Accession ID: MIRT016199 [miRNA, hsa-miR-590-3p :: VPS35, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-590LinkOut: [miRBase ]
Synonyms MIRN590, hsa-mir-590, MIR590
Description Homo sapiens miR-590 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-590-3p
Mature Sequence 56| UAAUUUUAUGUAUAAGCUAGU |76
Evidence Experimental
Experiments Cloned
Putative hsa-miR-590-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol VPS35 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MEM3, PARK17
Description vacuolar protein sorting 35 homolog (S. cerevisiae)
Transcript NM_018206    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on VPS35 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of VPS35
(miRNA target sites are highlighted)
>VPS35|NM_018206|3'UTR
   1 AAAGGAAATAGCTCACCATACTCCTTTCCATGTACATCCAGTGAGGGTTTTATTACGCTAGGTTTCCCTTCCATAGATTG
  81 TGCCTTTCAGAAATGCTGAGGTAGGTTTCCCATTTCTTACCTGTGATGTGTTTTACCCAGCACCTCCGGACACTCACCTT
 161 CAGGACCTTAATAAAATTATTCACTTGGTAAGTGTTCAAGTCTTTCTGATCACCCCAAGTAGCATGACTGATCTGCAATT
 241 TAAAATTCCTGTGATCTGTAAAAAAAAAAAAAAAAAAAAAAACAAAACCCACAAGCACTTATCTTGGCTACTAATGAAGC
 321 TCTCCTTTTTTTTGTTTGTTTGTTTGCTTCATTGTTGATTGTGTATTTTCTTCATTCCTGGGGAGTACTAACCCAAAAGC
 401 GTCTGTCTCTTGTTTTCTAGTCCAGTTTGAGATTAATTTAGAAGAAAGGAATACTGTATGTGAAATTCATCTTGGGCTTT
 481 CCCCTAAATTGCAAGATAAGGCCATGTGTAAGATTTTCCCTAAAACTAGAATATATTAATGCATGTTTGAGAATTTTAAA
 561 GCACCATGGTCAAAACCAGAAGCTATATTTTGCATATTTGGACTCAGCCATCCATTAAGAACCCATGTTGTCCTCTGGAC
 641 ATATTTATCAATATAATTGGGTTTTAAATAGTATAAAAGAAAACTTGTGATCTATATAATTTATGTATCACCTTCATTGT
 721 AAATTTAGCAGGAAATGCATCACAATTATGATTTTTTTTTTTGCACCAGTGAAACAATAAAGATGCTATTAACAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugaUCGAAUAUGUAUUUUAAu 5'
             ||   ||:::|||:||| 
Target 5' ataAGGCCATGTGTAAGATTt 3'
496 - 516 138.00 -6.60
2
miRNA  3' ugaucGAAUAUGU---AUUUUAAu 5'
               || :| ||   |:|:||| 
Target 5' gttttCTAGTCCAGTTTGAGATTa 3'
412 - 435 116.00 -6.52
3
miRNA  3' ugaUCGAAUAUGUAUUUUAau 5'
             :||||   | |||| |  
Target 5' ttgGGCTTTCCCCTAAATTgc 3'
472 - 492 102.00 -5.52
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-590-3p :: VPS35    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
362 hsa-miR-590-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016158 GPATCH8 G patch domain containing 8 1 1
MIRT016159 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT016160 CHAF1A chromatin assembly factor 1, subunit A (p150) 1 1
MIRT016161 TMEM259 chromosome 19 open reading frame 6 1 1
MIRT016162 MTF1 metal-regulatory transcription factor 1 1 1
MIRT016163 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT016164 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT016165 FAM49B family with sequence similarity 49, member B 1 1
MIRT016166 CBX1 chromobox homolog 1 1 1
MIRT016167 CITED2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 1 1
MIRT016168 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 1
MIRT016169 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT016170 QTRTD1 queuine tRNA-ribosyltransferase domain containing 1 1 1
MIRT016171 SBDS Shwachman-Bodian-Diamond syndrome 1 1
MIRT016172 PNN pinin, desmosome associated protein 1 1
MIRT016173 TERF2IP telomeric repeat binding factor 2, interacting protein 1 1
MIRT016174 FAM210A family with sequence similarity 210, member A 1 1
MIRT016175 SPATS2 spermatogenesis associated, serine-rich 2 1 1
MIRT016176 CSNK1D casein kinase 1, delta 1 1
MIRT016177 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT016178 NEO1 neogenin 1 1 2
MIRT016179 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT016180 CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa 1 1
MIRT016181 PPP2R5A protein phosphatase 2, regulatory subunit B', alpha 1 1
MIRT016182 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT016183 SGCB sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) 1 1
