Accession ID: MIRT018730 [miRNA, hsa-miR-335-5p :: GCK, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-335LinkOut: [miRBase ]
Synonyms MIRN335, hsa-mir-335, miRNA335, MIR335
Description Homo sapiens miR-335 stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-335-5p
Mature Sequence 16| UCAAGAGCAAUAACGAAAAAUGU |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-335-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GCK LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FGQTL3, GK, GLK, HHF3, HK4, HKIV, HXKP, LGLK, MODY2
Description glucokinase (hexokinase 4)
Transcript NM_0001    LinkOut: [ RefSeq ]
Other Transcripts NM_0335 , NM_0335   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GCK LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GCK
(miRNA target sites are highlighted)
>GCK|NM_0001|3'UTR
   1 TGAGAGCAGTGGCCGCAAGCGCAGGGAGGATGCCACAGCCCCACAGCACCCAGGCTCCATGGGGAAGTGCTCCCCACACG
  81 TGCTCGCAGCCTGGCGGGGCAGGAGGCCTGGCCTTGTCAGGACCCAGGCCGCCTGCCATACCGCTGGGGAACAGAGCGGG
 161 CCTCTTCCCTCAGTTTTTCGGTGGGACAGCCCCAGGGCCCTAACGGGGGTGCGGCAGGAGCAGGAACAGAGACTCTGGAA
 241 GCCCCCCACCTTTCTCGCTGGAATCAATTTCCCAGAAGGGAGTTGCTCACTCAGGACTTTGATGCATTTCCACACTGTCA
 321 GAGCTGTTGGCCTCGCCTGGGCCCAGGCTCTGGGAAGGGGTGCCCTCTGGATCCTGCTGTGGCCTCACTTCCCTGGGAAC
 401 TCATCCTGTGTGGGGAGGCAGCTCCAACAGCTTGACCAGACCTAGACCTGGGCCAAAAGGGCAGCCAGGGGCTGCTCATC
 481 ACCCAGTCCTGGCCATTTTCTTGCCTGAGGCTCAAGAGGCCCAGGGAGCAATGGGAGGGGGCTCCATGGAGGAGGTGTCC
 561 CAAGCTTTGAATACCCCCAGAGACCTTTTCTCTCCCATACCATCACTGAGTGGCTTGTGATTCTGGGATGGACCCTCGCA
 641 GCAGGTGCAAGAGACAGAGCCCCCAAGCCTCTGCCCCAAGGGGCCCACAAAGGGGAGAAGGGCCAGCCCTACATCTTCAG
 721 CTCCCATAGCGCTGGCTCAGGAAGAAACCCCAAGCAGCATTCAGCACACCCCAAGGGACAACCCCATCATATGACATGCC
 801 ACCCTCTCCATGCCCAACCTAAGATTGTGTGGGTTTTTTAATTAAAAATGTTAAAAGTTTTAAACATGAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uguaaAAAG------CAAUAACGAGAACu 5'
               ||||      || |  ||| ||| 
Target 5' atgcaTTTCCACACTGTCAGAGCTGTTGg 3'
302 - 330 116.00 -7.90
2
miRNA  3' uguaaaaagcaauaaCGAGAACu 5'
                         ||||| | 
Target 5' ctcgcctgggcccagGCTCTGGg 3'
332 - 354 108.00 -10.40
3
miRNA  3' uguaaaaagcaauaacGAGAACu 5'
                          :||||| 
Target 5' cccagtcctggccattTTCTTGc 3'
482 - 504 104.00 -6.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-335-5p :: GCK    [ Functional MTI ]
Validation Method Microarray
Article - Tavazoie, S. F. Alarcon, C. Oskarsson, T. et al.
- Nature, 2008
A search for general regulators of cancer metastasis has yielded a set of microRNAs for which expression is specifically lost as human breast cancer cells develop metastatic potential. Here we show that restoring the expression of these microRNAs in malignant cells suppresses lung and bone metastasis by human cancer cells in vivo. Of these microRNAs, miR-126 restoration reduces overall tumour growth and proliferation, whereas miR-335 inhibits metastatic cell invasion. miR-335 regulates a set of genes whose collective expression in a large cohort of human tumours is associated with risk of distal metastasis. miR-335 suppresses metastasis and migration through targeting of the progenitor cell transcription factor SOX4 and extracellular matrix component tenascin C. Expression of miR-126 and miR-335 is lost in the majority of primary breast tumours from patients who relapse, and the loss of expression of either microRNA is associated with poor distal metastasis-free survival. miR-335 and miR-126 are thus identified as metastasis suppressor microRNAs in human breast cancer.
LinkOut: [PMID: 18185580]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
2542 hsa-miR-335-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000666 TNC tenascin C 3 2
MIRT002429 MERTK c-mer proto-oncogene tyrosine kinase 3 2
MIRT002430 PTPRN2 protein tyrosine phosphatase, receptor type, N polypeptide 2 3 2
MIRT002431 SOX4 SRY (sex determining region Y)-box 4 3 3
MIRT003229 ARPC5L actin related protein 2/3 complex, subunit 5-like 2 1
MIRT003230 RASA1 RAS p21 protein activator (GTPase activating protein) 1 2 1
MIRT003587 RB1 retinoblastoma 1 4 2
MIRT004083 UBE2F ubiquitin-conjugating enzyme E2F (putative) 2 1
MIRT005888 RUNX2 runt-related transcription factor 2 4 1
MIRT006109 BCL2L2 BCL2-like 2 3 1
MIRT006110 TFF2 trefoil factor 2 4 2
MIRT006447 MAPK1 mitogen-activated protein kinase 1 4 1
MIRT006448 LRG1 leucine-rich alpha-2-glycoprotein 1 4 1
MIRT006620 Daam1 dishevelled associated activator of morphogenesis 1 4 1
MIRT007304 BIRC5 baculoviral IAP repeat-containing 5 1 1
MIRT016695 CD69 CD69 molecule 1 1
MIRT016696 DEFB126 defensin, beta 126 1 1
MIRT016697 PPP1R3D protein phosphatase 1, regulatory (inhibitor) subunit 3D 1 1
MIRT016698 ZNF609 zinc finger protein 609 1 1
MIRT016699 SYT12 synaptotagmin XII 1 1
MIRT016700 TNNI1 troponin I type 1 (skeletal, slow) 1 1
MIRT016701 IFNA21 interferon, alpha 21 1 1
MIRT016702 BSN bassoon (presynaptic cytomatrix protein) 1 1
MIRT016703 EREG epiregulin 1 1
MIRT016704 SYCP2L synaptonemal complex protein 2-like 1 1
MIRT016705 FBP2 fructose-1,6-bisphosphatase 2 1 1
MIRT016706 IL17A interleukin 17A 1 1
MIRT016707 KCNH2 potassium voltage-gated channel, subfamily H (eag-related), member 2 1 1
MIRT016708 SCP2D1 chromosome 20 open reading frame 79 1 1
MIRT016709 NPY neuropeptide Y 1 1
MIRT016710 CACNB3 calcium channel, voltage-dependent, beta 3 subunit 1 1
MIRT016711 CRYGC crystallin, gamma C 1 1
MIRT016712 USH1C Usher syndrome 1C (autosomal recessive, severe) 1 1
