Accession ID: MIRT016516 [miRNA, hsa-miR-193b-3p :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-193bLinkOut: [miRBase ]
Description Homo sapiens miR-193b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-193b-3p
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-193b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_033360    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
(miRNA target sites are highlighted)
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
               ||:| |  |||||||| 
Target 5' taaaaGATTATTTGGGCCAGTt 3'
1060 - 1081 157.00 -17.70
            ||||::||     ||  ||||||  
2571 - 2597 140.00 -21.90
miRNA  3' ucgcccugaAAC-UCCCGGUCaa 5'
                   ||| | ||||||  
Target 5' agaccaaggTTGCAAGGCCAGgc 3'
1103 - 1125 129.00 -11.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-193b-3p :: KRAS    [ Functional MTI ]
Validation Method Microarray
Article - Chen, J. Feilotter, H. E. Pare, G. C. et al.
- Am J Pathol, 2010
Cutaneous melanoma is an aggressive form of human skin cancer characterized by high metastatic potential and poor prognosis. To better understand the role of microRNAs (miRNAs) in melanoma, the expression of 470 miRNAs was profiled in tissue samples from benign nevi and metastatic melanomas. We identified 31 miRNAs that were differentially expressed (13 up-regulated and 18 down-regulated) in metastatic melanomas relative to benign nevi. Notably, miR-193b was significantly down-regulated in the melanoma tissues examined. To understand the role of miR-193b in melanoma, functional studies were undertaken. Overexpression of miR-193b in melanoma cell lines repressed cell proliferation. Gene expression profiling identified 314 genes down-regulated by overexpression of miR-193b in Malme-3M cells. Eighteen of these down-regulated genes, including cyclin D1 (CCND1), were also identified as putative miR-193b targets by TargetScan. Overexpression of miR-193b in Malme-3M cells down-regulated CCND1 mRNA and protein by >/=50%. A luciferase reporter assay confirmed that miR-193b directly regulates CCND1 by binding to the 3'untranslated region of CCND1 mRNA. These studies indicate that miR-193b represses cell proliferation and regulates CCND1 expression and suggest that dysregulation of miR-193b may play an important role in melanoma development.
LinkOut: [PMID: 20304954]
CLIP-seq Support 1 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000256078.4 | 3UTR | UUUUUUUUUCCUCUAAGUGCCAGUAUUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

MiRNA-Target Expression Profile(TCGA):

MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
851 hsa-miR-193b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000480 CCND1 cyclin D1 6 3
MIRT000701 ESR1 estrogen receptor 1 3 1
MIRT004413 PLAU plasminogen activator, urokinase 6 3
MIRT004414 PRAP1 proline-rich acidic protein 1 2 2
MIRT004663 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 5 3
MIRT005516 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 4 1
MIRT006983 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 3 3
MIRT006985 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 4 3
MIRT006986 AKR1C2 aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III) 2 1
MIRT016262 CHDH choline dehydrogenase 1 1
MIRT016264 SGOL1 shugoshin-like 1 (S. pombe) 1 1
MIRT016265 CENPJ centromere protein J 1 1
MIRT016266 SHMT1 serine hydroxymethyltransferase 1 (soluble) 1 1
MIRT016267 KIF22 kinesin family member 22 1 1
MIRT016268 OIP5 Opa interacting protein 5 1 1
MIRT016269 NCAPH2 non-SMC condensin II complex, subunit H2 1 1
MIRT016270 DLX1 distal-less homeobox 1 1 1
MIRT016271 EPPK1 epiplakin 1 1 1
MIRT016272 BASP1 brain abundant, membrane attached signal protein 1 1 1
MIRT016273 MCCC2 methylcrotonoyl-CoA carboxylase 2 (beta) 1 1
MIRT016274 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT016275 CCP110 centriolar coiled coil protein 110kDa 1 1
MIRT016276 PDXDC1 pyridoxal-dependent decarboxylase domain containing 1 1 1
MIRT016277 GSG2 germ cell associated 2 (haspin) 2 2
MIRT016278 RFC5 replication factor C (activator 1) 5, 36.5kDa 1 1
MIRT016279 LRR1 leucine rich repeat protein 1 1 1
MIRT016280 MRPL42 mitochondrial ribosomal protein L42 1 1
MIRT016281 RRM2 ribonucleotide reductase M2 2 2
MIRT016282 POLA1 polymerase (DNA directed), alpha 1, catalytic subunit 1 1
MIRT016283 BARD1 BRCA1 associated RING domain 1 1 1
MIRT016284 PCNT pericentrin 1 1
MIRT016285 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT016286 ORC6 origin recognition complex, subunit 6 1 1
MIRT016287 FANCA Fanconi anemia, complementation group A 1 1
MIRT016288 RAB5C RAB5C, member RAS oncogene family 1 1
MIRT016289 NOSIP nitric oxide synthase interacting protein 1 1
MIRT016290 FAM111A family with sequence similarity 111, member A 1 1
MIRT016291 AIMP2 aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 1 1
MIRT016292 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT016293 PSIP1 PC4 and SFRS1 interacting protein 1 2 2
MIRT016294 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT016295 STRADB STE20-related kinase adaptor beta 1 1
MIRT016296 DLEU2 deleted in lymphocytic leukemia 2 (non-protein coding) 1 1
MIRT016297 ERRFI1 ERBB receptor feedback inhibitor 1 1 1
MIRT016298 MLF1IP MLF1 interacting protein 1 1
MIRT016299 PRDX3 peroxiredoxin 3 1 1
MIRT016300 A4GALT alpha 1,4-galactosyltransferase 1 1
MIRT016301 SMCO4 chromosome 11 open reading frame 75 1 1
MIRT016302 NUCB1 nucleobindin 1 1 1
MIRT016303 DONSON downstream neighbor of SON 1 1
MIRT016304 KRT19 keratin 19 1 1
MIRT016305 HMGB1 high mobility group box 1 1 1
MIRT016306 HYOU1 hypoxia up-regulated 1 2 2
MIRT016307 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT016308 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT016309 TECR trans-2,3-enoyl-CoA reductase 1 1
MIRT016310 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT016311 FANCI Fanconi anemia, complementation group I 1 1
MIRT016312 EXO1 exonuclease 1 1 1
MIRT016313 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT016314 MCM3 minichromosome maintenance complex component 3 1 1
MIRT016315 MCM10 minichromosome maintenance complex component 10 2 2
MIRT016316 EIF3I eukaryotic translation initiation factor 3, subunit I 2 2
MIRT016317 KNTC1 kinetochore associated 1 1 1
MIRT016318 MYLK myosin light chain kinase 1 1
MIRT016319 LASP1 LIM and SH3 protein 1 1 1