MIRT016184 KAT6B K(lysine) acetyltransferase 6B 1 1
MIRT016185 MED13L mediator complex subunit 13-like 1 1
MIRT016186 GFPT1 glutamine--fructose-6-phosphate transaminase 1 1 1
MIRT016187 NCOA3 nuclear receptor coactivator 3 1 1
MIRT016188 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT016189 CDK1 cyclin-dependent kinase 1 1 1
MIRT016190 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 1
MIRT016191 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT016192 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT016193 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT016194 NEDD4 neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase 1 1
MIRT016195 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT016196 USP6NL USP6 N-terminal like 1 1
MIRT016197 KCTD20 potassium channel tetramerisation domain containing 20 1 1
MIRT016198 FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase 1 1
MIRT016199 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT016200 FOXG1 forkhead box G1 1 1
MIRT016201 EFCAB14 KIAA0494 1 1
MIRT016202 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT016203 PGAP1 post-GPI attachment to proteins 1 1 1
MIRT016204 ANGEL2 angel homolog 2 (Drosophila) 1 1
MIRT016205 UBXN2A UBX domain protein 2A 1 1
MIRT016206 HAUS3 HAUS augmin-like complex, subunit 3 1 3
MIRT016207 PAPD4 PAP associated domain containing 4 1 1
MIRT016208 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT016209 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 1 1
MIRT016210 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT016211 ABHD17B family with sequence similarity 108, member B1 1 1
MIRT016212 ZBTB18 zinc finger protein 238 1 1
MIRT016213 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 1
MIRT016214 MRPL19 mitochondrial ribosomal protein L19 1 1
MIRT016215 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT016216 EXOC5 exocyst complex component 5 1 1
MIRT016217 KHSRP KH-type splicing regulatory protein 1 3
MIRT016218 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT016219 TMEM123 transmembrane protein 123 1 1
MIRT016220 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT016221 ATP13A3 ATPase type 13A3 1 1
MIRT016222 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT016223 TMX3 thioredoxin-related transmembrane protein 3 1 1
MIRT016224 REEP3 receptor accessory protein 3 1 1
MIRT016225 ATXN1 ataxin 1 1 1
MIRT016226 RBM12B RNA binding motif protein 12B 1 1
MIRT016227 SERTAD4 SERTA domain containing 4 1 1
MIRT016228 PRKAR2B protein kinase, cAMP-dependent, regulatory, type II, beta 1 1
MIRT016229 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT016230 SESN3 sestrin 3 1 1
MIRT056644 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 2
MIRT057759 HIAT1 hippocampus abundant transcript 1 1 1
MIRT058544 CTTNBP2NL CTTNBP2 N-terminal like 1 1
MIRT060729 RPS3 ribosomal protein S3 1 1
MIRT062184 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT066654 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT071767 RNF11 ring finger protein 11 1 1
MIRT078405 DCAF7 DDB1 and CUL4 associated factor 7 1 2
MIRT080020 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 1
MIRT081744 ZNF507 zinc finger protein 507 1 1
MIRT083155 SEC23B Sec23 homolog B (S. cerevisiae) 1 2
MIRT090774 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT091626 RPL15 ribosomal protein L15 1 2
MIRT092789 SETD5 SET domain containing 5 1 1
MIRT102659 UBN2 ubinuclein 2 1 1
MIRT103264 NUPL2 nucleoporin like 2 1 2
MIRT104173 PHTF2 putative homeodomain transcription factor 2 1 3
MIRT105327 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 3
MIRT109589 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT150165 MIDN midnolin 1 1
MIRT159605 PEX13 peroxisomal biogenesis factor 13 1 3