MIRT016713 PCDHGC4 protocadherin gamma subfamily C, 4 1 1
MIRT016714 C8orf12 chromosome 8 open reading frame 12 1 1
MIRT016715 KLRC1 killer cell lectin-like receptor subfamily C, member 1 1 1
MIRT016716 XKRX XK, Kell blood group complex subunit-related, X-linked 1 1
MIRT016717 SIX6 SIX homeobox 6 1 1
MIRT016718 FAM99A family with sequence similarity 99, member A 1 1
MIRT016719 HMBOX1 homeobox containing 1 1 1
MIRT016720 DAZL deleted in azoospermia-like 1 1
MIRT016721 APLP1 amyloid beta (A4) precursor-like protein 1 1 1
MIRT016722 GAGE2D G antigen 2D 1 1
MIRT016723 ADCY6 adenylate cyclase 6 1 1
MIRT016724 EFNA1 ephrin-A1 1 1
MIRT016725 OR11A1 olfactory receptor, family 11, subfamily A, member 1 1 1
MIRT016726 DYNC1I1 dynein, cytoplasmic 1, intermediate chain 1 1 1
MIRT016727 DNASE1L3 deoxyribonuclease I-like 3 1 1
MIRT016728 KDM5B lysine (K)-specific demethylase 5B 1 1
MIRT016729 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 1
MIRT016730 MEF2A myocyte enhancer factor 2A 1 1
MIRT016731 MIR34C microRNA 34c 1 1
MIRT016732 TREML3P triggering receptor expressed on myeloid cells-like 3 1 1
MIRT016733 LRRC4 leucine rich repeat containing 4 1 1
MIRT016734 SLC26A3 solute carrier family 26, member 3 1 1
MIRT016735 DCST2 DC-STAMP domain containing 2 1 1
MIRT016736 ZNF641 zinc finger protein 641 1 1
MIRT016737 IDUA iduronidase, alpha-L- 1 1
MIRT016738 ZFAND3 zinc finger, AN1-type domain 3 1 1
MIRT016739 ZC3H11B zinc finger CCCH-type containing 11B pseudogene 1 1
MIRT016740 TMPRSS12 transmembrane (C-terminal) protease, serine 12 1 1
MIRT016741 KCNH3 potassium voltage-gated channel, subfamily H (eag-related), member 3 1 1
MIRT016742 KLRB1 killer cell lectin-like receptor subfamily B, member 1 1 1
MIRT016743 TTC6 chromosome 14 open reading frame 25 1 1
MIRT016744 MMP20 matrix metallopeptidase 20 1 1
MIRT016745 ARHGAP5 Rho GTPase activating protein 5 1 1
MIRT016746 PTPRH protein tyrosine phosphatase, receptor type, H 1 1
MIRT016747 KRTAP10-2 keratin associated protein 10-2 1 1
MIRT016748 SYNPO2 synaptopodin 2 1 1
MIRT016749 GCNT2 glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) 1 1
MIRT016750 DEFB118 defensin, beta 118 1 1
MIRT016751 NBEA neurobeachin 1 1
MIRT016752 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT016753 LHX9 LIM homeobox 9 1 1
MIRT016754 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 1 1
MIRT016755 SLC46A3 solute carrier family 46, member 3 1 1
MIRT016756 USH2A Usher syndrome 2A (autosomal recessive, mild) 1 1
MIRT016757 CYP21A1P cytochrome P450, family 21, subfamily A, polypeptide 1 pseudogene 1 1
MIRT016758 WNT9A wingless-type MMTV integration site family, member 9A 1 1
MIRT016759 PRAMEF14 PRAME family member 14 1 1
MIRT016760 VNN2 vanin 2 1 1
MIRT016761 DMGDH dimethylglycine dehydrogenase 1 1
MIRT016762 NGFR nerve growth factor receptor 1 1
MIRT016763 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT016764 PLD4 phospholipase D family, member 4 1 1
MIRT016765 CCDC108 coiled-coil domain containing 108 1 1
MIRT016766 ST6GALNAC1 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 1 1
MIRT016767 SEC14L4 SEC14-like 4 (S. cerevisiae) 1 1
MIRT016768 KIAA1033 KIAA1033 1 1
MIRT016769 CCL15 chemokine (C-C motif) ligand 15 1 1
MIRT016770 INHBE inhibin, beta E 1 1
MIRT016771 RXRB retinoid X receptor, beta 1 1
MIRT016772 SYVN1 synovial apoptosis inhibitor 1, synoviolin 1 1
MIRT016773 CYGB cytoglobin 1 1
MIRT016774 ORAI3 ORAI calcium release-activated calcium modulator 3 1 1
MIRT016775 KRT72 keratin 72 1 1
MIRT016776 FAM110C family with sequence similarity 110, member C 1 1
MIRT016777 PIP5KL1 phosphatidylinositol-4-phosphate 5-kinase-like 1 1 1
MIRT016778 SVIL supervillin 1 1
MIRT016779 KIAA1551 chromosome 12 open reading frame 35 1 1
MIRT016780 RIPPLY2 ripply2 homolog (zebrafish) 1 1
MIRT016781 GNMT glycine N-methyltransferase 1 1
MIRT016782 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT016783 KDM4C lysine (K)-specific demethylase 4C 1 1
MIRT016784 KAAG1 kidney associated antigen 1 1 1
MIRT016785 USP29 ubiquitin specific peptidase 29 1 1
MIRT016786 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1 1
MIRT016787 OR2J3 olfactory receptor, family 2, subfamily J, member 3 1 1
MIRT016788 GC group-specific component (vitamin D binding protein) 1 1
MIRT016789 PPP1R17 chromosome 7 open reading frame 16 1 1
MIRT016790 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT016791 RASL10A RAS-like, family 10, member A 1 1
MIRT016792 CACNG1 calcium channel, voltage-dependent, gamma subunit 1 1 1
MIRT016793 CD24P4 CD24 molecule-like 4 pseudogene 1 1
MIRT016794 ECE1 endothelin converting enzyme 1 1 1
MIRT016795 SEC24D SEC24 family, member D (S. cerevisiae) 1 1
MIRT016796 TMEM154 transmembrane protein 154 1 1
MIRT016797 CYTL1 cytokine-like 1 1 1
MIRT016798 ACOT8 acyl-CoA thioesterase 8 1 1
MIRT016799 ABCC11 ATP-binding cassette, sub-family C (CFTR/MRP), member 11 1 1
MIRT016800 POU6F2 POU class 6 homeobox 2 1 1
MIRT016801 SOBP sine oculis binding protein homolog (Drosophila) 1 1
MIRT016802 HIST1H4I histone cluster 1, H4i 1 1
MIRT016803 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 1 1
MIRT016804 ASIP agouti signaling protein, nonagouti homolog (mouse) 1 1
MIRT016805 JAG2 jagged 2 1 1
MIRT016806 PRSS53 protease, serine, 53 1 1
MIRT016807 SEMA3B sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B 1 1
MIRT016808 ARRB1 arrestin, beta 1 1 1
MIRT016809 PDE4A phosphodiesterase 4A, cAMP-specific (phosphodiesterase E2 dunce homolog, Drosophila) 1 1
