Accession ID: MIRT007361 [miRNA, hsa-miR-433-3p :: CFTR, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-433LinkOut: [miRBase ]
Synonyms MIRN433, hsa-mir-433, miRNA433, MIR433
Description Homo sapiens miR-433 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-433-3p
Mature Sequence 64| AUCAUGAUGGGCUCCUCGGUGU |85
Evidence Experimental
Experiments Cloned
Putative hsa-miR-433-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CFTR LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ABC35, ABCC7, CF, CFTR/MRP, MRP7, TNR-CFTR, dJ760C5.1
Description cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Transcript NM_0004    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CFTR LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CFTR
(miRNA target sites are highlighted)
>CFTR|NM_0004|3'UTR
   1 AGAGCAGCATAAATGTTGACATGGGACATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGAGCT
  81 CGTGGAACAGTTACCTCTGCCTCAGAAAACAAGGATGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAAT
 161 TGAGGACACTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATCCTTGAAG
 241 ATTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAAT
 321 GTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACT
 401 TCTTAGGGTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTCC
 481 CCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCAC
 561 AGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACTTCCAGATCCTG
 641 GAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAATCTCAATATTTCAGATAATCACAATACATCCCTTACCTGGGAAA
 721 GGGCTGTTATAATCTTTCACAGGGGACAGGATGGTTCCCTTGATGAAGAAGTTGATATGCCTTTTCCCAACTCCAGAAAG
 801 TGACAAGCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTTT
 881 CCACAGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGGGTAGACACACATGAAGTCCAAGCATT
 961 TAGATGTATAGGTTGATGGTGGTATGTTTTCAGGCTAGATGTATGTACTTCATGCTGTCTACACTAAGAGAGAATGAGAG
1041 ACACACTGAAGAAGCACCAATCATGAATTAGTTTTATATGCTTCTGTTTTATAATTTTGTGAAGCAAAATTTTTTCTCTA
1121 GGAAATATTTATTTTAATAATGTTTCAAACATATATAACAATGCTGTATTTTAAAAGAATGATTATGAATTACATTTGTA
1201 TAAAATAATTTTTATATTTGAAATATTGACTTTTTATGGCACTAGTATTTCTATGAAATATTATGTTAAAACTGGGACAG
1281 GGGAGAACCTAGGGTGATATTAACCAGGGGCCATGAATCACCTTTTGGTCTGGAGGGAAGCCTTGGGGCTGATGCAGTTG
1361 TTGCCCACAGCTGTATGATTCCCAGCCAGCACAGCCTCTTAGATGCAGTTCTGAAGAAGATGGTACCACCAGTCTGACTG
1441 TTTCCATCAAGGGTACACTGCCTTCTCAACTCCAAACTGACTCTTAAGAAGACTGCATTATATTTATTACTGTAAGAAAA
1521 TATCACTTGTCAATAAAATCCATACATTTGTGTGAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugUGGC-UCCUCG-GG-UAGUACUa 5'
            ||:| || ||| || ||||||| 
Target 5' acACTGAAGAAGCACCAATCATGAa 3'
1043 - 1067 164.00 -20.90
2
miRNA  3' uguGGCUCC---UCGG-GUAGUACUa 5'
             :|| ||   ||:| | |||||: 
Target 5' agcTCGTGGGACAGTCACCTCATGGa 3'
46 - 71 111.00 -13.50
3
miRNA  3' ugUGGCUC-CUCGGGUAGUACUa 5'
            |:| || ||| | :||| || 
Target 5' acATCTAGTGAG-CAGTCAGGAa 3'
600 - 621 111.00 -13.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-433-3p :: CFTR    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions PANC-1 , HEK293
Location of target site 3'UTR
Tools used in this research PITA , RNAhybrid
Original Description (Extracted from the article) ... Validation of miRNA Target Sites in the CFTR 39UTR Functional validation of the 2 predicted miRNA target sites containing the identified genetic variants was performed using a dual-luciferase assay in HEK 293 and in Panc1 cell lines. A luciferase-reporter construct containing the wild-type 39UTR of CFTR was co-transfected with the miRNAs mimics of interest. As shown in Figure 3A, a statistically significant reduction of the luciferase activity was observed for both the miRNAs used (miR- 509-3p, miR-433) when compared with control mimics. The