MIRT178772 RNF141 ring finger protein 141 1 2
MIRT180821 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 3
MIRT183618 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT192609 HYPK huntingtin interacting protein K 1 1
MIRT195883 DEPDC1 DEP domain containing 1 1 3
MIRT203134 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT204602 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204633 MOB4 MOB family member 4, phocein 1 4
MIRT209479 EIF4A2 eukaryotic translation initiation factor 4A2 1 4
MIRT213541 SCARB2 scavenger receptor class B, member 2 1 2
MIRT214647 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT216334 PAPD7 PAP associated domain containing 7 1 1
MIRT219198 CENPQ centromere protein Q 1 2
MIRT223404 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT227885 NFIB nuclear factor I/B 1 1
MIRT229986 CHIC1 cysteine-rich hydrophobic domain 1 1 1
MIRT230396 KIAA1462 KIAA1462 1 2
MIRT242220 TTC9 tetratricopeptide repeat domain 9 1 2
MIRT244041 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) 1 1
MIRT244277 TMEM30A transmembrane protein 30A 1 1
MIRT244503 TRPS1 trichorhinophalangeal syndrome I 1 1
MIRT271390 PYROXD1 pyridine nucleotide-disulphide oxidoreductase domain 1 1 1
MIRT272740 ALG10B asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) 1 1
MIRT276861 MZT1 mitotic spindle organizing protein 1 1 2
MIRT283827 ZNF75A zinc finger protein 75a 1 1
MIRT293285 DR1 down-regulator of transcription 1, TBP-binding (negative cofactor 2) 1 1
MIRT293385 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT294330 ZNF264 zinc finger protein 264 1 1
MIRT296533 STX16 syntaxin 16 1 1
MIRT303047 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT310521 YTHDC1 YTH domain containing 1 1 1
MIRT314110 CCNB1 cyclin B1 1 1
MIRT318833 EPHA7 EPH receptor A7 1 1
MIRT322697 BAG4 BCL2-associated athanogene 4 1 1
MIRT326891 NHS Nance-Horan syndrome (congenital cataracts and dental anomalies) 1 1
MIRT329287 TMEM33 transmembrane protein 33 1 1
MIRT337967 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT347916 ZNF260 zinc finger protein 260 1 1
MIRT347940 ZNF529 zinc finger protein 529 1 1
MIRT353824 PCYOX1 prenylcysteine oxidase 1 1 1
MIRT354445 LRRC58 leucine rich repeat containing 58 1 3
MIRT371238 LYRM7 LYR motif containing 7 1 1
MIRT406885 PTBP2 polypyrimidine tract binding protein 2 1 1
MIRT409071 NOM1 nucleolar protein with MIF4G domain 1 1 2
MIRT441495 TSC22D1 TSC22 domain family, member 1 1 1
MIRT441753 AGTPBP1 ATP/GTP binding protein 1 1 1
MIRT443183 DENND4C DENN/MADD domain containing 4C 1 1
MIRT443224 ARL5B ADP-ribosylation factor-like 5B 1 1
MIRT444305 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT444566 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT445649 ZFP37 zinc finger protein 37 homolog (mouse) 1 1
MIRT445844 KLHL31 kelch-like 31 (Drosophila) 1 1
MIRT446739 MYEF2 myelin expression factor 2 1 1
MIRT446792 KIF1C kinesin family member 1C 1 1
MIRT447373 NUP205 nucleoporin 205kDa 1 1
MIRT449508 TM6SF1 transmembrane 6 superfamily member 1 1 1
MIRT449865 POFUT2 protein O-fucosyltransferase 2 1 1
MIRT450228 PCNX pecanex homolog (Drosophila) 1 1
MIRT450378 RABGEF1 RAB guanine nucleotide exchange factor (GEF) 1 1 1
MIRT451643 FAM96A family with sequence similarity 96, member A 1 2
MIRT451725 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT452490 BANK1 B-cell scaffold protein with ankyrin repeats 1 1 8
MIRT453417 RAD51 RAD51 homolog (S. cerevisiae) 1 1
MIRT461348 NUP133 nucleoporin 133kDa 1 1
MIRT467282 SPNS1 spinster homolog 1 (Drosophila) 1 1
MIRT467390 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT473850 MAP2K6 mitogen-activated protein kinase kinase 6 1 1
