Accession ID: MIRT016681 [miRNA, hsa-miR-423-3p :: ATXN7, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-423LinkOut: [miRBase ]
Synonyms MIRN423, hsa-mir-423, MIR423
Description Homo sapiens miR-423 stem-loop
Comment miR-423 (renamed miR-423-3p here) is expressed in human promyelocytic leukemia (HL-60) cells .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-423-3p
Mature Sequence 53| AGCUCGGUCUGAGGCCCCUCAGU |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-423-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ATXN7 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ADCAII, FLJ17787, OPCA3, SCA7
Description ataxin 7
Transcript NM_0003    LinkOut: [ RefSeq ]
Other Transcripts NM_0011281 , NM_0011773   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ATXN7 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ATXN7
(miRNA target sites are highlighted)
>ATXN7|NM_0003|3'UTR
   1 TGACAGCTGAAAATAGCACGGGGAGGAATAATGCGGACACTTTTGAGGACAAGTTACACCTCCACTCAGCACTCTGGACT
  81 CCACGATGCCTTTGAGTCTGTTTTCCCAACCTCCTGTGGGCCTCAAGGGTAGAAACCTGCCGGGCTGTTGTTTTAACGAG
 161 GATTTCCCTGAAGCTATGTCTCTAGCAGTGAGTACTCATAAAGGACACTGGATCAAGTTCAGCCACCGAATTGCTTTTAT
 241 CAGTGTTAAAGTGGTCTGAACTGCTTGCTACCAATCTGTGAGAAGTTTTTGTTTTTGTTTTGTTTTTTAACTTGCAGTAT
 321 ATCACAGAGCCACTCTTCAAGTAGATTGGCTGGGCAAAAGAATGTTTTGGCAAGAGCGTTACTGTAGACCTTTCTCCCTC
 401 CTTCCTTTTACTACCATTTTTTTTTAACACTGTCATCTGTAGGTCACTCTCCAGCAGTTAGGCACCTTAACTGGAGACCA
 481 GAAACCTTCCAGAGAACACAGGGCTGCATCCCGAGCAACCCTCTGAAGAAGGGAATTAGGCTTTAGATTTTGATAGCAAT
 561 GTTCCAGGAATGAAATATAGATGTTAGCCCAAGACACCATGACAAAATAGCCCAGCCTTTTGAGAGTAATTTGGGAAAAG
 641 AAGCTGTCAGAAGTTTCTAACTTACAAACTGGTTTGAAATTTTTGATGCCCAGACAGCAAGTATAAATCATTTTGGAGGC
 721 TTACTTTTCATGATACAAAAGCAATTCTGTGTGATTTTTTTTTTTAAGAAGAAAGAAAATGCAAGCTAGTTTTGAGAAAG
 801 GAAGGCCAAATTGGGTCGGGGGAGGGTGGGAGTGAGGAAGTTAAAATCACTATAGGGAGAAAAAACTTTTTTCAAGATTT
 881 CCAAAGAGATGAAATTTTCTTAATCCTTTTAAGTTTTCATAGTAAACAGTATGGCAGATTGGGTTGGTTGTCCTACCTGG
 961 TCTATTTTTAAAAGTCACCTTTTAAAGTGACATTATTAGATACACTTAAATGTTTCCAAGGCACTCTCTACATTACCCTT
1041 GTTTTTCTCTTTGGATACTGTCCTGGGACTAAGTGTAGATTTCTGCTTCAAGCACTTCTGGCATTGTGTGTTTTTGTATG
1121 CACTCCCCTTCATGCCACTTCAGATGTTTATTTGGATGTGGTTGGGGACGAGAGCAGACACCAAGGAAAGGGAGTTGGAG
1201 AGAATGTAAGTCCTGACCTGAAGGTCTTTTGTGATGCATGTATAGGATTGCCCTGACACACACCCTCCTTTCTTGGGATT
1281 ATACCAGCCATCTTCCTGAGAGTTTTGGAGCCCTCTAGGATATTTTTTCTAGTACCCCACCCCCCACCCCTAAAGAAAGA
1361 CCTTAATATGTTAAAACAGCATTGCTTGGAGAAGGTGTCATTGAATTCCGGGACGAGCCGGAGCCTTTAAATGGGTGCTT
1441 CCACCACTACAGGCTCCTGACACGAGTAACAGGCACTGTTGCTTAGAAGAACACACGAAGTTGCCGAACACAGGGTAAAA
1521 TTTCCAAGGCGCTGATCGTTGCCCTGGCCAGGGCCTGATGAGAGCCAGTCAGTACATTCTTTTTTTCCTACAGTTCTTGG
1601 GTTTCAAACTTCAGTTTCAGGGAATTTCAAGTCAACAACAGGTAGAATGAATAAACTTGGTTACCAGCCTAATAATGTGA
1681 ATTGCTACAGAATTATTCTTATTATGTAAGAAAACAAAAACTTTATGCAGATACTTTAGCTATAAATTGATGTAAAATAC
1761 TGATTTTTTTAAAGGAAGGAGAGAACAGTATCTTGTTCAATTATTATGCAATCAATCAGTAAATGTTTTTAAAATGATAC