MIRT016810 PPP3R2 protein phosphatase 3, regulatory subunit B, beta 1 1
MIRT016811 ARHGEF28 190 kDa guanine nucleotide exchange factor 1 1
MIRT016812 NOL4 nucleolar protein 4 1 1
MIRT016813 SOX5 SRY (sex determining region Y)-box 5 1 1
MIRT016814 SERPINA1 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 1 1
MIRT016815 EGLN1 egl nine homolog 1 (C. elegans) 1 1
MIRT016816 SH2D3A SH2 domain containing 3A 1 1
MIRT016817 CD14 CD14 molecule 1 1
MIRT016818 ESAM endothelial cell adhesion molecule 1 1
MIRT016819 GALNT16 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1 1 1
MIRT016820 PLEKHG1 pleckstrin homology domain containing, family G (with RhoGef domain) member 1 1 1
MIRT016821 SCN1B sodium channel, voltage-gated, type I, beta 1 1
MIRT016822 FAM84B family with sequence similarity 84, member B 1 1
MIRT016823 FBXL8 F-box and leucine-rich repeat protein 8 1 1
MIRT016824 ULK2 unc-51-like kinase 2 (C. elegans) 1 1
MIRT016825 CCNG2 cyclin G2 1 1
MIRT016826 ZNF654 zinc finger protein 654 1 1
MIRT016827 ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 1 1
MIRT016828 LRP1B low density lipoprotein receptor-related protein 1B 1 1
MIRT016829 C7orf31 chromosome 7 open reading frame 31 1 1
MIRT016830 POU2F3 POU class 2 homeobox 3 1 1
MIRT016831 PARK2 Parkinson disease (autosomal recessive, juvenile) 2, parkin 1 1
MIRT016832 VAT1 vesicle amine transport protein 1 homolog (T. californica) 1 1
MIRT016833 EDDM3B epididymal protein 3B 1 1
MIRT016834 SLFN5 schlafen family member 5 1 1
MIRT016835 TRAV22 T cell receptor alpha variable 22 1 1
MIRT016836 TSPYL2 TSPY-like 2 1 1
MIRT016837 UBE4B ubiquitination factor E4B (UFD2 homolog, yeast) 1 1
MIRT016838 NUCB1 nucleobindin 1 1 1
MIRT016839 IL17RD interleukin 17 receptor D 1 1
MIRT016840 FCRL4 Fc receptor-like 4 1 1
MIRT016841 TBATA chromosome 10 open reading frame 27 1 1
MIRT016842 CASP14 caspase 14, apoptosis-related cysteine peptidase 1 1
MIRT016843 CHRNA7 cholinergic receptor, nicotinic, alpha 7 1 1
MIRT016844 PNPLA3 patatin-like phospholipase domain containing 3 1 1
MIRT016845 ODF3L1 outer dense fiber of sperm tails 3-like 1 1 1
MIRT016846 ADAM21 ADAM metallopeptidase domain 21 1 1
MIRT016847 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT016848 WNT7B wingless-type MMTV integration site family, member 7B 1 1
MIRT016849 LINC00313 chromosome 21 open reading frame 84 1 1
MIRT016850 ATP10A ATPase, class V, type 10A 1 1
MIRT016851 DNMBP dynamin binding protein 1 1
MIRT016852 F10 coagulation factor X 1 1
MIRT016853 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT016854 MEGF11 multiple EGF-like-domains 11 1 1
MIRT016855 ATP10D ATPase, class V, type 10D 1 1
MIRT016856 APOBEC4 apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative) 1 1
MIRT016857 C20orf194 chromosome 20 open reading frame 194 1 1
MIRT016858 TMEM130 transmembrane protein 130 1 1
MIRT016859 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 1 1
MIRT016860 KRT19 keratin 19 1 1
MIRT016861 PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 1 1
MIRT016862 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT016863 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 1
MIRT016864 ROR2 receptor tyrosine kinase-like orphan receptor 2 1 1
MIRT016865 ZCCHC24 zinc finger, CCHC domain containing 24 1 1
MIRT016866 SPP1 secreted phosphoprotein 1 1 1
MIRT016867 RNF214 ring finger protein 214 1 1
MIRT016868 CDRT4 CMT1A duplicated region transcript 4 1 1
MIRT016869 ZNF821 zinc finger protein 821 1 1
MIRT016870 FABP6 fatty acid binding protein 6, ileal 1 1
MIRT016871 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT016872 CDR1 cerebellar degeneration-related protein 1, 34kDa 1 1
MIRT016873 MBD5 methyl-CpG binding domain protein 5 1 1
MIRT016874 HRH2 histamine receptor H2 1 1
MIRT016875 RHOB ras homolog gene family, member B 1 1
MIRT016876 MAPK4 mitogen-activated protein kinase 4 1 1
MIRT016877 ALDOC aldolase C, fructose-bisphosphate 1 1
MIRT016878 SLC37A1 solute carrier family 37 (glycerol-3-phosphate transporter), member 1 1 1
MIRT016879 ACOT4 acyl-CoA thioesterase 4 1 1
MIRT016880 KLF4 Kruppel-like factor 4 (gut) 1 1
MIRT016881 TIAF1 TGFB1-induced anti-apoptotic factor 1 1 1
MIRT016882 SOX13 SRY (sex determining region Y)-box 13 1 1
MIRT016883 SYNGR3 synaptogyrin 3 1 1
MIRT016884 JUP junction plakoglobin 1 1
MIRT016885 CFP complement factor properdin 1 1
MIRT016886 OTUB2 OTU domain, ubiquitin aldehyde binding 2 1 1
MIRT016887 PER1 period homolog 1 (Drosophila) 1 1
MIRT016888 GALNT12 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12) 1 1
MIRT016889 TMEM155 transmembrane protein 155 1 1
MIRT016890 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT016891 ERO1LB ERO1-like beta (S. cerevisiae) 1 1
MIRT016892 LYPD4 LY6/PLAUR domain containing 4 1 1
MIRT016893 SETX senataxin 1 1
MIRT016894 C20orf141 chromosome 20 open reading frame 141 1 1
MIRT016895 GALNT5 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5) 1 1
MIRT016896 RAB3C RAB3C, member RAS oncogene family 1 1
MIRT016897 GOLGA6L9 golgin A6 family-like 9 1 1
MIRT016898 BAZ2B bromodomain adjacent to zinc finger domain, 2B 1 1
MIRT016899 SORBS2 sorbin and SH3 domain containing 2 1 1
MIRT016900 CYP21A2 cytochrome P450, family 21, subfamily A, polypeptide 2 1 1
MIRT016901 NEFM neurofilament, medium polypeptide 1 1
MIRT016902 HYOU1 hypoxia up-regulated 1 1 1
MIRT016903 GAGE12B G antigen 12B 1 1
MIRT016904 LHX6 LIM homeobox 6 1 1