MIRT478351 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT478387 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT480062 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT492622 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT494315 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT497090 PAH phenylalanine hydroxylase 1 1
MIRT503745 GPATCH11 coiled-coil domain containing 75 1 5
MIRT505760 SENP1 SUMO1/sentrin specific peptidase 1 1 3
MIRT506140 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 3
MIRT507097 GPCPD1 glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) 1 1
MIRT507398 EMC7 ER membrane protein complex subunit 7 1 4
MIRT508339 TET2 tet methylcytosine dioxygenase 2 1 2
MIRT508369 ITPRIPL1 inositol 1,4,5-trisphosphate receptor interacting protein-like 1 1 5
MIRT510743 SLC8A1 solute carrier family 8 (sodium/calcium exchanger), member 1 1 2
MIRT514173 PGPEP1 pyroglutamyl-peptidase I 1 1
MIRT514275 ZNF519 zinc finger protein 519 1 1
MIRT514530 GDPGP1 GDP-D-glucose phosphorylase 1 1 1
MIRT514798 SLC25A45 solute carrier family 25, member 45 1 1
MIRT514942 GPR141 G protein-coupled receptor 141 1 1
MIRT515347 CXorf36 chromosome X open reading frame 36 1 1
MIRT515597 FBXL13 F-box and leucine-rich repeat protein 13 1 2
MIRT515812 ALOX5AP arachidonate 5-lipoxygenase-activating protein 1 1
MIRT516011 GPN2 GPN-loop GTPase 2 1 1
MIRT516225 RAB3B RAB3B, member RAS oncogene family 1 2
MIRT516658 PIGP phosphatidylinositol glycan anchor biosynthesis, class P 1 1
MIRT516914 CTSB cathepsin B 1 2
MIRT517113 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT517157 VHLL von Hippel-Lindau tumor suppressor-like 1 1
MIRT517269 NRIP2 nuclear receptor interacting protein 2 1 1
MIRT517663 TRIM72 tripartite motif containing 72 1 2
MIRT517768 ZNF366 zinc finger protein 366 1 1
MIRT517968 ZMIZ2 zinc finger, MIZ-type containing 2 1 1
MIRT518030 ABHD15 abhydrolase domain containing 15 1 1
MIRT518355 CCL5 chemokine (C-C motif) ligand 5 1 1
MIRT518365 THAP8 THAP domain containing 8 1 1
MIRT518489 C8orf37 chromosome 8 open reading frame 37 1 1
MIRT518500 FAM161B family with sequence similarity 161, member B 1 1
MIRT518523 CASP10 caspase 10, apoptosis-related cysteine peptidase 1 1
MIRT518613 FARSB phenylalanyl-tRNA synthetase, beta subunit 1 1
MIRT519016 NOA1 nitric oxide associated 1 1 1
MIRT519348 CACNG1 calcium channel, voltage-dependent, gamma subunit 1 1 2
MIRT519493 PNPLA3 patatin-like phospholipase domain containing 3 1 1
MIRT519568 MRPS10 mitochondrial ribosomal protein S10 1 1
MIRT520932 SSBP2 single-stranded DNA binding protein 2 1 1
MIRT521063 SLC25A32 solute carrier family 25 (mitochondrial folate carrier) , member 32 1 3
MIRT521096 SLC24A2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 1
MIRT521946 PHC3 polyhomeotic homolog 3 (Drosophila) 1 1
MIRT522248 NPFFR1 neuropeptide FF receptor 1 1 1
MIRT522571 MBTD1 mbt domain containing 1 1 3
MIRT522655 MANEAL mannosidase, endo-alpha-like 1 1
MIRT523541 GLO1 glyoxalase I 1 2
MIRT523572 GGCX gamma-glutamyl carboxylase 1 1
MIRT524139 DMXL1 Dmx-like 1 1 1
MIRT525351 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 1
MIRT526513 POU5F1B POU class 5 homeobox 1B 1 1
MIRT527745 DCAF16 DDB1 and CUL4 associated factor 16 1 1
MIRT527841 NUPL1 nucleoporin like 1 1 1
MIRT528228 METTL8 methyltransferase like 8 1 1
MIRT528746 RAB13 RAB13, member RAS oncogene family 1 1
MIRT529056 KRBOX4 zinc finger family member 673 1 1
MIRT529388 SKP1 S-phase kinase-associated protein 1 1 1
MIRT529442 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT531332 SEMA3D sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D 1 1
MIRT531664 ZFP14 zinc finger protein 14 homolog (mouse) 1 1
MIRT532339 TTR transthyretin 1 1
MIRT532707 TCN2 transcobalamin II 1 2
MIRT534084 SPRY4 sprouty homolog 4 (Drosophila) 1 1
MIRT535223 PIWIL2 piwi-like 2 (Drosophila) 1 1
MIRT535245 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 2
MIRT536008 MED13 mediator complex subunit 13 1 1