1841 TACAGGAGAGCTTAGTAAGGAGAGGGCATGGATGGGCCAGTTTGGCATAGTTGGGAGAAATCAGTCTGGTTTCCATCCCA
1921 GTCGGGGAAGAGAGAGGTGAGAGGGAATCAGAACGTACCTAGTTGATTCCTTGGTGACAAGTGCAATGGGGTATGGGTAG
2001 AATTTATTTTCAGAGCCAAGAGGACTTGATGGTTATAAATAAAGTTGCCTTTAGCAATGGAATTTACAGATCGATCATGT
2081 TGTTCCGAAAGATGTGAATAGGATCCACAATAACAAGTTGATTCAGACTAATGTAGATATTTAGATTAGCAAGTATTGAA
2161 CATTTGATTTCTTAGACTGAGGTTTTAAATGAATTTCATTATTTCTCCCGGTAATACACAGAGCATCGGGATTAGGAAAT
2241 TAGCCATTTTGGATTCTGTCTGCCACAAACAGACCTATTCTAAACAGTGCTATTAAATTTTAGACTGTTGTTCAAATATT
2321 TTATTTTCTCCTAAACTACTTTTTATGGTGATGAATAATTAAGACCATTTAAAACACGGGAGTACAAGTATTTTTTTGAA
2401 TTAAATTAACTTGCAAAAACCAAATTTGCAGTGGTTGGGTTGTTTCTAGACAGACTTTGGTATCAATTTAAAACCAAGAT
2481 AATTTTTATATTCTTTCCAATAGAATTTCATGACAACTCCTGCAGTTTTCTTAACCTACAAAAAAAAAAAAAAAGTGCTG
2561 CAATGATGAACAAAGAATTATACAAAACCTACTTTTGTATCTTTATTTTGGAATTTCTTGTTCTATTATAAATATGGAAG
2641 TATCCCTATTTCAGAAGACATATTTTGTTAAAAATGAATTGTACATATTTAAATATGTATTTTTGCACAGGTCTTTTTTT
2721 CTGATATCCTGTTTTGGTACAATTGAGATCATCTAGTATTTATTTATTAATTAATAAAAGTAAATACCTTTTTATAATTT
2801 GAAGTGGTTCACTGCCAAGCCAATAGTTCTAGAACCTGCCTCCTTTACAGTTTTAAGGGATGCCTCTGTTCTGTGAAAAG
2881 TCTTTGTCCCTTTTAGTGTCTCGGGAGTGGATTCATACAGATGAAGTGGGCATTGCTTCTTCCTGGTTGCCTGGTTTCCC
2961 GATAGACTACATGTAACTAAGTGACACACTGCTTTTCTTTTGTTAGTATTTTATGTGTGGGAGTATGTGACTGCGTGTGT
3041 GTGTGCCTGTGCGTGTGTGTGTATACTCAGCACATGTATGTTACTATGTGATGTGGTTTAAAACTAATGGAAAAAACTGA
3121 AAGTGCCTGAAACTAGTTTTAAGCTTAGACAGAATCTCTTTAAAAAGACTTGAATGTTCAGTTGAACTTTTGGAGTTTGC
3201 TTTTTCCACCTAAATATTGTTTCTAAAATTTTAGGGGCGGAGTTGAAAACCACCAATGCTGGTAATTTTATAAGGTATTT
3281 TAAAATTAAGACCTCTTGGTTCATAGTAATTCAATTGGTGATGGATTGCCTGGTGGCACCAAGGGTTACAGATCTTTTTG
3361 TCAGCCAGCAACTTACACGATGTGTCCGTTTTGTTATTCACTCATGAAATACAATTTAAAATATTTAAAATATTTTGTAT
3441 TCCAAAAATATAATACAAAGAAGTACCTCTGAGAACATTGAAAAAAATGTATAATTTGAAAAATGTAACTTATAAGGGCA
3521 GCTGTCTTCCTGCAAGAGTTCTGTTGCCAAGGAATTTCTTAATGTCGCTCATTCTGTCCAGGGGGTTTGGGGCGATTGGG
3601 CTTTGAAAAAATATTCTTAAAAGTTTGTTTAGCAGAAAATAATCACTTTTACATTTTGTGCAAAACATTTTACATTTTCA
3681 GATAATTTAAATGAGCACTACATACTGTCAGTGTGAATGTAGGGCCTTGAAAGCATTTTGCTTTTTTTTTTTTTTTTTTT
3761 TTTTTGAGCTTGGTTATAAAAGCAATCTCCTGTGTTAAAAACGTGTGAATAGTTTGATAATTTGTACACATAATCAAGAG
3841 CATCTCAGCTGGACTTTGTGTTGGCTGCTGTATAGAACATGAACAAATGTCAAGGGATAGAAAATTACTTTGGATATTTA
3921 AAAGAGAAGAAATATATAGTCTATTTGTTTTGTAACAAGTTTCTGTAAATAAAATAATTTATACTATTTATAAGAAAAAA
4001 AAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugacucCCCGGAGUCUGGCUCGa 5'
                ||||: ||  |||||| 
Target 5' aacacaGGGCTGCATCCCGAGCa 3'
495 - 517 133.00 -20.40
2
miRNA  3' ugacuccccGGAGUCUGGCUCga 5'
                   :||:||||:|||  
Target 5' catttgattTCTTAGACTGAGgt 3'
2161 - 2183 126.00 -17.90
3
miRNA  3' ugacucCCCGGAG------UC------UGGCUCGa 5'
                |||||||      ||      :|||:|| 
Target 5' tcctgtGGGCCTCAAGGGTAGAAACCTGCCGGGCt 3'
112 - 146 117.00 -30.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-423-3p :: ATXN7    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