MIRT016905 CC2D2B coiled-coil and C2 domain containing 2B 1 1
MIRT016906 PCDHGA8 protocadherin gamma subfamily A, 8 1 1
MIRT016907 SERINC2 serine incorporator 2 1 1
MIRT016908 EPHA4 EPH receptor A4 1 1
MIRT016909 C11orf52 chromosome 11 open reading frame 52 1 1
MIRT016910 RRBP1 ribosome binding protein 1 homolog 180kDa (dog) 1 1
MIRT016911 VEGFA vascular endothelial growth factor A 1 1
MIRT016912 SCRG1 stimulator of chondrogenesis 1 1 1
MIRT016913 TUBGCP6 tubulin, gamma complex associated protein 6 1 1
MIRT016914 CDH20 cadherin 20, type 2 1 1
MIRT016915 RAB4B RAB4B, member RAS oncogene family 1 1
MIRT016916 SYT14 synaptotagmin XIV 1 1
MIRT016917 HTR7 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) 1 1
MIRT016918 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT016919 IL25 interleukin 25 1 1
MIRT016920 DUSP16 dual specificity phosphatase 16 1 1
MIRT016921 DNAAF2 chromosome 14 open reading frame 104 1 1
MIRT016922 PRAMEF17 PRAME family member 17 1 1
MIRT016923 DNASE2B deoxyribonuclease II beta 1 1
MIRT016924 SNED1 sushi, nidogen and EGF-like domains 1 1 1
MIRT016925 TUSC5 tumor suppressor candidate 5 1 1
MIRT016926 MEIS3 Meis homeobox 3 1 1
MIRT016927 DDIT3 DNA-damage-inducible transcript 3 1 1
MIRT016928 CD8A CD8a molecule 1 1
MIRT016929 CHD6 chromodomain helicase DNA binding protein 6 1 1
MIRT016930 ZNF771 zinc finger protein 771 1 1
MIRT016931 LATS1 LATS, large tumor suppressor, homolog 1 (Drosophila) 1 1
MIRT016932 FN3K fructosamine 3 kinase 1 1
MIRT016933 FOXO1 forkhead box O1 1 1
MIRT016934 FAM160A2 family with sequence similarity 160, member A2 1 1
MIRT016935 SALL4 sal-like 4 (Drosophila) 1 1
MIRT016936 CAPN11 calpain 11 1 1
MIRT016937 BRAT1 chromosome 7 open reading frame 27 1 1
MIRT016938 LTC4S leukotriene C4 synthase 1 1
MIRT016939 DAAM1 dishevelled associated activator of morphogenesis 1 1 1
MIRT016940 LPAL2 lipoprotein, Lp(a)-like 2 pseudogene 1 1
MIRT016941 FGF16 fibroblast growth factor 16 1 1
MIRT016942 KCNC1 potassium voltage-gated channel, Shaw-related subfamily, member 1 1 1
MIRT016943 RNF213 ring finger protein 213 1 1
MIRT016944 CXCL9 chemokine (C-X-C motif) ligand 9 1 1
MIRT016945 TMPRSS13 transmembrane protease, serine 13 1 1
MIRT016946 ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3 1 1
MIRT016947 BBX bobby sox homolog (Drosophila) 1 1
MIRT016948 OR8G7P olfactory receptor, family 8, subfamily G, member 7 pseudogene 1 1
MIRT016949 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT016950 TRIB1 tribbles homolog 1 (Drosophila) 1 1
MIRT016951 VIP vasoactive intestinal peptide 1 1
MIRT016952 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT016953 CPNE5 copine V 1 1
MIRT016955 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT016956 C12orf56 chromosome 12 open reading frame 56 1 1
MIRT016957 CABP1 calcium binding protein 1 1 1
MIRT016958 KIF17 kinesin family member 17 1 1
MIRT016959 ZFP57 zinc finger protein 57 homolog (mouse) 1 1
MIRT016960 DAPK2 death-associated protein kinase 2 1 1
MIRT016961 HSPA1L heat shock 70kDa protein 1-like 1 1
MIRT016962 IL37 interleukin 1 family, member 7 (zeta) 1 1
MIRT016963 LINC00324 chromosome 17 open reading frame 44 1 1
MIRT016964 YPEL5 yippee-like 5 (Drosophila) 1 1
MIRT016965 LRRC41 leucine rich repeat containing 41 1 1
MIRT016966 C21orf62 chromosome 21 open reading frame 62 1 1
MIRT016967 ITPR2 inositol 1,4,5-triphosphate receptor, type 2 1 1
MIRT016968 NECAB1 N-terminal EF-hand calcium binding protein 1 1 1
MIRT016969 DYRK1B dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B 1 1
MIRT016970 MMP14 matrix metallopeptidase 14 (membrane-inserted) 1 1
MIRT016971 ACSM1 acyl-CoA synthetase medium-chain family member 1 1 1
MIRT016972 ITGB2 integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) 1 1
MIRT016973 SIGLEC5 sialic acid binding Ig-like lectin 5 1 1
MIRT016974 PSORS1C1 psoriasis susceptibility 1 candidate 1 1 1
MIRT016975 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 1 1
MIRT016976 GREB1 growth regulation by estrogen in breast cancer 1 1 1
MIRT016977 GLS2 glutaminase 2 (liver, mitochondrial) 1 1
MIRT016978 KDR kinase insert domain receptor (a type III receptor tyrosine kinase) 1 1
MIRT016979 CSF1 colony stimulating factor 1 (macrophage) 1 1
MIRT016980 HECTD4 chromosome 12 open reading frame 51 1 1
MIRT016981 TET2 tet oncogene family member 2 1 1
MIRT016982 DHCR7 7-dehydrocholesterol reductase 1 1
MIRT016983 PCDHB10 protocadherin beta 10 1 1
MIRT016984 GFAP glial fibrillary acidic protein 1 1
MIRT016985 OR8D2 olfactory receptor, family 8, subfamily D, member 2 1 1
MIRT016986 ESRP1 epithelial splicing regulatory protein 1 1 1
MIRT016987 ARHGEF4 Rho guanine nucleotide exchange factor (GEF) 4 1 1
MIRT016988 SLC25A41 solute carrier family 25, member 41 1 1
MIRT016989 ZKSCAN2 zinc finger with KRAB and SCAN domains 2 1 1
MIRT016990 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT016991 ANGPT4 angiopoietin 4 1 1
MIRT016992 GABRP gamma-aminobutyric acid (GABA) A receptor, pi 1 1
MIRT016993 GRB7 growth factor receptor-bound protein 7 1 1
MIRT016994 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT016995 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A 1 1
MIRT016996 PHF21A PHD finger protein 21A 1 1
MIRT016997 OSMR oncostatin M receptor 1 1
MIRT016998 GULP1 GULP, engulfment adaptor PTB domain containing 1 1 1
MIRT016999 PCYOX1 prenylcysteine oxidase 1 1 1
MIRT017000 GPR50 G protein-coupled receptor 50 1 1
MIRT017001 SASH1 SAM and SH3 domain containing 1 1 1