MIRT536130 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT536564 JMJD1C jumonji domain containing 1C 1 1
MIRT536584 ITPKB inositol-trisphosphate 3-kinase B 1 1
MIRT537676 EPB41L1 erythrocyte membrane protein band 4.1-like 1 1 1
MIRT538029 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT538806 C2CD5 KIAA0528 1 1
MIRT538827 C16orf87 chromosome 16 open reading frame 87 1 1
MIRT543104 TNFRSF11A tumor necrosis factor receptor superfamily, member 11a, NFKB activator 1 1
MIRT543493 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 1
MIRT544834 ZNF639 zinc finger protein 639 1 1
MIRT546472 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT547415 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT548952 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT549700 RBM23 RNA binding motif protein 23 1 2
MIRT550053 RSRC1 arginine/serine-rich coiled-coil 1 1 1
MIRT550235 DSN1 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT550544 MYZAP myocardial zonula adherens protein 1 1
MIRT551638 TRUB1 TruB pseudouridine (psi) synthase homolog 1 (E. coli) 1 2
MIRT553008 USP38 ubiquitin specific peptidase 38 1 1
MIRT553726 TBX18 T-box 18 1 1
MIRT554312 SIAH2 siah E3 ubiquitin protein ligase 2 1 2
MIRT554769 RHOB ras homolog family member B 1 1
MIRT557253 CRAMP1L Crm, cramped-like (Drosophila) 1 1
MIRT560028 ZNF780A zinc finger protein 780A 1 1
MIRT560033 TMEM120B transmembrane protein 120B 1 1
MIRT560151 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT561166 TNFSF14 tumor necrosis factor (ligand) superfamily, member 14 1 1
MIRT561787 PAWR PRKC, apoptosis, WT1, regulator 1 1
MIRT562447 DCTN6 dynactin 6 1 1
MIRT562799 NDUFA12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 1 1
MIRT562867 PBOV1 prostate and breast cancer overexpressed 1 1 1
MIRT563715 SVIP small VCP/p97-interacting protein 1 2
MIRT563785 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT564977 WTAP Wilms tumor 1 associated protein 1 1
MIRT566739 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT567605 FANCF Fanconi anemia, complementation group F 1 1
MIRT609961 ATF7IP2 activating transcription factor 7 interacting protein 2 1 1
MIRT611762 PLA2G7 phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) 1 3
MIRT613450 LUC7L2 LUC7-like 2 (S. cerevisiae) 1 2
MIRT613679 SH3KBP1 SH3-domain kinase binding protein 1 1 1
MIRT614099 PDE4C phosphodiesterase 4C, cAMP-specific 1 1
MIRT614113 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 1 2
MIRT614725 TEAD3 TEA domain family member 3 1 1
MIRT614826 PVRL4 poliovirus receptor-related 4 1 1
MIRT615594 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 1
MIRT615776 FSD2 fibronectin type III and SPRY domain containing 2 1 1
MIRT615915 C1orf27 chromosome 1 open reading frame 27 1 1
MIRT615925 SLC25A4 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 1 1
MIRT616776 KANSL1L KAT8 regulatory NSL complex subunit 1-like 1 1
MIRT619324 PIGM phosphatidylinositol glycan anchor biosynthesis, class M 1 1
MIRT622445 RNF217 ring finger protein 217 1 1
MIRT622755 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT624018 ENAH enabled homolog (Drosophila) 1 1
MIRT624808 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 1 1
MIRT625179 GRIK4 glutamate receptor, ionotropic, kainate 4 1 1
MIRT635636 PRR15L proline rich 15-like 1 1
MIRT635960 SSPN sarcospan 1 1
MIRT636132 YIPF4 Yip1 domain family, member 4 1 1
MIRT636995 PLEKHA2 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 1 1
MIRT637374 ZNF383 zinc finger protein 383 1 1
MIRT639456 CTNNBL1 catenin, beta like 1 1 1
MIRT639556 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT639751 FAM8A1 family with sequence similarity 8, member A1 1 1
MIRT639787 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT639968 PRKD2 protein kinase D2 1 1
