Accession ID: MIRT016199 [miRNA, hsa-miR-590-3p :: VPS35, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-590LinkOut: [miRBase ]
Synonyms MIRN590, hsa-mir-590, MIR590
Description Homo sapiens miR-590 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-590-3p
Mature Sequence 56| UAAUUUUAUGUAUAAGCUAGU |76
Evidence Experimental
Experiments Cloned
Putative hsa-miR-590-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol VPS35 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DKFZp434E1211, DKFZp434P1672, FLJ10752, FLJ13588, FLJ20388, MEM3
Description vacuolar protein sorting 35 homolog (S. cerevisiae)
Transcript NM_0182    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on VPS35 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of VPS35
(miRNA target sites are highlighted)
>VPS35|NM_0182|3'UTR
   1 TAAAAAGGAAATAGCTCACCATACTCCTTTCCATGTACATCCAGTGAGGGTTTTATTACGCTAGGTTTCCCTTCCATAGA
  81 TTGTGCCTTTCAGAAATGCTGAGGTAGGTTTCCCATTTCTTACCTGTGATGTGTTTTACCCAGCACCTCCGGACACTCAC
 161 CTTCAGGACCTTAATAAAATTATTCACTTGGTAAGTGTTCAAGTCTTTCTGATCACCCCAAGTAGCATGACTGATCTGCA
 241 ATTTAAAATTCCTGTGATCTGTAAAAAAAAAAAAAAAAAAAAAAACAAAACCCACAAGCACTTATCTTGGCTACTAATGA
 321 AGCTCTCCTTTTTTTTGTTTGTTTGTTTGCTTCATTGTTGATTGTGTATTTTCTTCATTCCTGGGGAGTACTAACCCAAA
 401 AGCGTCTGTCTCTTGTTTTCTAGTCCAGTTTGAGATTAATTTAGAAGAAAGGAATACTGTATGTGAAATTCATCTTGGGC
 481 TTTCCCCTAAATTGCAAGATAAGGCCATGTGTAAGATTTTCCCTAAAACTAGAATATATTAATGCATGTTTGAGAATTTT
 561 AAAGCACCATGGTCAAAACCAGAAGCTATATTTTGCATATTTGGACTCAGCCATCCATTAAGAACCCATGTTGTCCTCTG
 641 GACATATTTATCAATATAATTGGGTTTTAAATAGTATAAAAGAAAACTTGTGATCTATATAATTTATGTATCACCTTCAT
 721 TGTAAATTTAGCAGGAAATGCATCACAATTATGATTTTTTTTTTTGCACCAGTGAAACAATAAAGATGCTATTAACAAAA
 801 AAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugaUCGAAUAUGUAUUUUAAu 5'
             ||   ||:::|||:||| 
Target 5' ataAGGCCATGTGTAAGATTt 3'
499 - 519 138.00 -6.60
2
miRNA  3' ugaucGAAUAUGU---AUUUUAAu 5'
               || :| ||   |:|:||| 
Target 5' gttttCTAGTCCAGTTTGAGATTa 3'
415 - 438 116.00 -6.52
3
miRNA  3' ugaUCGAAUAUGUAUUUUAau 5'
             :||||   | |||| |  
Target 5' ttgGGCTTTCCCCTAAATTgc 3'
475 - 495 102.00 -5.52
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-590-3p :: VPS35    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
73 hsa-miR-590-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016158 GPATCH8 G patch domain containing 8 1 1
MIRT016159 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT016160 CHAF1A chromatin assembly factor 1, subunit A (p150) 1 1
MIRT016161 TMEM259 chromosome 19 open reading frame 6 1 1
MIRT016162 MTF1 metal-regulatory transcription factor 1 1 1
MIRT016163 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT016164 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT016165 FAM49B family with sequence similarity 49, member B 1 1
MIRT016166 CBX1 chromobox homolog 1 (HP1 beta homolog Drosophila ) 1 1
MIRT016167 CITED2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 1 1
MIRT016168 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 1
MIRT016169 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT016170 QTRTD1 queuine tRNA-ribosyltransferase domain containing 1 1 1
MIRT016171 SBDS Shwachman-Bodian-Diamond syndrome 1 1
MIRT016172 PNN pinin, desmosome associated protein 1 1
MIRT016173 TERF2IP telomeric repeat binding factor 2, interacting protein 1 1
MIRT016174 FAM210A chromosome 18 open reading frame 19 1 1
MIRT016175 SPATS2 spermatogenesis associated, serine-rich 2 1 1
MIRT016176 CSNK1D casein kinase 1, delta 1 1
MIRT016177 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT016178 NEO1 neogenin homolog 1 (chicken) 1 1
MIRT016179 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT016180 CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa 1 1
MIRT016181 PPP2R5A protein phosphatase 2, regulatory subunit B', alpha 1 1
MIRT016182 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT016183 SGCB sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) 1 1
MIRT016184 KAT6B MYST histone acetyltransferase (monocytic leukemia) 4 1 1
MIRT016185 MED13L mediator complex subunit 13-like 1 1
MIRT016186 GFPT1 glutamine--fructose-6-phosphate transaminase 1 1 1
MIRT016187 NCOA3 nuclear receptor coactivator 3 1 1
MIRT016188 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT016189 CDK1 cyclin-dependent kinase 1 1 1
MIRT016190 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 1
MIRT016191 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT016192 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT016193 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT016194 NEDD4 neural precursor cell expressed, developmentally down-regulated 4 1 1
MIRT016195 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT016196 USP6NL USP6 N-terminal like 1 1
MIRT016197 KCTD20 potassium channel tetramerisation domain containing 20 1 1
MIRT016198 FBXW7 F-box and WD repeat domain containing 7 1 1
MIRT016199 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT016200 FOXG1 forkhead box G1 1 1
MIRT016201 EFCAB14 KIAA0494 1 1
MIRT016202 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT016203 PGAP1 post-GPI attachment to proteins 1 1 1
MIRT016204 ANGEL2 angel homolog 2 (Drosophila) 1 1
MIRT016205 UBXN2A UBX domain protein 2A 1 1
MIRT016206 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT016207 PAPD4 PAP associated domain containing 4 1 1
MIRT016208 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT016209 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 1 1
MIRT016210 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT016211 ABHD17B family with sequence similarity 108, member B1 1 1
MIRT016212 ZBTB18 zinc finger protein 238 1 1
MIRT016213 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 1
MIRT016214 MRPL19 mitochondrial ribosomal protein L19 1 1
MIRT016215 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT016216 EXOC5 exocyst complex component 5 1 1
MIRT016217 KHSRP KH-type splicing regulatory protein 1 1
MIRT016218 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT016219 TMEM123 transmembrane protein 123 1 1
MIRT016220 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT016221 ATP13A3 ATPase type 13A3 1 1
MIRT016222 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT016223 TMX3 thioredoxin-related transmembrane protein 3 1 1
MIRT016224 REEP3 receptor accessory protein 3 1 1
MIRT016225 ATXN1 ataxin 1 1 1
MIRT016226 RBM12B RNA binding motif protein 12B 1 1
MIRT016227 SERTAD4 SERTA domain containing 4 1 1
MIRT016228 PRKAR2B protein kinase, cAMP-dependent, regulatory, type II, beta 1 1
MIRT016229 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT016230 SESN3 sestrin 3 1 1