MIRT017002 MANBA mannosidase, beta A, lysosomal 1 1
MIRT017003 HIST1H4L histone cluster 1, H4l 1 1
MIRT017004 BFSP2 beaded filament structural protein 2, phakinin 1 1
MIRT017005 SOX1 SRY (sex determining region Y)-box 1 1 1
MIRT017006 RASGEF1A RasGEF domain family, member 1A 1 1
MIRT017007 CLIC3 chloride intracellular channel 3 1 1
MIRT017008 GBX2 gastrulation brain homeobox 2 1 1
MIRT017009 LEPR leptin receptor 1 1
MIRT017010 GRIK1-AS1 non-protein coding RNA 110 1 1
MIRT017011 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT017012 TRAV23DV6 T cell receptor alpha variable 23/delta variable 6 1 1
MIRT017013 FGF23 fibroblast growth factor 23 1 1
MIRT017014 CXorf58 chromosome X open reading frame 58 1 1
MIRT017015 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT017016 STAT6 signal transducer and activator of transcription 6, interleukin-4 induced 1 1
MIRT017017 SIGIRR single immunoglobulin and toll-interleukin 1 receptor (TIR) domain 1 1
MIRT017018 MFGE8 milk fat globule-EGF factor 8 protein 1 1
MIRT017019 SERPINB10 serpin peptidase inhibitor, clade B (ovalbumin), member 10 1 1
MIRT017020 ST14 suppression of tumorigenicity 14 (colon carcinoma) 1 1
MIRT017021 KIF27 kinesin family member 27 1 1
MIRT017022 TRRAP transformation/transcription domain-associated protein 1 1
MIRT017023 TEKT3 tektin 3 1 1
MIRT017024 ZNF461 zinc finger protein 461 1 1
MIRT017025 SDCCAG8 serologically defined colon cancer antigen 8 1 1
MIRT017026 PCDHGC5 protocadherin gamma subfamily C, 5 1 1
MIRT017027 FAM71F2 family with sequence similarity 71, member F2 1 1
MIRT017028 ARX aristaless related homeobox 1 1
MIRT017029 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 1
MIRT017030 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT017031 DYRK1A dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A 1 1
MIRT017032 CTDP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 1 1
MIRT017033 FTSJD2 FtsJ methyltransferase domain containing 2 1 1
MIRT017034 MLC1 megalencephalic leukoencephalopathy with subcortical cysts 1 1 1
MIRT017035 CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 1 1
MIRT017036 MAN1A1 mannosidase, alpha, class 1A, member 1 1 1
MIRT017037 TBX15 T-box 15 1 1
MIRT017038 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT017039 SUSD3 sushi domain containing 3 1 1
MIRT017040 RSPO3 R-spondin 3 homolog (Xenopus laevis) 1 1
MIRT017041 NIPSNAP1 nipsnap homolog 1 (C. elegans) 1 1
MIRT017042 RARRES2 retinoic acid receptor responder (tazarotene induced) 2 1 1
MIRT017043 PTAFR platelet-activating factor receptor 1 1
MIRT017044 THBD thrombomodulin 1 1
MIRT017045 SLC30A2 solute carrier family 30 (zinc transporter), member 2 1 1
MIRT017046 HOXA2 homeobox A2 1 1
MIRT017047 LINC00487 FLJ42418 protein 1 1
MIRT017048 TNFRSF9 tumor necrosis factor receptor superfamily, member 9 1 1
MIRT017049 HEY1 hairy/enhancer-of-split related with YRPW motif 1 1 1
MIRT017050 KIRREL kin of IRRE like (Drosophila) 1 1
MIRT017051 IL1A interleukin 1, alpha 1 1
MIRT017052 DEFB104A defensin, beta 104A 1 1
MIRT017053 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 1
MIRT017054 SH3D21 chromosome 1 open reading frame 113 1 1
MIRT017055 PDZD8 PDZ domain containing 8 1 1
MIRT017056 C8G complement component 8, gamma polypeptide 1 1
MIRT017057 TACSTD2 tumor-associated calcium signal transducer 2 1 1
MIRT017058 ASB11 ankyrin repeat and SOCS box-containing 11 1 1
MIRT017059 SCIMP chromosome 17 open reading frame 87 1 1
MIRT017060 MUC15 mucin 15, cell surface associated 1 1
MIRT017061 SHH sonic hedgehog homolog (Drosophila) 1 1
MIRT017062 PTH2 parathyroid hormone 2 1 1
MIRT017063 SLC2A12 solute carrier family 2 (facilitated glucose transporter), member 12 1 1
MIRT017064 EXD3 exonuclease 3'-5' domain containing 3 1 1
MIRT017065 OPN1MW2 opsin 1 (cone pigments), medium-wave-sensitive 2 1 1
MIRT017066 IGLV1-47 immunoglobulin lambda variable 1-47 1 1
MIRT017067 ZNF518A zinc finger protein 518A 1 1
MIRT017068 HSPB3 heat shock 27kDa protein 3 1 1
MIRT017069 KMT2E myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) 1 1
MIRT017070 IRX2 iroquois homeobox 2 1 1
MIRT017071 LRRK2 leucine-rich repeat kinase 2 1 1
MIRT017072 HOXA11 homeobox A11 1 1
MIRT017073 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT017074 MAML2 mastermind-like 2 (Drosophila) 1 1
MIRT017075 NPAS1 neuronal PAS domain protein 1 1 1
MIRT017076 XRRA1 X-ray radiation resistance associated 1 1 1
MIRT017077 CLCN2 chloride channel 2 1 1
MIRT017078 FNDC9 chromosome 5 open reading frame 40 1 1
MIRT017079 TANC2 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 1 1
MIRT017080 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT017081 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT017082 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT017083 DUSP5 dual specificity phosphatase 5 1 1
MIRT017084 G2E3 G2/M-phase specific E3 ubiquitin ligase 1 1
MIRT017085 ZFP69 zinc finger protein 642 1 1
MIRT017086 SPRR3 small proline-rich protein 3 1 1
MIRT017087 TOX2 TOX high mobility group box family member 2 1 1
MIRT017088 GRIK4 glutamate receptor, ionotropic, kainate 4 1 1
MIRT017089 FGD2 FYVE, RhoGEF and PH domain containing 2 1 1
MIRT017090 SH2D6 SH2 domain containing 6 1 1
MIRT017091 LTBP1 latent transforming growth factor beta binding protein 1 1 1
MIRT017092 NEUROD4 neurogenic differentiation 4 1 1
MIRT017093 RNF121 ring finger protein 121 1 1
MIRT017094 IL22 interleukin 22 1 1