down regulation observed ranged from a reduction of the luciferase expression of about 50% in the case of miR-433, up to 60% for the miR-509-3p. A western blot analysis was performed to check the levels of CFTR protein in Panc1 cells transient transfected with the two miRNAs. Both miRNAs were able, although to a different extent, to significantly reduce the endogenous levels of CFTR protein (Figure 3B). To further validate and to mimic a more physiological context, where different miRNAs may be expressed at high levels from their genomic loci, we cloned the genes of miR- 433 and miR-509-3p in lentiviral vectors. We also constructed a lentiviral vector expressing a short hairpin RNA (shRNA) against the target region of both miR-433 and miR-509-3p (Figure 4A). Then, we produced lentiviral particles with which we transduced Panc 1 cells. So we obtained Panc 1 cells stably expressing each of the two miRNAs of interest or the shRNA (Panc-miR-433, Panc- miR-509-3p, Panc-sh-39UTR). Thus, we transient transfected each of these cell lines with the wild-type construct of CFTR 39UTR. The levels of luciferase in cells expressing high levels of miR-433 or miR-509 compared to not transduced cells were comparable to those obtained using the miRNA mimics (Figure 4B, white rectangles), the residual luciferase activity in Panc-sh-39UTR was close to 10% compared to the control. The same results were obtained in HEK293 cell line. ...

- Amato, F. Seia, M. Giordano, S. Elce, A. et al., 2013, PLoS One.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ugUGGC-UCCUCG-GG-UAGUACUa 5'
            ||:| || ||| || ||||||| 
Target 5' acACUGAAGAAGCACCAAUCAUGAa 3'
4 - 28
Article - Amato, F. Seia, M. Giordano, S. Elce, A. et al.
- PLoS One, 2013
Cystic fibrosis (CF) is the most frequent lethal genetic disorder among Caucasians. It depends on alterations of a chloride channel expressed by most epithelial cells and encoded by CFTR gene. Also using scanning techniques to analyze the whole coding regions of CFTR gene, mutations are not identified in up to 10% of CF alleles, and such figure increases in CFTR-related disorders (CFTR-RD). Other gene regions may be the site of causing-disease mutations. We searched for genetic variants in the 1500 bp of CFTR 3' untranslated region, typical target of microRNA (miRNA) posttranscriptional gene regulation, in either CF patients with the F508del homozygous genotype and different clinical expression (n = 20), CF (n = 32) and CFTR-RD (n = 43) patients with one or none mutation after CFTR scanning and in controls (n = 50). We identified three SNPs, one of which, the c.*1043A>C, was located in a region predicted to bind miR-433 and miR-509-3p. Such mutation was peculiar of a CFTR-RD patient that had Congenital Bilateral Absence of Vas Deferens (CBAVD), diffuse bronchiectasis, a borderline sweat chloride test and the heterozygous severe F508del mutation on the other allele. The expression analysis demonstrated that the c.*1043A>C increases the affinity for miR-509-3p and slightly decreases that for the miR-433. Both miRNAs cause in vitro a reduced expression of CFTR protein. Thus, the c.*1043A>C may act as a mild CFTR mutation enhancing the affinity for inhibitory miRNAs as a novel pathogenetic mechanism in CF.
LinkOut: [PMID: 23555973]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
5 hsa-miR-433-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001201 GRB2 growth factor receptor-bound protein 2 3 1
MIRT001741 FGF20 fibroblast growth factor 20 3 1
MIRT007225 RUNX2 runt-related transcription factor 2 1 1
MIRT007361 CFTR cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) 1 1
MIRT016630 HDAC6 histone deacetylase 6 1 1