204 hsa-miR-423-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000589 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 1
MIRT016679 KIF2C kinesin family member 2C 1 1
MIRT016680 TATDN2 TatD DNase domain containing 2 1 1
MIRT016681 ATXN7 ataxin 7 1 1
MIRT016682 PAPD7 PAP associated domain containing 7 1 1
MIRT016683 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT016684 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT016685 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT016686 ZC3H4 zinc finger CCCH-type containing 4 1 1
MIRT016687 ESRRA estrogen-related receptor alpha 1 1
MIRT016688 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT042459 YIPF5 Yip1 domain family, member 5 1 1
MIRT042460 IRGQ immunity-related GTPase family, Q 1 1
MIRT042461 KDSR 3-ketodihydrosphingosine reductase 1 1
MIRT042462 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT042463 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT042464 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT042465 PTPRK protein tyrosine phosphatase, receptor type, K 1 1
MIRT042466 LURAP1 chromosome 1 open reading frame 190 1 1
MIRT042467 UQCRB ubiquinol-cytochrome c reductase binding protein 1 1
MIRT042468 EIF3B eukaryotic translation initiation factor 3, subunit B 1 1
MIRT042469 RANBP2 RAN binding protein 2 1 1
MIRT042470 RPL26 ribosomal protein L26 1 1
MIRT042471 POLR3H polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) 1 1
MIRT042472 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT042473 COPA coatomer protein complex, subunit alpha 1 1
MIRT042474 C17orf70 chromosome 17 open reading frame 70 1 1
MIRT042475 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 1 1
MIRT042476 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT042477 NTN1 netrin 1 1 1
MIRT042478 HIST1H3D histone cluster 1, H3d 1 1
MIRT042479 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT042480 MTA2 metastasis associated 1 family, member 2 1 1
MIRT042481 CALR calreticulin 1 1
MIRT042482 H1F0 H1 histone family, member 0 1 1
MIRT042483 DPYSL3 dihydropyrimidinase-like 3 1 1
MIRT042484 RPL4 ribosomal protein L4 1 1
MIRT042485 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT042486 INCENP inner centromere protein antigens 135/155kDa 1 1
MIRT042487 ATP6V0D1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 1 1
MIRT042488 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT042489 FLII flightless I homolog (Drosophila) 1 1
MIRT042490 ALAS1 aminolevulinate, delta-, synthase 1 1 1
MIRT042491 PSMD1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 1 1
MIRT042492 NPTX2 neuronal pentraxin II 1 1
MIRT042493 SLC25A6 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 1 1
MIRT042494 KIAA1524 KIAA1524 1 1
MIRT042495 FLOT2 flotillin 2 1 1
MIRT042496 SF3B1 splicing factor 3b, subunit 1, 155kDa 1 1
MIRT042497 ETF1 eukaryotic translation termination factor 1 1 1