MIRT017095 C4orf45 chromosome 4 open reading frame 45 1 1
MIRT017096 MAMLD1 mastermind-like domain containing 1 1 1
MIRT017097 PLAC8L1 PLAC8-like 1 1 1
MIRT017098 TEAD2 TEA domain family member 2 1 1
MIRT017099 PLD3 phospholipase D family, member 3 1 1
MIRT017100 TAZ tafazzin 1 1
MIRT017101 MYPN myopalladin 1 1
MIRT017102 MAP3K8 mitogen-activated protein kinase kinase kinase 8 1 1
MIRT017103 CNGB1 cyclic nucleotide gated channel beta 1 1 1
MIRT017104 ABCA12 ATP-binding cassette, sub-family A (ABC1), member 12 1 1
MIRT017105 DISP1 dispatched homolog 1 (Drosophila) 1 1
MIRT017106 ELOVL6 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 1 1
MIRT017107 FAM151A family with sequence similarity 151, member A 1 1
MIRT017108 ZNF579 zinc finger protein 579 1 1
MIRT017109 DHH desert hedgehog homolog (Drosophila) 1 1
MIRT017110 FAM131C family with sequence similarity 131, member C 1 1
MIRT017111 RSPH4A radial spoke head 4 homolog A (Chlamydomonas) 1 1
MIRT017112 SLC6A12 solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 1 1
MIRT017113 XKR6 XK, Kell blood group complex subunit-related family, member 6 1 1
MIRT017114 FLG2 filaggrin family member 2 1 1
MIRT017115 MLXIP MLX interacting protein 1 1
MIRT017116 NEIL1 nei endonuclease VIII-like 1 (E. coli) 1 1
MIRT017117 ING4 inhibitor of growth family, member 4 1 1
MIRT017118 SMG7 Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT017119 FREM1 FRAS1 related extracellular matrix 1 1 1
MIRT017120 FOXA2 forkhead box A2 1 1
MIRT017121 ATG16L2 ATG16 autophagy related 16-like 2 (S. cerevisiae) 1 1
MIRT017122 LDLR low density lipoprotein receptor 1 1
MIRT017123 COPA coatomer protein complex, subunit alpha 1 1
MIRT017124 SESN3 sestrin 3 1 1
MIRT017125 SLC29A3 solute carrier family 29 (nucleoside transporters), member 3 1 1
MIRT017126 TMEM25 transmembrane protein 25 1 1
MIRT017127 C6orf223 chromosome 6 open reading frame 223 1 1
MIRT017128 GLTPD2 glycolipid transfer protein domain containing 2 1 1
MIRT017129 PLK3 polo-like kinase 3 (Drosophila) 1 1
MIRT017130 VMO1 vitelline membrane outer layer 1 homolog (chicken) 1 1
MIRT017131 ZBTB1 zinc finger and BTB domain containing 1 1 1
MIRT017132 IGLV1-36 immunoglobulin lambda variable 1-36 1 1
MIRT017133 C10orf118 chromosome 10 open reading frame 118 1 1
MIRT017134 DHRS3 dehydrogenase/reductase (SDR family) member 3 1 1
MIRT017135 ZBED2 zinc finger, BED-type containing 2 1 1
MIRT017136 PRAMEF10 PRAME family member 10 1 1
MIRT017137 ADGB chromosome 6 open reading frame 103 1 1
MIRT017138 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT017139 ANTXR2 anthrax toxin receptor 2 1 1
MIRT017140 FAM47C family with sequence similarity 47, member C 1 1
MIRT017141 OPN1SW opsin 1 (cone pigments), short-wave-sensitive 1 1
MIRT017142 NUTM2B family with sequence similarity 22, member B 1 1
MIRT017143 ZFP41 zinc finger protein 41 homolog (mouse) 1 1
MIRT017144 HOXC6 homeobox C6 1 1
MIRT017145 MMRN1 multimerin 1 1 1
MIRT017146 SAG S-antigen; retina and pineal gland (arrestin) 1 1
MIRT017147 RUFY2 RUN and FYVE domain containing 2 1 1
MIRT017148 WIF1 WNT inhibitory factor 1 1 1
MIRT017149 CBLN4 cerebellin 4 precursor 1 1
MIRT017150 FAM214A KIAA1370 1 1
MIRT017151 TAF8 TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa 1 1
MIRT017152 MPPED2 metallophosphoesterase domain containing 2 1 1
MIRT017153 RASSF8 Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 1 1
MIRT017154 WDR59 WD repeat domain 59 1 1
MIRT017155 AHNAK AHNAK nucleoprotein 1 1
MIRT017156 RNASE4 ribonuclease, RNase A family, 4 1 1
MIRT017157 GPR82 G protein-coupled receptor 82 1 1
MIRT017158 TFE3 transcription factor binding to IGHM enhancer 3 1 1
MIRT017159 SFRP1 secreted frizzled-related protein 1 1 1
MIRT017160 SLC34A2 solute carrier family 34 (sodium phosphate), member 2 1 1
MIRT017161 PPM1H protein phosphatase, Mg2+/Mn2+ dependent, 1H 1 1
MIRT017162 TRIM2 tripartite motif-containing 2 1 1
MIRT017163 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT017164 FAM63B family with sequence similarity 63, member B 1 1
MIRT017165 SH3BP1 SH3-domain binding protein 1 1 1
MIRT017166 MCMDC2 chromosome 8 open reading frame 45 1 1
MIRT017167 TRDN triadin 1 1
MIRT017168 C6orf25 chromosome 6 open reading frame 25 1 1
MIRT017169 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 1
MIRT017170 DLG2 discs, large homolog 2 (Drosophila) 1 1
MIRT017171 LEPREL2 leprecan-like 2 1 1
MIRT017172 JHDM1D jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae) 1 1
MIRT017173 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT017174 PLLP plasma membrane proteolipid (plasmolipin) 1 1
MIRT017175 KLRK1 killer cell lectin-like receptor subfamily K, member 1 1 1
MIRT017176 FAM102A family with sequence similarity 102, member A 1 1
MIRT017177 LIN7A lin-7 homolog A (C. elegans) 1 1
MIRT017178 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT017179 GSDMB gasdermin B 1 1
MIRT017180 MFSD6L major facilitator superfamily domain containing 6-like 1 1
MIRT017181 CDK20 cyclin-dependent kinase 20 1 1
MIRT017182 NLRC4 NLR family, CARD domain containing 4 1 1
MIRT017183 EGFLAM EGF-like, fibronectin type III and laminin G domains 1 1
MIRT017184 TRBV7-3 T cell receptor beta variable 7-3 1 1
MIRT017185 GP9 glycoprotein IX (platelet) 1 1
MIRT017186 ZNF660 zinc finger protein 660 1 1
MIRT017187 CA14 carbonic anhydrase XIV 1 1
MIRT017188 C7orf69 chromosome 7 open reading frame 69 1 1
MIRT017189 OR1C1 olfactory receptor, family 1, subfamily C, member 1 1 1