MIRT016320 C16orf59 chromosome 16 open reading frame 59 1 1
MIRT016321 FAM132B family with sequence similarity 132, member B 1 1
MIRT016322 GPATCH11 coiled-coil domain containing 75 1 1
MIRT016323 HELLS helicase, lymphoid-specific 1 1
MIRT016324 MTFR2 family with sequence similarity 54, member A 1 1
MIRT016325 LRRC40 leucine rich repeat containing 40 1 1
MIRT016326 VAV3 vav 3 guanine nucleotide exchange factor 1 1
MIRT016327 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT016328 NUPL1 nucleoporin like 1 1 1
MIRT016329 CLSTN1 calsyntenin 1 1 1
MIRT016330 PHLDA2 pleckstrin homology-like domain, family A, member 2 2 2
MIRT016331 FAM109B family with sequence similarity 109, member B 1 1
MIRT016332 EFHD1 EF-hand domain family, member D1 1 1
MIRT016333 ADCY9 adenylate cyclase 9 1 1
MIRT016334 PHF16 PHD finger protein 16 1 1
MIRT016335 PCYOX1L prenylcysteine oxidase 1 like 1 1
MIRT016336 STARD7 StAR-related lipid transfer (START) domain containing 7 2 4
MIRT016337 ZNF512B zinc finger protein 512B 2 2
MIRT016338 HHAT hedgehog acyltransferase 1 1
MIRT016339 STMN1 stathmin 1 1 1
MIRT016340 ZNF618 zinc finger protein 618 1 1
MIRT016341 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase, type II, gamma 1 1
MIRT016342 PSRC1 proline/serine-rich coiled-coil 1 1 1
MIRT016343 LEF1 lymphoid enhancer-binding factor 1 1 1
MIRT016344 PLXNC1 plexin C1 1 1
MIRT016345 ATOH8 atonal homolog 8 (Drosophila) 1 1
MIRT016346 PKMYT1 protein kinase, membrane associated tyrosine/threonine 1 1 1
MIRT016347 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT016348 RAVER1 ribonucleoprotein, PTB-binding 1 1 1
MIRT016349 TRIP13 thyroid hormone receptor interactor 13 1 1
MIRT016350 NFKB2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) 1 1
MIRT016351 NSG1 neuron specific gene family member 1 1 1
MIRT016352 RFC4 replication factor C (activator 1) 4, 37kDa 1 1
MIRT016353 NDC80 NDC80 kinetochore complex component homolog (S. cerevisiae) 1 1
MIRT016354 MRPS9 mitochondrial ribosomal protein S9 1 1
MIRT016355 LMCD1 LIM and cysteine-rich domains 1 1 1
MIRT016356 PM20D2 peptidase M20 domain containing 2 1 1
MIRT016357 TK1 thymidine kinase 1, soluble 1 1
MIRT016358 GJB2 gap junction protein, beta 2, 26kDa 1 1
MIRT016359 DSN1 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT016360 SETD8 SET domain containing (lysine methyltransferase) 8 1 1
MIRT016361 DHFRP1 dihydrofolate reductase pseudogene 1 1 1
MIRT016362 ACTN1 actinin, alpha 1 1 1
MIRT016363 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT016364 DUT deoxyuridine triphosphatase 1 1
MIRT016365 TMEM204 transmembrane protein 204 1 1
MIRT016366 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT016367 RBBP5 retinoblastoma binding protein 5 1 1
MIRT016368 PLIN3 perilipin 3 1 1
MIRT016369 CEP44 centrosomal protein 44kDa 1 1
MIRT016370 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT016371 TERT telomerase reverse transcriptase 1 1
MIRT016372 CYTH1 cytohesin 1 1 1
MIRT016373 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT016374 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT016375 EPHA2 EPH receptor A2 1 1
MIRT016376 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT016377 KBTBD11 kelch repeat and BTB (POZ) domain containing 11 1 1
MIRT016378 FANCE Fanconi anemia, complementation group E 1 1
MIRT016379 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 1 1
MIRT016380 SKA1 spindle and kinetochore associated complex subunit 1 1 1
MIRT016381 AUNIP aurora kinase A and ninein interacting protein 1 1
MIRT016382 KIF11 kinesin family member 11 1 1
MIRT016383 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT016384 S100A14 S100 calcium binding protein A14 1 1
MIRT016385 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT016386 BUB1B budding uninhibited by benzimidazoles 1 homolog beta (yeast) 2 2
MIRT016387 RASSF3 Ras association (RalGDS/AF-6) domain family member 3 1 1
MIRT016388 PPA2 pyrophosphatase (inorganic) 2 1 1
MIRT016389 ADI1 acireductone dioxygenase 1 1 1
MIRT016390 PRPF40B PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae) 1 1
MIRT016391 MELK maternal embryonic leucine zipper kinase 1 1
MIRT016392 PSMC3IP PSMC3 interacting protein 1 1
MIRT016393 NCAPH non-SMC condensin I complex, subunit H 1 1
MIRT016394 ZNF823 zinc finger protein 823 1 1
MIRT016395 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT016396 HSBP1P2 heat shock factor binding protein 1 pseudogene 2 1 1
MIRT016397 WHSC1 Wolf-Hirschhorn syndrome candidate 1 2 2
MIRT016398 NPPC natriuretic peptide C 1 1
MIRT016399 CHAF1B chromatin assembly factor 1, subunit B (p60) 1 1
MIRT016400 GINS2 GINS complex subunit 2 (Psf2 homolog) 1 1
MIRT016401 POLQ polymerase (DNA directed), theta 1 1
MIRT016402 C11orf24 chromosome 11 open reading frame 24 1 1
MIRT016403 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT016404 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT016405 FANCG Fanconi anemia, complementation group G 1 1
MIRT016406 VASP vasodilator-stimulated phosphoprotein 1 1
MIRT016407 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT016408 CASP9 caspase 9, apoptosis-related cysteine peptidase 1 1
MIRT016409 MAT2A methionine adenosyltransferase II, alpha 1 1
MIRT016410 CDCA7 cell division cycle associated 7 1 1
MIRT016411 DDB1 damage-specific DNA binding protein 1, 127kDa 1 1
MIRT016412 HPRT1 hypoxanthine phosphoribosyltransferase 1 1 1
MIRT016413 NMD3 NMD3 homolog (S. cerevisiae) 1 1
MIRT016414 ESYT2 extended synaptotagmin-like protein 2 1 1
MIRT016415 SURF4 surfeit 4 1 1
MIRT016416 GLO1 glyoxalase I 1 1
MIRT016417 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT016418 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT016419 ARNTL2 aryl hydrocarbon receptor nuclear translocator-like 2 1 1
MIRT016420 E2F6 E2F transcription factor 6 1 1
MIRT016421 EIF4B eukaryotic translation initiation factor 4B 2 2
MIRT016422 CDC42EP4 CDC42 effector protein (Rho GTPase binding) 4 1 1
MIRT016423 PLEK2 pleckstrin 2 1 1
MIRT016424 SEPN1 selenoprotein N, 1 1 1
MIRT016425 SLC35D2 solute carrier family 35, member D2 1 1
MIRT016426 PRNP prion protein 1 1
MIRT016427 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT016428 SESN2 sestrin 2 1 1
MIRT016429 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT016430 FAM20B family with sequence similarity 20, member B 1 1