MIRT042498 EAF1 ELL associated factor 1 1 1
MIRT042499 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT042500 RBM15B RNA binding motif protein 15B 1 1
MIRT042501 PDCL phosducin-like 1 1
MIRT042502 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT042503 MCMBP chromosome 10 open reading frame 119 1 1
MIRT042504 ZNF420 zinc finger protein 420 1 1
MIRT042505 CYFIP2 cytoplasmic FMR1 interacting protein 2 1 1
MIRT042506 ROBO1 roundabout, axon guidance receptor, homolog 1 (Drosophila) 1 1
MIRT042507 USMG5 up-regulated during skeletal muscle growth 5 homolog (mouse) 1 1
MIRT042508 LARP1B La ribonucleoprotein domain family, member 1B 1 1
MIRT042509 GLDC glycine dehydrogenase (decarboxylating) 1 1
MIRT042510 COMMD9 COMM domain containing 9 1 1
MIRT042511 FADS2 fatty acid desaturase 2 1 1
MIRT042512 DDX46 DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 1 1
MIRT042513 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT042514 MRPS18A mitochondrial ribosomal protein S18A 1 1
MIRT042515 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT042516 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT042517 CDK7 cyclin-dependent kinase 7 1 1
MIRT042518 ZNF503 zinc finger protein 503 1 1
MIRT042519 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT042520 MOGS mannosyl-oligosaccharide glucosidase 1 1
MIRT042521 CYTB cytochrome b 1 1
MIRT042522 NUBP1 nucleotide binding protein 1 (MinD homolog, E. coli) 1 1
MIRT042523 LYPLA2 lysophospholipase II 1 1
MIRT042524 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT042525 PUS3 pseudouridylate synthase 3 1 1
MIRT042526 NUDT2 nudix (nucleoside diphosphate linked moiety X)-type motif 2 1 1
MIRT042527 SEPN1 selenoprotein N, 1 1 1
MIRT042528 UBE4B ubiquitination factor E4B (UFD2 homolog, yeast) 1 1
MIRT042529 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT042530 RPL3 ribosomal protein L3 1 1
MIRT042531 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT042532 B4GALNT3 beta-1,4-N-acetyl-galactosaminyl transferase 3 1 1
MIRT042533 LRRC8B leucine rich repeat containing 8 family, member B 1 1
MIRT042534 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT042535 PML promyelocytic leukemia 1 1
MIRT042536 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT042537 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT042538 MCM2 minichromosome maintenance complex component 2 1 1
MIRT042539 TMEM9B TMEM9 domain family, member B 1 1
MIRT042540 NUPL1 nucleoporin like 1 1 1
MIRT042541 RBBP4 retinoblastoma binding protein 4 1 1
MIRT042542 ARHGEF2 Rho/Rac guanine nucleotide exchange factor (GEF) 2 1 1
MIRT042543 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT042544 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT042545 LARP4 La ribonucleoprotein domain family, member 4 1 1
MIRT042546 SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 1 1
MIRT042547 RXRA retinoid X receptor, alpha 1 1