MIRT017190 PDE5A phosphodiesterase 5A, cGMP-specific 1 1
MIRT017191 ZER1 zer-1 homolog (C. elegans) 1 1
MIRT017192 PRAMEF2 PRAME family member 2 1 1
MIRT017193 CPNE6 copine VI (neuronal) 1 1
MIRT017194 KIAA1324L KIAA1324-like 1 1
MIRT017195 TMEM8A transmembrane protein 8A 1 1
MIRT017196 KCNJ9 potassium inwardly-rectifying channel, subfamily J, member 9 1 1
MIRT017197 CEACAM3 carcinoembryonic antigen-related cell adhesion molecule 3 1 1
MIRT017198 TVP23A family with sequence similarity 18, member A 1 1
MIRT017199 GAB2 GRB2-associated binding protein 2 1 1
MIRT017200 UBN1 ubinuclein 1 1 1
MIRT017201 FOXO3 forkhead box O3 1 1
MIRT017202 IRF2 interferon regulatory factor 2 1 1
MIRT017203 STOX1 storkhead box 1 1 1
MIRT017204 HDAC6 histone deacetylase 6 1 1
MIRT017205 DDR1 discoidin domain receptor tyrosine kinase 1 1 1
MIRT017206 ABLIM1 actin binding LIM protein 1 1 1
MIRT017207 ACOT6 acyl-CoA thioesterase 6 1 1
MIRT017208 C6orf201 chromosome 6 open reading frame 201 1 1
MIRT017209 ZNF251 zinc finger protein 251 1 1
MIRT017210 PRAMEF16 PRAME family member 16 1 1
MIRT017211 TULP4 tubby like protein 4 1 1
MIRT017212 FGF8 fibroblast growth factor 8 (androgen-induced) 1 1
MIRT017213 ACSL1 acyl-CoA synthetase long-chain family member 1 1 1
MIRT017214 RSPO4 R-spondin family, member 4 1 1
MIRT017215 TACR3 tachykinin receptor 3 1 1
MIRT017216 HSD17B7P2 hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2 1 1
MIRT017217 CEL carboxyl ester lipase (bile salt-stimulated lipase) 1 1
MIRT017218 BCL2A1 BCL2-related protein A1 1 1
MIRT017219 OR2J1 olfactory receptor, family 2, subfamily J, member 1 1 1
MIRT017220 ANXA11 annexin A11 1 1
MIRT017221 NDST3 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 1 1
MIRT017222 KLK3 kallikrein-related peptidase 3 1 1
MIRT017223 USP44 ubiquitin specific peptidase 44 1 1
MIRT017224 SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1 1
MIRT017225 PYGM phosphorylase, glycogen, muscle 1 1
MIRT017226 PTPLAD2 protein tyrosine phosphatase-like A domain containing 2 1 1
MIRT017227 CEACAM21 carcinoembryonic antigen-related cell adhesion molecule 21 1 1
MIRT017228 SERPINF1 serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 1 1
MIRT017229 COG3 component of oligomeric golgi complex 3 1 1
MIRT017230 TP53AIP1 tumor protein p53 regulated apoptosis inducing protein 1 1 1
MIRT017231 SLC27A6 solute carrier family 27 (fatty acid transporter), member 6 1 1
MIRT017232 SWT1 chromosome 1 open reading frame 26 1 1
MIRT017233 UHMK1 U2AF homology motif (UHM) kinase 1 1 1
MIRT017234 FOLR2 folate receptor 2 (fetal) 1 1
MIRT017235 TGIF2LY TGFB-induced factor homeobox 2-like, Y-linked 1 1
MIRT017236 CHST8 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 1 1
MIRT017237 CPT1B carnitine palmitoyltransferase 1B (muscle) 1 1
MIRT017238 IRAK2 interleukin-1 receptor-associated kinase 2 1 1
MIRT017239 ATP8B2 ATPase, class I, type 8B, member 2 1 1
MIRT017240 CD79A CD79a molecule, immunoglobulin-associated alpha 1 1
MIRT017241 IYD iodotyrosine deiodinase 1 1
MIRT017242 IL27 interleukin 27 1 1
MIRT017243 DPY19L2 dpy-19-like 2 (C. elegans) 1 1
MIRT017244 SYT5 synaptotagmin V 1 1
MIRT017245 LGALS9 lectin, galactoside-binding, soluble, 9 1 1
MIRT017246 EMX2 empty spiracles homeobox 2 1 1
MIRT017247 DOCK9 dedicator of cytokinesis 9 1 1
MIRT017248 APOL2 apolipoprotein L, 2 1 1
MIRT017249 KCNK4 potassium channel, subfamily K, member 4 1 1
MIRT017250 GOLGB1 golgin B1 1 1
MIRT017251 RARG retinoic acid receptor, gamma 1 1
MIRT017252 SKAP2 src kinase associated phosphoprotein 2 1 1
MIRT017253 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 1
MIRT017254 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT017255 ZNF334 zinc finger protein 334 1 1
MIRT017256 CRYBA2 crystallin, beta A2 1 1
MIRT017257 FAM120B family with sequence similarity 120B 1 1
MIRT017258 KCNK5 potassium channel, subfamily K, member 5 1 1
MIRT017259 SLC9A7 solute carrier family 9 (sodium/hydrogen exchanger), member 7 1 1
MIRT017260 DMPK dystrophia myotonica-protein kinase 1 1
MIRT017261 TRIM40 tripartite motif-containing 40 1 1
MIRT017262 DCHS2 dachsous 2 (Drosophila) 1 1
MIRT017263 ILDR1 immunoglobulin-like domain containing receptor 1 1 1
MIRT017264 CYB561 cytochrome b-561 1 1
MIRT017265 CDH5 cadherin 5, type 2 (vascular endothelium) 1 1
MIRT017266 KRTAP4-2 keratin associated protein 4-2 1 1
MIRT017267 CNTNAP3 contactin associated protein-like 3 1 1
MIRT017268 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT017269 FCRLA Fc receptor-like A 1 1
MIRT017270 CLMN calmin (calponin-like, transmembrane) 1 1
MIRT017271 CD5L CD5 molecule-like 1 1
MIRT017272 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 1 1
MIRT017273 PPFIBP1 PTPRF interacting protein, binding protein 1 (liprin beta 1) 1 1
MIRT017274 RIIAD1 chromosome 1 open reading frame 230 1 1
MIRT017275 ADCK1 aarF domain containing kinase 1 1 1
MIRT017276 SLC4A8 solute carrier family 4, sodium bicarbonate cotransporter, member 8 1 1
MIRT017277 CLIP2 CAP-GLY domain containing linker protein 2 1 1
MIRT017278 TNNC1 troponin C type 1 (slow) 1 1
MIRT017279 HCAR1 G protein-coupled receptor 81 1 1
MIRT017280 RGS16 regulator of G-protein signaling 16 1 1
MIRT017281 KCNA4 potassium voltage-gated channel, shaker-related subfamily, member 4 1 1
MIRT017282 RNF186 ring finger protein 186 1 1
MIRT017283 SPATA20 spermatogenesis associated 20 1 1
MIRT017284 CYTH1 cytohesin 1 1 1
MIRT017285 CCDC103 coiled-coil domain containing 103 1 1