MIRT016431 TMEM164 transmembrane protein 164 1 1
MIRT016432 LOXL1 lysyl oxidase-like 1 1 1
MIRT016433 ZNF365 zinc finger protein 365 1 1
MIRT016434 PITPNB phosphatidylinositol transfer protein, beta 1 1
MIRT016435 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT016436 MAX MYC associated factor X 4 2
MIRT016437 AP5M1 adaptor-related protein complex 5, mu 1 subunit 1 1
MIRT016438 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT016439 RECQL4 RecQ protein-like 4 1 1
MIRT016440 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 1 1
MIRT016441 CCDC77 coiled-coil domain containing 77 1 1
MIRT016442 CDK1 cyclin-dependent kinase 1 1 1
MIRT016443 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT016444 CENPQ centromere protein Q 1 1
MIRT016445 SHCBP1 SHC SH2-domain binding protein 1 1 1
MIRT016446 PTMS parathymosin 1 1
MIRT016447 CHTF18 CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae) 1 1
MIRT016448 NHLRC2 NHL repeat containing 2 1 1
MIRT016449 RTKN2 rhotekin 2 1 1
MIRT016450 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT016451 LOC391247 GINS complex subunit 2 (Psf2 homolog) pseudogene 1 1
MIRT016452 EPDR1 ependymin related protein 1 (zebrafish) 1 1
MIRT016453 KIAA0101 KIAA0101 1 1
MIRT016454 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT016455 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT016456 DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 1 1
MIRT016457 PFDN2 prefoldin subunit 2 1 1
MIRT016458 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT016459 CDCA2 cell division cycle associated 2 1 1
MIRT016460 SFXN2 sideroflexin 2 1 1
MIRT016461 SIX1 SIX homeobox 1 1 1
MIRT016462 MND1 meiotic nuclear divisions 1 homolog (S. cerevisiae) 1 1
MIRT016463 MPST mercaptopyruvate sulfurtransferase 1 1
MIRT016464 NSDHL NAD(P) dependent steroid dehydrogenase-like 1 1
MIRT016465 IDI1 isopentenyl-diphosphate delta isomerase 1 1 1
MIRT016466 PTGES2 prostaglandin E synthase 2 1 1
MIRT016467 ITPKA inositol-trisphosphate 3-kinase A 1 1
MIRT016468 NLRP3 NLR family, pyrin domain containing 3 1 1
MIRT016469 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 1 1
MIRT016470 DSCC1 defective in sister chromatid cohesion 1 homolog (S. cerevisiae) 1 1
MIRT016471 COPRS chromosome 17 open reading frame 79 1 1
MIRT016472 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT016473 TOP2A topoisomerase (DNA) II alpha 170kDa 1 1
MIRT016474 FANCM Fanconi anemia, complementation group M 1 1
MIRT016475 CBX1 chromobox homolog 1 1 1
MIRT016476 SEPHS1 selenophosphate synthetase 1 1 1
MIRT016477 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT016478 ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 1 1
MIRT016479 C1QTNF2 C1q and tumor necrosis factor related protein 2 1 1
MIRT016480 TUBB3 tubulin, beta 3 class III 2 2
MIRT016481 TBC1D1 TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 1 1
MIRT016482 DDX21 DEAD (Asp-Glu-Ala-Asp) box helicase 21 1 1
MIRT016483 CEP41 centrosomal protein 41kDa 1 1
MIRT016484 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT016485 TYMS thymidylate synthetase 1 1
MIRT016486 C1orf112 chromosome 1 open reading frame 112 1 1
MIRT016487 RBM8A RNA binding motif protein 8A 2 2
MIRT016488 CDCA5 cell division cycle associated 5 1 1
MIRT016489 TMC8 transmembrane channel-like 8 1 1
MIRT016490 POLE polymerase (DNA directed), epsilon, catalytic subunit 1 1
MIRT016491 ZNF395 zinc finger protein 395 1 1
MIRT016492 TYW3 tRNA-yW synthesizing protein 3 homolog (S. cerevisiae) 1 1
MIRT016493 CHST14 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 1 1
MIRT016494 AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) 1 1
MIRT016495 TJP2 tight junction protein 2 1 1
MIRT016496 BRCA1 breast cancer 1, early onset 1 1
MIRT016497 TICRR TOPBP1-interacting checkpoint and replication regulator 1 1
MIRT016498 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT016499 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT016500 SULF2 sulfatase 2 1 1
MIRT016501 WWTR1 WW domain containing transcription regulator 1 1 1
MIRT016502 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT016503 CHEK1 checkpoint kinase 1 1 1
MIRT016504 WDR62 WD repeat domain 62 1 1
MIRT016505 HN1L hematological and neurological expressed 1-like 1 1
MIRT016506 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 1 1
MIRT016507 UGP2 UDP-glucose pyrophosphorylase 2 1 1
MIRT016508 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT016509 CKAP2L cytoskeleton associated protein 2-like 1 1
MIRT016510 MAPK8 mitogen-activated protein kinase 8 2 3
MIRT016511 SEC61A1 Sec61 alpha 1 subunit (S. cerevisiae) 1 1
MIRT016512 ACPL2 acid phosphatase-like 2 1 1
MIRT016513 CDK6 cyclin-dependent kinase 6 1 1
MIRT016514 ELMO2 engulfment and cell motility 2 2 2
MIRT016515 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT016516 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 5 3
MIRT016517 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 1 1
MIRT016518 MCM5 minichromosome maintenance complex component 5 2 2
MIRT016519 DCAF7 DDB1 and CUL4 associated factor 7 2 4
MIRT016520 ABI2 abl-interactor 2 2 2
MIRT016521 MCM7 minichromosome maintenance complex component 7 2 2
MIRT016522 VAMP8 vesicle-associated membrane protein 8 2 2
MIRT016523 CDC6 cell division cycle 6 homolog (S. cerevisiae) 1 1
MIRT016524 FBXO5 F-box protein 5 1 1
MIRT016525 DAZAP2 DAZ associated protein 2 1 1
MIRT016526 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT016527 MSANTD3 Myb/SANT-like DNA-binding domain containing 3 1 1
MIRT016528 PCNA proliferating cell nuclear antigen 1 1
MIRT016529 E2F1 E2F transcription factor 1 1 1
MIRT016530 S100A16 S100 calcium binding protein A16 1 1
MIRT016531 RCC1 regulator of chromosome condensation 1 2 2
MIRT016532 BORA bora, aurora kinase A activator 1 1
MIRT016533 MRPL4 mitochondrial ribosomal protein L4 2 2
MIRT016534 CDT1 chromatin licensing and DNA replication factor 1 1 1
MIRT016535 C5 complement component 5 1 1
MIRT016536 C15orf57 chromosome 15 open reading frame 57 1 1
MIRT016537 APOBEC3B apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B 1 1
MIRT016538 EFS embryonal Fyn-associated substrate 1 1
MIRT016539 NUCB2 nucleobindin 2 1 1
MIRT016540 PKN3 protein kinase N3 1 1
MIRT016541 TMED2 transmembrane emp24 domain trafficking protein 2 1 1
MIRT016542 ENOX2 ecto-NOX disulfide-thiol exchanger 2 1 1