MIRT042548 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT042549 EIF4B eukaryotic translation initiation factor 4B 1 1
MIRT042550 PSMD8 proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 1 1
MIRT042551 PTMS parathymosin 1 1
MIRT042552 TBCE tubulin folding cofactor E 1 1
MIRT042553 STOML2 stomatin (EPB72)-like 2 1 1
MIRT042554 UPF1 UPF1 regulator of nonsense transcripts homolog (yeast) 1 1
MIRT042555 SET SET nuclear oncogene 1 1
MIRT042556 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT042557 SRSF1 splicing factor, arginine/serine-rich 1 1 1
MIRT042558 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT042559 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT042560 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT042561 MAPK3 mitogen-activated protein kinase 3 1 1
MIRT042562 LRR1 peptidylprolyl isomerase (cyclophilin)-like 5 1 1
MIRT042563 RNF185 ring finger protein 185 1 1
MIRT042564 WIZ widely interspaced zinc finger motifs 1 1
MIRT042565 FBRSL1 fibrosin-like 1 1 1
MIRT042566 RTCB chromosome 22 open reading frame 28 1 1
MIRT042567 PEPD peptidase D 1 1
MIRT042568 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT042569 MYB v-myb myeloblastosis viral oncogene homolog (avian) 1 1
MIRT042570 NARF nuclear prelamin A recognition factor 1 1
MIRT042571 TXLNA taxilin alpha 1 1
MIRT042572 AKT2 v-akt murine thymoma viral oncogene homolog 2 1 1
MIRT042573 KIAA0319L KIAA0319-like 1 1
MIRT042574 MRFAP1 Mof4 family associated protein 1 1 1
MIRT042575 ZNF324 zinc finger protein 324 1 1
MIRT042576 METTL16 methyltransferase 10 domain containing 1 1
MIRT042577 MIB2 mindbomb homolog 2 (Drosophila) 1 1
MIRT042578 PFKL phosphofructokinase, liver 1 1
MIRT042579 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT042580 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT042581 SF3B4 splicing factor 3b, subunit 4, 49kDa 1 1
MIRT042582 RAI14 retinoic acid induced 14 1 1
MIRT042583 SZT2 KIAA0467 1 1
MIRT042584 RPLP1 ribosomal protein, large, P1 1 1
MIRT042585 CCNT2 cyclin T2 1 1
MIRT042586 RPS2 ribosomal protein S2 1 1
MIRT042587 RRP1 ribosomal RNA processing 1 homolog (S. cerevisiae) 1 1
MIRT042588 SUCLG1 succinate-CoA ligase, alpha subunit 1 1
MIRT042589 KIDINS220 kinase D-interacting substrate, 220kDa 1 1
MIRT042590 HIAT1 hippocampus abundant transcript 1 1 1
MIRT042591 FEM1A fem-1 homolog a (C. elegans) 1 1
MIRT042592 ZFYVE20 zinc finger, FYVE domain containing 20 1 1
MIRT042593 KIAA1671 KIAA1671 1 1
MIRT042594 C22orf42 chromosome 22 open reading frame 42 1 1
MIRT042595 LSM4 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT042596 FOXJ2 forkhead box J2 1 1
MIRT042597 KIF1A kinesin family member 1A 1 1
MIRT042598 HGS hepatocyte growth factor-regulated tyrosine kinase substrate 1 1
MIRT042599 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT042600 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT042601 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT042602 ADCY1 adenylate cyclase 1 (brain) 1 1