MIRT640289 SPIC Spi-C transcription factor (Spi-1/PU.1 related) 1 1
MIRT640836 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT640866 TSHZ2 teashirt zinc finger homeobox 2 1 2
MIRT641005 SLC35E4 solute carrier family 35, member E4 1 1
MIRT641719 THG1L tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) 1 1
MIRT642035 MXI1 MAX interactor 1 1 1
MIRT645608 PCDH11X protocadherin 11 X-linked 1 1
MIRT646632 SLC25A46 solute carrier family 25, member 46 1 1
MIRT649952 IREB2 iron-responsive element binding protein 2 1 1
MIRT653176 SPPL3 signal peptide peptidase like 3 1 1
MIRT653307 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 1
MIRT654072 RWDD1 RWD domain containing 1 1 1
MIRT655190 PHEX phosphate regulating endopeptidase homolog, X-linked 1 1
MIRT655355 PCDH11Y protocadherin 11 Y-linked 1 1
MIRT655646 OIP5 Opa interacting protein 5 1 1
MIRT657330 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT657768 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT658129 FNBP1L formin binding protein 1-like 1 1
MIRT666587 RHOBTB3 Rho-related BTB domain containing 3 1 1
MIRT667665 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT667741 KIAA0930 KIAA0930 1 1
MIRT669615 AEBP2 AE binding protein 2 1 1
MIRT670043 NFRKB nuclear factor related to kappaB binding protein 1 1
MIRT670879 RAB10 RAB10, member RAS oncogene family 1 1
MIRT673358 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT683235 ERVV-1 endogenous retrovirus group V, member 1 1 1
MIRT684221 C9orf64 chromosome 9 open reading frame 64 1 1
MIRT687721 KIAA1614 KIAA1614 1 1
MIRT688362 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT691462 C21orf58 chromosome 21 open reading frame 58 1 1
MIRT691959 RHOH ras homolog family member H 1 1
MIRT691990 TTC38 tetratricopeptide repeat domain 38 1 1
MIRT693029 LINC00632 uncharacterized LOC286411 1 1
MIRT693189 NPR1 natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) 1 1
MIRT695097 CHRNB1 cholinergic receptor, nicotinic, beta 1 (muscle) 1 1
MIRT695301 TK1 thymidine kinase 1, soluble 1 1
MIRT696153 WDR59 WD repeat domain 59 1 1
MIRT697684 WASL Wiskott-Aldrich syndrome-like 1 1
MIRT698458 TLCD2 TLC domain containing 2 1 1
MIRT700642 PQLC2 PQ loop repeat containing 2 1 1
MIRT701424 NHLRC2 NHL repeat containing 2 1 1
MIRT702038 MOGAT1 monoacylglycerol O-acyltransferase 1 1 1
MIRT703069 GSR glutathione reductase 1 1
MIRT705018 CAMK2N1 calcium/calmodulin-dependent protein kinase II inhibitor 1 1 1
MIRT705038 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT707934 PPP1R3D protein phosphatase 1, regulatory subunit 3D 1 1
MIRT709600 IFT74 intraflagellar transport 74 homolog (Chlamydomonas) 1 1
MIRT709733 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 1 1
MIRT710297 SPN sialophorin 1 1
MIRT710747 ZNF71 zinc finger protein 71 1 1
MIRT711840 AMOTL2 angiomotin like 2 1 1
MIRT712642 ARL14EPL ADP-ribosylation factor-like 14 effector protein-like 1 1
MIRT713763 NCKAP1 NCK-associated protein 1 1 1
MIRT714432 SNED1 sushi, nidogen and EGF-like domains 1 1 1
MIRT715817 NUDT7 nudix (nucleoside diphosphate linked moiety X)-type motif 7 1 1
MIRT718563 MUC20 mucin 20, cell surface associated 1 1
MIRT719035 ARPC2 actin related protein 2/3 complex, subunit 2, 34kDa 1 1
MIRT719506 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT721540 DKK3 dickkopf 3 homolog (Xenopus laevis) 1 1
MIRT722654 SIGLEC14 sialic acid binding Ig-like lectin 14 1 1
MIRT722666 VKORC1L1 vitamin K epoxide reductase complex, subunit 1-like 1 1 1
MIRT723913 PEX11A peroxisomal biogenesis factor 11 alpha 1 1
MIRT724022 LMBRD2 LMBR1 domain containing 2 1 1
MIRT724047 SMIM14 chromosome 4 open reading frame 34 1 1
MIRT724330 C19orf52 chromosome 19 open reading frame 52 1 1
MIRT724877 MAPK14 mitogen-activated protein kinase 14 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*