MIRT016543 HAUS8 HAUS augmin-like complex, subunit 8 1 1
MIRT016544 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT016545 HIST1H1D histone cluster 1, H1d 1 1
MIRT016546 ARHGAP11A Rho GTPase activating protein 11A 1 1
MIRT016547 KANK2 KN motif and ankyrin repeat domains 2 1 1
MIRT016548 SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 1 1
MIRT016549 PRRC1 proline-rich coiled-coil 1 1 1
MIRT016550 MAP7D3 MAP7 domain containing 3 1 1
MIRT016551 COTL1 coactosin-like 1 (Dictyostelium) 1 1
MIRT016552 TM7SF2 transmembrane 7 superfamily member 2 1 1
MIRT016553 MCM8 minichromosome maintenance complex component 8 1 1
MIRT016554 POLE2 polymerase (DNA directed), epsilon 2, accessory subunit 1 1
MIRT016555 CLIC4 chloride intracellular channel 4 1 1
MIRT016556 CCNA2 cyclin A2 1 1
MIRT016557 HEATR6 HEAT repeat containing 6 1 1
MIRT016558 SPC25 SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT016559 APCDD1 adenomatosis polyposis coli down-regulated 1 1 1
MIRT016560 SLC35G1 solute carrier family 35, member G1 1 1
MIRT016561 EPHX1 epoxide hydrolase 1, microsomal (xenobiotic) 1 1
MIRT016562 KIF15 kinesin family member 15 1 1
MIRT016563 ELK3 ELK3, ETS-domain protein (SRF accessory protein 2) 1 1
MIRT016564 SEC23A Sec23 homolog A (S. cerevisiae) 1 1
MIRT016565 CDC37 cell division cycle 37 homolog (S. cerevisiae) 1 1
MIRT016566 TACC3 transforming, acidic coiled-coil containing protein 3 2 2
MIRT016567 WDYHV1 WDYHV motif containing 1 1 1
MIRT016568 FAM101B family with sequence similarity 101, member B 1 1
MIRT016569 ZWINT ZW10 interactor 1 1
MIRT016570 GMNN geminin, DNA replication inhibitor 1 1
MIRT016571 GINS3 GINS complex subunit 3 (Psf3 homolog) 1 1
MIRT016572 CDCA4 cell division cycle associated 4 1 1
MIRT016573 DAGLB diacylglycerol lipase, beta 1 1
MIRT016574 RAC2 ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) 1 1
MIRT016575 USP39 ubiquitin specific peptidase 39 1 1
MIRT016576 TACC1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT016577 E2F2 E2F transcription factor 2 1 1
MIRT016578 FANCD2 Fanconi anemia, complementation group D2 1 1
MIRT016579 NF2 neurofibromin 2 (merlin) 1 1
MIRT016580 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT016581 LRRC8A leucine rich repeat containing 8 family, member A 1 1
MIRT016582 RAD51 RAD51 homolog (S. cerevisiae) 1 1
MIRT016583 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT016584 CEP128 centrosomal protein 128kDa 1 1
MIRT016585 PHF19 PHD finger protein 19 1 1
MIRT016586 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 1 1
MIRT016587 SNX9 sorting nexin 9 1 1
MIRT016588 MYB v-myb myeloblastosis viral oncogene homolog (avian) 1 1
MIRT016589 ARHGAP19 Rho GTPase activating protein 19 2 2
MIRT016590 BLM Bloom syndrome, RecQ helicase-like 1 1
MIRT016591 C9orf40 chromosome 9 open reading frame 40 1 1
MIRT016592 SOAT1 sterol O-acyltransferase 1 1 1
MIRT016593 GIMAP2 GTPase, IMAP family member 2 1 1
MIRT016594 LPCAT1 lysophosphatidylcholine acyltransferase 1 2 2
MIRT016595 TUBA1B tubulin, alpha 1b 1 1
MIRT016596 PTPLB protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b 1 1
MIRT016597 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT016598 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase 1 1
MIRT016599 ENDOD1 endonuclease domain containing 1 1 1
MIRT016600 KIF1B kinesin family member 1B 1 1
MIRT016601 TMEM33 transmembrane protein 33 1 1
MIRT016602 RUSC1 RUN and SH3 domain containing 1 1 1
MIRT016603 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT016604 NAGA N-acetylgalactosaminidase, alpha- 1 1
MIRT016605 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT016606 RSF1 remodeling and spacing factor 1 1 1
MIRT016607 MORC4 MORC family CW-type zinc finger 4 1 1
MIRT016608 CCDC28A coiled-coil domain containing 28A 1 1
MIRT016609 AREL1 KIAA0317 1 1
MIRT016610 FEN1 flap structure-specific endonuclease 1 2 2
MIRT016611 MCM6 minichromosome maintenance complex component 6 2 2
MIRT016612 MCM4 minichromosome maintenance complex component 4 2 2
MIRT041192 DAZAP1 DAZ associated protein 1 1 1
MIRT041193 COX1 cytochrome c oxidase subunit I 1 1
MIRT041194 FOXC1 forkhead box C1 1 1
MIRT041195 BRCC3 BRCA1/BRCA2-containing complex, subunit 3 1 1
MIRT041196 TUBB tubulin, beta class I 1 1
MIRT041197 ACTG1 actin, gamma 1 1 1
MIRT041198 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT041199 FARSB phenylalanyl-tRNA synthetase, beta subunit 1 1
MIRT041200 AHDC1 AT hook, DNA binding motif, containing 1 1 1
MIRT041201 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT041202 TRAK2 trafficking protein, kinesin binding 2 1 1
MIRT041203 CDK8 cyclin-dependent kinase 8 1 1
MIRT041204 NFIA nuclear factor I/A 1 1
MIRT041205 ARMC7 armadillo repeat containing 7 1 1
MIRT041206 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT041207 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT041208 SARS2 seryl-tRNA synthetase 2, mitochondrial 1 1
MIRT041209 IQCA1 IQ motif containing with AAA domain 1 1 1
MIRT041210 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT041211 RPL9 ribosomal protein L9 1 1
MIRT041212 DPH1 DPH1 homolog (S. cerevisiae) 1 1
MIRT041213 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT041214 EMC1 ER membrane protein complex subunit 1 1 1
MIRT041215 NCOA2 nuclear receptor coactivator 2 1 1
MIRT041216 NONO non-POU domain containing, octamer-binding 1 1
MIRT041217 PTDSS2 phosphatidylserine synthase 2 1 1
MIRT041218 TENM4 teneurin transmembrane protein 4 1 1
MIRT041219 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT041220 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT041221 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT041222 SLC38A2 solute carrier family 38, member 2 1 1
MIRT041223 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT041224 TXNL4A thioredoxin-like 4A 1 1
MIRT041225 MEPCE methylphosphate capping enzyme 1 1
MIRT041226 GMPPB GDP-mannose pyrophosphorylase B 1 1
MIRT041227 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT041228 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT041229 RPL23A ribosomal protein L23a 1 1
MIRT041230 EIF3M eukaryotic translation initiation factor 3, subunit M 1 1
MIRT041231 KCTD10 potassium channel tetramerisation domain containing 10 1 1
MIRT041232 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT041233 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT041234 PTRH2 peptidyl-tRNA hydrolase 2 1 1
