the potential pathogenic elevation of LRRK2 protein in the brains of patients with sporadic PD; while over-expression of miR-205 may provide an applicable therapeutic strategy to suppress the abnormal up-regulation of LRRK2 protein in PD.
LinkOut: [PMID: 23125283]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
24 hsa-miR-205-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001163 LRP1 low density lipoprotein receptor-related protein 1 4 1
MIRT002478 ZEB1 zinc finger E-box binding homeobox 1 5 2
MIRT002479 SIP1 survival of motor neuron protein interacting protein 1 1 1
MIRT003236 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 2 1
MIRT003238 INPPL1 inositol polyphosphate phosphatase-like 1 3 2
MIRT003239 MED1 mediator complex subunit 1 3 1
MIRT003321 E2F5 E2F transcription factor 5, p130-binding 1 2
MIRT003322 E2F1 E2F transcription factor 1 3 3
MIRT003659 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 5 5
MIRT003666 ZEB2 zinc finger E-box binding homeobox 2 5 3
MIRT003667 PRKCE protein kinase C, epsilon 2 1
MIRT004518 VEGFA vascular endothelial growth factor A 2 2
MIRT004655 SIGMAR1 sigma non-opioid intracellular receptor 1 2 1
MIRT005563 IL24 interleukin 24 4 2
MIRT005564 IL32 interleukin 32 4 1
MIRT006784 EGLN2 egl nine homolog 2 (C. elegans) 4 1
MIRT006897 TP73 tumor protein p73 2 1
MIRT006935 CYR61 cysteine-rich, angiogenic inducer, 61 1 1
MIRT006936 CTGF connective tissue growth factor 1 1
MIRT006982 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 2 1
MIRT007075 LAMC1 laminin, gamma 1 (formerly LAMB2) 3 1
MIRT007191 LRRK2 leucine-rich repeat kinase 2 3 1
MIRT024970 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 1
MIRT024971 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 1 1