MIRT042603 RPP25L chromosome 9 open reading frame 23 1 1
MIRT042604 MTHFR methylenetetrahydrofolate reductase (NAD(P)H) 1 1
MIRT042605 NAA10 N(alpha)-acetyltransferase 10, NatA catalytic subunit 1 1
MIRT042606 TLE1 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) 1 1
MIRT042607 TNPO3 transportin 3 1 1
MIRT042608 C1orf56 chromosome 1 open reading frame 56 1 1
MIRT042609 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT042610 DGCR6L DiGeorge syndrome critical region gene 6-like 1 1
MIRT042611 HLA-C major histocompatibility complex, class I, C 1 1
MIRT042612 SH2B1 SH2B adaptor protein 1 1 1
MIRT042613 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT042614 PPAN peter pan homolog (Drosophila) 1 1
MIRT042615 PTCD2 pentatricopeptide repeat domain 2 1 1
MIRT042616 FRMD4A FERM domain containing 4A 1 1
MIRT042617 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 1 1
MIRT042618 TAGLN2 transgelin 2 1 1
MIRT042619 GPS1 G protein pathway suppressor 1 1 1
MIRT042620 SAC3D1 SAC3 domain containing 1 1 1
MIRT042621 ZFYVE27 zinc finger, FYVE domain containing 27 1 1
MIRT042622 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT042623 EIF5A eukaryotic translation initiation factor 5A 1 1
MIRT042624 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT042625 ATP8B2 ATPase, class I, type 8B, member 2 1 1
MIRT042626 SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 1 1
MIRT042627 TRPM2 transient receptor potential cation channel, subfamily M, member 2 1 1
MIRT042628 ARFGAP1 ADP-ribosylation factor GTPase activating protein 1 1 1
MIRT042629 DDX56 DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 1 1
MIRT042630 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT042631 APP amyloid beta (A4) precursor protein 1 1
MIRT042632 FBXL19 F-box and leucine-rich repeat protein 19 1 1
MIRT042633 HDLBP high density lipoprotein binding protein 1 1
MIRT042634 CEP78 centrosomal protein 78kDa 1 1
MIRT042635 LYPD1 LY6/PLAUR domain containing 1 1 1
MIRT042636 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT042637 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT042638 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 1 1
MIRT042639 FASN fatty acid synthase 1 1
MIRT042640 ABHD12 abhydrolase domain containing 12 1 1
MIRT042641 HOXD13 homeobox D13 1 1
MIRT042642 MICALL1 MICAL-like 1 1 1
MIRT042643 ZNF561 zinc finger protein 561 1 1
MIRT042644 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT042645 NUP210 nucleoporin 210kDa 1 1
MIRT042646 PKM pyruvate kinase, muscle 1 1
MIRT042647 POLR2L polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa 1 1
MIRT042648 UBE2J2 ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast) 1 1
MIRT042649 RNF213 ring finger protein 213 1 1
MIRT042650 REEP2 receptor accessory protein 2 1 1
MIRT042651 URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 1 1