MIRT041235 ENAH enabled homolog (Drosophila) 1 1
MIRT041236 AKT1 v-akt murine thymoma viral oncogene homolog 1 1 1
MIRT041237 YDJC YdjC homolog (bacterial) 1 1
MIRT041238 FAF1 Fas (TNFRSF6) associated factor 1 1 1
MIRT041239 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT041240 C12orf5 chromosome 12 open reading frame 5 1 2
MIRT041241 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT041242 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 1
MIRT041243 NMT1 N-myristoyltransferase 1 1 1
MIRT041244 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT041245 EPRS glutamyl-prolyl-tRNA synthetase 1 1
MIRT041246 CAPNS1 calpain, small subunit 1 1 1
MIRT041247 MCRS1 microspherule protein 1 1 1
MIRT041248 TOLLIP toll interacting protein 1 1
MIRT041249 FUNDC2 FUN14 domain containing 2 1 1
MIRT041250 HIST1H2AJ histone cluster 1, H2aj 1 1
MIRT041251 RPL27A ribosomal protein L27a 1 1
MIRT041252 SNX18 sorting nexin 18 1 1
MIRT041253 ZNF814 zinc finger protein 814 1 1
MIRT041254 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT041255 IPO4 importin 4 1 1
MIRT041256 FLNA filamin A, alpha 1 1
MIRT041257 HIST1H1B histone cluster 1, H1b 1 1
MIRT041258 BAG6 BCL2-associated athanogene 6 1 1
MIRT041259 NUTF2 nuclear transport factor 2 1 1
MIRT041260 RBM4B RNA binding motif protein 4B 1 1
MIRT041261 ALKBH4 alkB, alkylation repair homolog 4 (E. coli) 1 1
MIRT041262 MRPL32 mitochondrial ribosomal protein L32 1 1
MIRT041263 TAOK3 TAO kinase 3 1 1
MIRT041264 TRRAP transformation/transcription domain-associated protein 1 1
MIRT041265 RPS18 ribosomal protein S18 1 1
MIRT041266 POLR2C polymerase (RNA) II (DNA directed) polypeptide C, 33kDa 1 1
MIRT041267 IL17RD interleukin 17 receptor D 1 1
MIRT041268 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 1 1
MIRT041269 HM13 histocompatibility (minor) 13 1 1
MIRT041270 DOK2 docking protein 2, 56kDa 1 1
MIRT041271 TRIM28 tripartite motif containing 28 1 1
MIRT041272 COX7C cytochrome c oxidase subunit VIIc 1 1
MIRT041273 SEPHS2 selenophosphate synthetase 2 1 1
MIRT041274 PSMA7 proteasome (prosome, macropain) subunit, alpha type, 7 1 1
MIRT041275 ILVBL ilvB (bacterial acetolactate synthase)-like 1 1
MIRT041276 SNRNP70 small nuclear ribonucleoprotein 70kDa (U1) 1 1
MIRT041277 ATP13A2 ATPase type 13A2 1 1
MIRT041278 TPI1 triosephosphate isomerase 1 1 1
MIRT041279 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT041280 ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 1 1
MIRT041281 STX7 syntaxin 7 1 1
MIRT041282 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT041283 MDH2 malate dehydrogenase 2, NAD (mitochondrial) 1 1
MIRT041284 PHF8 PHD finger protein 8 1 1
MIRT041285 LMNB1 lamin B1 1 1
MIRT041286 INSIG1 insulin induced gene 1 1 1
MIRT041287 TFG TRK-fused gene 1 1
MIRT041288 RPS3 ribosomal protein S3 1 1
MIRT041289 DUS1L dihydrouridine synthase 1-like (S. cerevisiae) 1 1
MIRT041290 MBTPS1 membrane-bound transcription factor peptidase, site 1 1 1
MIRT041291 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 1
MIRT041292 TUBGCP6 tubulin, gamma complex associated protein 6 1 1
MIRT041293 DHX37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 1 1
MIRT041294 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 1
MIRT041295 NUP214 nucleoporin 214kDa 1 1
MIRT041296 EXOSC10 exosome component 10 1 1
MIRT041297 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT041298 RPL8 ribosomal protein L8 1 1
MIRT041299 PRPF31 PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae) 1 1
MIRT041300 CYFIP1 cytoplasmic FMR1 interacting protein 1 1 1
MIRT041301 DNAJC11 DnaJ (Hsp40) homolog, subfamily C, member 11 1 1
MIRT041302 ESYT1 extended synaptotagmin-like protein 1 1 1
MIRT041303 DNAJA3 DnaJ (Hsp40) homolog, subfamily A, member 3 1 1
MIRT041304 MARS methionyl-tRNA synthetase 1 1
MIRT041305 ALDH1A2 aldehyde dehydrogenase 1 family, member A2 1 1
MIRT041306 ESD esterase D 1 1
MIRT041307 GEMIN4 gem (nuclear organelle) associated protein 4 1 1
MIRT041308 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT041309 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 1 1
MIRT041310 PEG10 paternally expressed 10 1 1
MIRT041311 EMC6 ER membrane protein complex subunit 6 1 1
MIRT041312 MFN2 mitofusin 2 1 1
MIRT041313 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT041314 LAMB1 laminin, beta 1 1 1
MIRT041315 YIPF3 Yip1 domain family, member 3 1 1
MIRT041316 RAB35 RAB35, member RAS oncogene family 1 1
MIRT041317 ZNF317 zinc finger protein 317 1 1
MIRT041318 AP3M2 adaptor-related protein complex 3, mu 2 subunit 1 1
MIRT041319 CDK17 cyclin-dependent kinase 17 1 1
MIRT041320 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT041321 BCL9L B-cell CLL/lymphoma 9-like 1 1
MIRT041322 GCC2 GRIP and coiled-coil domain containing 2 1 1
MIRT041323 PRRC2B proline-rich coiled-coil 2B 1 1
MIRT041324 NF1 neurofibromin 1 4 3
MIRT041325 AARS alanyl-tRNA synthetase 1 1
MIRT041326 KAT6A K(lysine) acetyltransferase 6A 1 1
MIRT041327 CASC3 cancer susceptibility candidate 3 1 1
MIRT041328 CTDP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 1 1
MIRT041329 PRPF19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 1 1
MIRT041330 FAF2 Fas associated factor family member 2 1 1
MIRT041331 CCT4 chaperonin containing TCP1, subunit 4 (delta) 1 1
MIRT041332 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT041333 ZFYVE27 zinc finger, FYVE domain containing 27 1 1
MIRT041334 TEAD2 TEA domain family member 2 1 1
MIRT041335 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT041336 ZYX zyxin 1 1
MIRT041337 MAGEB2 melanoma antigen family B, 2 1 1
MIRT041338 ANKRD11 ankyrin repeat domain 11 1 1
MIRT041339 CCT2 chaperonin containing TCP1, subunit 2 (beta) 1 1
MIRT041340 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT041341 QTRTD1 queuine tRNA-ribosyltransferase domain containing 1 1 1
MIRT041342 PACSIN2 protein kinase C and casein kinase substrate in neurons 2 1 1
MIRT041343 INTS5 integrator complex subunit 5 1 1
MIRT041344 C7orf26 chromosome 7 open reading frame 26 1 1
MIRT041345 AAAS achalasia, adrenocortical insufficiency, alacrimia 1 1
MIRT041346 TSC1 tuberous sclerosis 1 1 1
MIRT041347 HIST1H3B histone cluster 1, H3b 1 1
MIRT041348 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT041349 FBXL19 F-box and leucine-rich repeat protein 19 1 1
MIRT041350 YBX3 cold shock domain protein A 1 1
MIRT041351 CDK4 cyclin-dependent kinase 4 1 1
MIRT041352 FAM60A family with sequence similarity 60, member A 1 1
MIRT041353 FASN fatty acid synthase 1 1
MIRT041354 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT041355 RPL26 ribosomal protein L26 1 1
MIRT041356 REEP4 receptor accessory protein 4 1 1
MIRT041357 SMC3 structural maintenance of chromosomes 3 1 1
MIRT041358 FBXL18 F-box and leucine-rich repeat protein 18 1 1
MIRT041359 UBQLN2 ubiquilin 2 1 1
MIRT041360 SMAD3 SMAD family member 3 4 2
MIRT041361 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT041362 CTDSPL2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 1 1
MIRT041363 STAG2 stromal antigen 2 1 1
MIRT041364 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase, type I, gamma 1 1
MIRT041365 USP24 ubiquitin specific peptidase 24 1 1
MIRT041366 TMBIM1 transmembrane BAX inhibitor motif containing 1 1 1
MIRT041367 SSNA1 Sjogren syndrome nuclear autoantigen 1 1 1
MIRT041368 CECR5 cat eye syndrome chromosome region, candidate 5 1 1
MIRT041369 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 1 1
MIRT041370 DBNL drebrin-like 1 1
MIRT041371 XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 1 1
MIRT041372 RNF115 ring finger protein 115 1 1
MIRT041373 ALDH3A2 aldehyde dehydrogenase 3 family, member A2 1 1
MIRT041374 GPI glucose-6-phosphate isomerase 1 1
MIRT041375 THAP7 THAP domain containing 7 1 1
MIRT041376 COPA coatomer protein complex, subunit alpha 1 1
MIRT041377 PSMC5 proteasome (prosome, macropain) 26S subunit, ATPase, 5 1 1
MIRT041378 ELP3 elongator acetyltransferase complex subunit 3 1 1
MIRT041379 DENND4B DENN/MADD domain containing 4B 1 1
MIRT041380 HP1BP3 heterochromatin protein 1, binding protein 3 1 1
MIRT041381 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT041382 PRKCA protein kinase C, alpha 1 1
MIRT041383 MYH14 myosin, heavy chain 14, non-muscle 1 1
MIRT041384 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT041385 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT041386 LMNB2 lamin B2 1 1
MIRT041387 ARCN1 archain 1 1 1
MIRT041388 TAF9B TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa 1 1
MIRT041389 COL4A1 collagen, type IV, alpha 1 1 1
MIRT041390 HSPH1 heat shock 105kDa/110kDa protein 1 1 1
MIRT041391 TICAM1 toll-like receptor adaptor molecule 1 1 1
MIRT041392 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT041393 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT041394 CIAO1 cytosolic iron-sulfur protein assembly 1 1 2
MIRT041395 PTPRG protein tyrosine phosphatase, receptor type, G 1 1
MIRT041396 SRSF1 serine/arginine-rich splicing factor 1 1 1
MIRT041397 NDUFS6 NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) 1 1
MIRT041398 KIAA0195 KIAA0195 1 1
MIRT041399 UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 1 1
MIRT041400 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT041401 TRAP1 TNF receptor-associated protein 1 1 1
MIRT041402 RHOV ras homolog family member V 1 1
MIRT041403 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT041404 GSS glutathione synthetase 1 1
MIRT041405 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT041406 MYL12B myosin, light chain 12B, regulatory 1 1
MIRT041407 GLUD1 glutamate dehydrogenase 1 1 1
MIRT041408 C16orf58 chromosome 16 open reading frame 58 1 1
MIRT041409 PEF1 penta-EF-hand domain containing 1 1 1
MIRT041410 NUP37 nucleoporin 37kDa 1 1
MIRT041411 SPAG9 sperm associated antigen 9 1 1
MIRT041412 KLHL22 kelch-like 22 (Drosophila) 1 1
MIRT041413 RB1CC1 RB1-inducible coiled-coil 1 1 1
MIRT041414 STRIP1 striatin interacting protein 1 1 1
MIRT041415 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT041416 C2CD2 C2 calcium-dependent domain containing 2 1 1
MIRT041417 RASSF5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT041418 RPL12 ribosomal protein L12 1 1
MIRT041419 GAREML family with sequence similarity 59, member B 1 1
MIRT041420 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT041421 ARHGAP33 Rho GTPase activating protein 33 1 1
MIRT041422 TRMT2A tRNA methyltransferase 2 homolog A (S. cerevisiae) 1 1
MIRT041423 HIST1H1E histone cluster 1, H1e 1 1
MIRT041424 SCLY selenocysteine lyase 1 1
MIRT041425 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT041426 CCNY cyclin Y 1 1
MIRT041427 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT041428 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT041429 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT041430 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT041431 GDI2 GDP dissociation inhibitor 2 1 1
MIRT041432 FGF11 fibroblast growth factor 11 1 1
MIRT041433 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT041434 DRG2 developmentally regulated GTP binding protein 2 1 1
MIRT041435 HIST1H3H histone cluster 1, H3h 1 1
MIRT041436 PTEN phosphatase and tensin homolog 1 1
MIRT041437 XPO7 exportin 7 1 1
MIRT041438 SKA3 spindle and kinetochore associated complex subunit 3 1 1
MIRT041439 PUS1 pseudouridylate synthase 1 1 1
MIRT041440 HIST2H3A histone cluster 2, H3a 1 1
MIRT041441 NSUN2 NOP2/Sun RNA methyltransferase family, member 2 1 1
MIRT041442 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1-like 1 1
MIRT041443 BCKDHA branched chain keto acid dehydrogenase E1, alpha polypeptide 1 1
MIRT041444 NRARP NOTCH-regulated ankyrin repeat protein 1 1
MIRT041445 C17orf96 chromosome 17 open reading frame 96 1 1
MIRT041446 YIPF5 Yip1 domain family, member 5 1 1
MIRT041447 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 1
MIRT041448 TPX2 TPX2, microtubule-associated, homolog (Xenopus laevis) 1 1
MIRT041449 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT041450 SOWAHC sosondowah ankyrin repeat domain family member C 1 1
MIRT041451 ENKD1 enkurin domain containing 1 1 1
MIRT041452 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT041453 MYBBP1A MYB binding protein (P160) 1a 1 1
MIRT041454 PTK7 PTK7 protein tyrosine kinase 7 1 1
MIRT041455 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT041456 FAM212B family with sequence similarity 212, member B 1 1
MIRT041457 PLS3 plastin 3 1 1
MIRT041458 FTSJD2 FtsJ methyltransferase domain containing 2 1 1
MIRT041459 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT041460 TANGO6 transmembrane and coiled-coil domains 7 1 1
MIRT041461 WDR36 WD repeat domain 36 1 1
MIRT041462 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT041463 YARS tyrosyl-tRNA synthetase 1 1
MIRT041464 TSEN34 tRNA splicing endonuclease 34 homolog (S. cerevisiae) 1 1
MIRT041465 ATAD2 ATPase family, AAA domain containing 2 1 1
MIRT041466 LIN37 lin-37 homolog (C. elegans) 1 1
MIRT041467 GLTSCR1 glioma tumor suppressor candidate region gene 1 1 1
MIRT041468 IPO8 importin 8 1 1
MIRT041469 CCBL1 cysteine conjugate-beta lyase, cytoplasmic 1 1
MIRT041470 ACTN4 actinin, alpha 4 1 2
MIRT041471 NT5C2 5'-nucleotidase, cytosolic II 1 1
MIRT041472 UBR1 ubiquitin protein ligase E3 component n-recognin 1 1 1
MIRT041473 CUL4A cullin 4A 1 1
MIRT041474 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT041475 PITRM1 pitrilysin metallopeptidase 1 1 1
MIRT041476 SCO1 SCO1 cytochrome c oxidase assembly protein 1 1
MIRT041477 SMG5 smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT041478 RPS6KA1 ribosomal protein S6 kinase, 90kDa, polypeptide 1 1 1
MIRT041479 CS citrate synthase 1 1
MIRT041480 ZC3H7B zinc finger CCCH-type containing 7B 1 1
MIRT041481 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT041482 RPS10 ribosomal protein S10 1 1
MIRT041483 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 1
MIRT041484 GCA grancalcin, EF-hand calcium binding protein 1 1
MIRT041485 ZNF3 zinc finger protein 3 1 1
MIRT041486 EEFSEC eukaryotic elongation factor, selenocysteine-tRNA-specific 1 1
MIRT041487 ALDH7A1 aldehyde dehydrogenase 7 family, member A1 1 1
MIRT041488 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT041489 CIAPIN1 cytokine induced apoptosis inhibitor 1 1 1
MIRT041490 EP300 E1A binding protein p300 1 1
MIRT041491 TDP1 tyrosyl-DNA phosphodiesterase 1 1 1
MIRT041492 AKAP13 A kinase (PRKA) anchor protein 13 1 1
MIRT041493 RABGGTB Rab geranylgeranyltransferase, beta subunit 1 1
MIRT041494 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT041495 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT041496 MEGF8 multiple EGF-like-domains 8 1 1
MIRT041497 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT041498 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT041499 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT041500 DCPS decapping enzyme, scavenger 1 1
MIRT041501 WDR12 WD repeat domain 12 1 1
MIRT041502 IRS4 insulin receptor substrate 4 1 1
MIRT041503 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT041504 SLC37A4 solute carrier family 37 (glucose-6-phosphate transporter), member 4 1 1
MIRT041505 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT041506 HSPA1L heat shock 70kDa protein 1-like 1 1
MIRT041507 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT041508 TXLNA taxilin alpha 1 1
MIRT041509 SH3GL1 SH3-domain GRB2-like 1 1 1
MIRT041510 TRIM16L tripartite motif containing 16-like 1 1
MIRT041511 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT041512 FAM50A family with sequence similarity 50, member A 1 1
MIRT041513 AHSA2 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) 1 1
MIRT041514 HDGF hepatoma-derived growth factor 1 1
MIRT041515 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT041516 TCEB3 transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) 1 1
MIRT041517 MARK2 MAP/microtubule affinity-regulating kinase 2 1 1
MIRT041518 HIST1H3D histone cluster 1, H3d 1 1
MIRT041519 UNC5B unc-5 homolog B (C. elegans) 1 1
MIRT041520 HERC1 HECT and RLD domain containing E3 ubiquitin protein ligase family member 1 1 1
MIRT041521 ACBD6 acyl-CoA binding domain containing 6 1 1
MIRT041522 GMPR2 guanosine monophosphate reductase 2 1 1
MIRT041523 EBNA1BP2 EBNA1 binding protein 2 1 1
MIRT041524 HEATR3 HEAT repeat containing 3 1 1
MIRT041525 RPL22 ribosomal protein L22 1 1
MIRT041526 ADARB1 adenosine deaminase, RNA-specific, B1 1 1
MIRT041527 ATXN7L3 ataxin 7-like 3 1 1
MIRT041528 IWS1 IWS1 homolog (S. cerevisiae) 1 1
MIRT041529 METTL13 methyltransferase like 13 1 1
MIRT041530 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT041531 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 1 1
MIRT041532 MXRA7 matrix-remodelling associated 7 1 1
MIRT041533 SYMPK symplekin 1 1
MIRT041534 ANAPC1 anaphase promoting complex subunit 1 1 1
MIRT041535 SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 1 1
MIRT041536 MYO1D myosin ID 1 1
MIRT041537 KXD1 KxDL motif containing 1 1 1
MIRT041538 RMDN3 family with sequence similarity 82, member A2 1 1
MIRT041539 STX16 syntaxin 16 1 1
MIRT041540 PFKP phosphofructokinase, platelet 1 1
MIRT041541 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 1 1
MIRT041542 DACT2 dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis) 1 1
MIRT041543 CHCHD10 coiled-coil-helix-coiled-coil-helix domain containing 10 1 1
MIRT041544 SPTBN2 spectrin, beta, non-erythrocytic 2 1 1
MIRT041545 TCFL5 transcription factor-like 5 (basic helix-loop-helix) 1 1
MIRT041546 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT041547 CDK12 cyclin-dependent kinase 12 1 1
MIRT041548 CIC capicua homolog (Drosophila) 1 1
MIRT041549 ODC1 ornithine decarboxylase 1 1 1
MIRT041550 SNRNP200 small nuclear ribonucleoprotein 200kDa (U5) 1 1
MIRT041551 VCPIP1 valosin containing protein (p97)/p47 complex interacting protein 1 1 1
MIRT041552 NCL nucleolin 1 1
MIRT041553 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 1
MIRT041554 SLC18B1 solute carrier family 18, subfamily B, member 1 1 1
MIRT041555 MTMR14 myotubularin related protein 14 1 1
MIRT041556 SCRIB scribbled homolog (Drosophila) 1 1
MIRT041557 ATAD3C ATPase family, AAA domain containing 3C 1 1
MIRT041558 CHPF2 chondroitin polymerizing factor 2 1 1
MIRT041559 PHB2 prohibitin 2 1 1
MIRT041560 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT041561 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT041562 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 2
MIRT041563 AAMP angio-associated, migratory cell protein 1 1
MIRT041564 NEIL2 nei endonuclease VIII-like 2 (E. coli) 1 1
MIRT041565 NOL6 nucleolar protein family 6 (RNA-associated) 1 1
MIRT041566 WAPAL wings apart-like homolog (Drosophila) 1 1
MIRT041567 RUVBL1 RuvB-like 1 (E. coli) 1 1
MIRT041568 ZNF71 zinc finger protein 71 1 1
MIRT041569 SSRP1 structure specific recognition protein 1 1 1
MIRT041570 CRAMP1L Crm, cramped-like (Drosophila) 1 1
MIRT041571 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 2
MIRT041572 C22orf29 chromosome 22 open reading frame 29 1 1
MIRT041573 AMACR alpha-methylacyl-CoA racemase 1 1
MIRT041574 NT5C3B 5'-nucleotidase, cytosolic III-like 1 1
MIRT041575 CDK9 cyclin-dependent kinase 9 1 1
MIRT041576 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT041577 CBS cystathionine-beta-synthase 1 1
MIRT041578 SNRK SNF related kinase 1 1
MIRT041579 TMEM97 transmembrane protein 97 1 1
MIRT041580 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT041581 CFL1 cofilin 1 (non-muscle) 1 1
MIRT041582 SH3BP4 SH3-domain binding protein 4 1 1
MIRT041583 MYO5A myosin VA (heavy chain 12, myoxin) 1 1
MIRT041584 ABT1 activator of basal transcription 1 1 1
MIRT041585 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT041586 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT041587 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT041588 ASXL1 additional sex combs like 1 (Drosophila) 1 1
MIRT041589 PFN1 profilin 1 1 1
MIRT041590 ISOC2 isochorismatase domain containing 2 1 1
MIRT041591 METTL16 methyltransferase like 16 1 1
MIRT041592 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT041593 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT041594 CHTOP chromatin target of PRMT1 1 1
MIRT041595 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT041596 REPS1 RALBP1 associated Eps domain containing 1 1 1
MIRT041597 ZBTB43 zinc finger and BTB domain containing 43 1 1
MIRT041598 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 1 1
MIRT041599 MYO18A myosin XVIIIA 1 1
MIRT041600 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT041601 LONP2 lon peptidase 2, peroxisomal 1 1
MIRT041602 PHRF1 PHD and ring finger domains 1 1 1
MIRT041603 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT041604 RMI1 RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae) 1 1
MIRT041605 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT041606 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT041607 SLC7A6 solute carrier family 7 (amino acid transporter light chain, y+L system), member 6 1 1
MIRT041608 MTMR4 myotubularin related protein 4 1 1
MIRT066674 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT096408 C5ORF22 chromosome 5 open reading frame 22 1 1
MIRT129893 TNFRSF1B tumor necrosis factor receptor superfamily, member 1B 1 1
MIRT166342 MAP3K1 mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase 1 1
MIRT167723 RNF146 ring finger protein 146 1 1
MIRT169939 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 3
MIRT194889 DCTN5 dynactin 5 (p25) 1 4
MIRT247465 TRAFD1 TRAF-type zinc finger domain containing 1 1 1
MIRT393394 PLEKHA2 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 1 1
MIRT472985 MRRF mitochondrial ribosome recycling factor 1 1
MIRT478385 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT493352 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 4
MIRT495317 GDF11 growth differentiation factor 11 1 1
MIRT496584 RGMA RGM domain family, member A 1 1
MIRT496916 RTKN rhotekin 1 1
MIRT498447 INO80D INO80 complex subunit D 1 1
MIRT498702 LYRM2 LYR motif containing 2 1 2
MIRT498844 NAPEPLD N-acyl phosphatidylethanolamine phospholipase D 1 1
MIRT500434 ZMAT3 zinc finger, matrin-type 3 1 4
MIRT500663 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT501314 RPS21 ribosomal protein S21 1 1
MIRT501872 MSANTD2 Myb/SANT-like DNA-binding domain containing 2 1 1
MIRT502564 EBAG9 estrogen receptor binding site associated, antigen, 9 1 1
MIRT502673 CTC1 CTS telomere maintenance complex component 1 1 6
MIRT505427 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 2
MIRT512632 TMPPE transmembrane protein with metallophosphoesterase domain 1 2
MIRT518284 SMIM14 chromosome 4 open reading frame 34 1 1
MIRT522826 KLHL42 kelch domain containing 5 1 3
MIRT528179 C6orf47 chromosome 6 open reading frame 47 1 1
MIRT531130 CLPB ClpB caseinolytic peptidase B homolog (E. coli) 1 1
MIRT533069 YY1 YY1 transcription factor 1 1
MIRT534612 RNASEH1 ribonuclease H1 1 2
MIRT539617 SHISA9 shisa homolog 9 (Xenopus laevis) 1 1
MIRT539648 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 1 1
MIRT540218 RAB32 RAB32, member RAS oncogene family 1 1
MIRT540343 OPHN1 oligophrenin 1 1 1
MIRT543683 HHLA1 HERV-H LTR-associating 1 1 1
MIRT551771 MED21 mediator complex subunit 21 1 1
MIRT560188 SPRTN SprT-like N-terminal domain 1 1
MIRT567209 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT572722 RBL1 retinoblastoma-like 1 (p107) 1 1
MIRT576588 Ptbp1 polypyrimidine tract binding protein 1 1 1
MIRT576842 Tgfbr3 transforming growth factor, beta receptor III 1 1
MIRT608243 PARP15 poly (ADP-ribose) polymerase family, member 15 1 1
MIRT620193 COQ7 coenzyme Q7 homolog, ubiquinone (yeast) 1 1
MIRT622767 PGM3 phosphoglucomutase 3 1 1
MIRT651158 ZNF384 zinc finger protein 384 1 1
MIRT658393 FAM221B family with sequence similarity 221, member B 1 1
MIRT663963 LYPLA1 lysophospholipase I 1 1
MIRT685443 SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter family), member 6 1 1
MIRT687787 KDSR 3-ketodihydrosphingosine reductase 1 1
MIRT691331 KIAA1841 KIAA1841 1 1
MIRT696737 UTP18 UTP18 small subunit (SSU) processome component homolog (yeast) 1 1
MIRT723155 NQO2 NAD(P)H dehydrogenase, quinone 2 1 1
MIRT723941 SVOP SV2 related protein homolog (rat) 1 1
MIRT726103 WDR82 WD repeat domain 82 1 1
MIRT726195 UBFD1 ubiquitin family domain containing 1 1 1
MIRT726289 TMEM30A transmembrane protein 30A 1 1
MIRT726314 TLN1 talin 1 1 1
MIRT726340 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT726631 SENP5 SUMO1/sentrin specific peptidase 5 1 1
MIRT726831 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT726879 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 1
MIRT726895 PPIF peptidylprolyl isomerase F 1 1
MIRT727058 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT727422 IRF1 interferon regulatory factor 1 1 1
MIRT727571 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT728087 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728116 C1QBP complement component 1, q subcomponent binding protein 1 1
MIRT728220 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT728291 ASB3 ankyrin repeat and SOCS box containing 3 1 1
MIRT728309 ARMC1 armadillo repeat containing 1 1 1
MIRT728333 SYNRG synergin, gamma 1 1
MIRT728347 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT728354 ALKBH5 alkB, alkylation repair homolog 5 (E. coli) 1 1
Error report submission
Your e-Mail*