MIRT017286 PLA2G7 phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) 1 1
MIRT017287 JUND jun D proto-oncogene 1 1
MIRT017288 FAM214B KIAA1539 1 1
MIRT017289 LBP lipopolysaccharide binding protein 1 1
MIRT017290 DBH dopamine beta-hydroxylase (dopamine beta-monooxygenase) 1 1
MIRT017291 PLCE1 phospholipase C, epsilon 1 1 1
MIRT017292 RAB26 RAB26, member RAS oncogene family 1 1
MIRT017293 PYGB phosphorylase, glycogen; brain 1 1
MIRT017294 C10orf99 chromosome 10 open reading frame 99 1 1
MIRT017295 TMPRSS11D transmembrane protease, serine 11D 1 1
MIRT017296 CD22 CD22 molecule 1 1
MIRT017297 CCDC88C coiled-coil domain containing 88C 1 1
MIRT017298 ABCA5 ATP-binding cassette, sub-family A (ABC1), member 5 1 1
MIRT017299 TNIK TRAF2 and NCK interacting kinase 1 1
MIRT017300 TLL1 tolloid-like 1 1 1
MIRT017301 SLC13A4 solute carrier family 13 (sodium/sulfate symporters), member 4 1 1
MIRT017302 JAKMIP3 Janus kinase and microtubule interacting protein 3 1 1
MIRT017303 AKAP13 A kinase (PRKA) anchor protein 13 1 1
MIRT017304 PGM5 phosphoglucomutase 5 1 1
MIRT017305 NANOG Nanog homeobox 1 1
MIRT017306 PIK3CA phosphoinositide-3-kinase, catalytic, alpha polypeptide 1 1
MIRT017307 S100Z S100 calcium binding protein Z 1 1
MIRT017308 IGSF10 immunoglobulin superfamily, member 10 1 1
MIRT017309 SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1 1
MIRT017310 RALGDS ral guanine nucleotide dissociation stimulator 1 1
MIRT017311 ETV5 ets variant 5 1 1
MIRT017312 SH3TC2 SH3 domain and tetratricopeptide repeats 2 1 1
MIRT017313 PLXNA4 plexin A4 1 1
MIRT017314 NBPF23 neuroblastoma breakpoint family, member 23 1 1
MIRT017315 MYCT1 myc target 1 1 1
MIRT017316 GRIN2D glutamate receptor, ionotropic, N-methyl D-aspartate 2D 1 1
MIRT017317 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT017318 PJA2 praja ring finger 2 1 1
MIRT017319 LIN28A lin-28 homolog A (C. elegans) 1 1
MIRT017320 PMEL silver homolog (mouse) 1 1
MIRT017321 PLXNC1 plexin C1 1 1
MIRT017322 SNORD116-21 small nucleolar RNA, C/D box 116-21 1 1
MIRT017323 VPS39 vacuolar protein sorting 39 homolog (S. cerevisiae) 1 1
MIRT017324 ABAT 4-aminobutyrate aminotransferase 1 1
MIRT017325 NTN4 netrin 4 1 1
MIRT017326 SCNN1D sodium channel, nonvoltage-gated 1, delta 1 1
MIRT017327 UNC13D unc-13 homolog D (C. elegans) 1 1
MIRT017328 PPP1R3B protein phosphatase 1, regulatory (inhibitor) subunit 3B 1 1
MIRT017329 SLC6A9 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 1 1
MIRT017330 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT017331 GJB6 gap junction protein, beta 6, 30kDa 1 1
MIRT017332 EFCAB5 EF-hand calcium binding domain 5 1 1
MIRT017333 C14orf178 chromosome 14 open reading frame 178 1 1
MIRT017334 DTX1 deltex homolog 1 (Drosophila) 1 1
MIRT017335 NR1D1 nuclear receptor subfamily 1, group D, member 1 1 1
MIRT017336 NEUROG1 neurogenin 1 1 1
MIRT017337 NCF4 neutrophil cytosolic factor 4, 40kDa 1 1
MIRT017338 KRT71 keratin 71 1 1
MIRT017339 C14orf28 chromosome 14 open reading frame 28 1 1
MIRT017340 HMP19 HMP19 protein 1 1
MIRT017341 LMOD3 leiomodin 3 (fetal) 1 1
MIRT017342 COL10A1 collagen, type X, alpha 1 1 1
MIRT017343 CDCP1 CUB domain containing protein 1 1 1
MIRT017344 GUCY1A2 guanylate cyclase 1, soluble, alpha 2 1 1
MIRT017345 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha 1 1
MIRT017346 C6orf132 chromosome 6 open reading frame 132 1 1
MIRT017347 UBE2O ubiquitin-conjugating enzyme E2O 1 1
MIRT017348 ARRDC3 arrestin domain containing 3 1 1
MIRT017349 DMBX1 diencephalon/mesencephalon homeobox 1 1 1
MIRT017350 PPP1R3C protein phosphatase 1, regulatory (inhibitor) subunit 3C 1 1
MIRT017351 PRICKLE2 prickle homolog 2 (Drosophila) 1 1
MIRT017352 OR2L2 olfactory receptor, family 2, subfamily L, member 2 1 1
MIRT017353 ADIG adipogenin 1 1
MIRT017354 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT017355 RNF157 ring finger protein 157 1 1
MIRT017356 AMHR2 anti-Mullerian hormone receptor, type II 1 1
MIRT017357 CDK19 cyclin-dependent kinase 19 1 1
MIRT017358 CXCR2 chemokine (C-X-C motif) receptor 2 1 1
MIRT017359 SLC22A15 solute carrier family 22, member 15 1 1
MIRT017360 FADS2 fatty acid desaturase 2 1 1
MIRT017361 ZFP28 zinc finger protein 28 homolog (mouse) 1 1
MIRT017362 PRPF40B PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae) 1 1
MIRT017363 TGFB2 transforming growth factor, beta 2 1 1
MIRT017364 CHAT choline O-acetyltransferase 1 1
MIRT017365 BARX2 BARX homeobox 2 1 1
MIRT017366 CCPG1 cell cycle progression 1 1 1
MIRT017367 COLQ collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase 1 1
MIRT017368 PCYT2 phosphate cytidylyltransferase 2, ethanolamine 1 1
MIRT017369 GABRQ gamma-aminobutyric acid (GABA) receptor, theta 1 1
MIRT017370 CTRB2 chymotrypsinogen B2 1 1
MIRT017371 PLIN4 perilipin 4 1 1
MIRT017372 CECR5-AS1 cat eye syndrome chromosome region, candidate 4 (non-protein coding) 1 1
MIRT017373 APOH apolipoprotein H (beta-2-glycoprotein I) 1 1
MIRT017374 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT017375 FCGRT Fc fragment of IgG, receptor, transporter, alpha 1 1
MIRT017376 PTPRA protein tyrosine phosphatase, receptor type, A 1 1
MIRT017377 TMEFF2 transmembrane protein with EGF-like and two follistatin-like domains 2 1 1
MIRT017378 SELENBP1 selenium binding protein 1 1 1
MIRT017379 SHC4 SHC (Src homology 2 domain containing) family, member 4 1 1
MIRT017380 MYT1L myelin transcription factor 1-like 1 1
MIRT017381 KLHL34 kelch-like 34 (Drosophila) 1 1
MIRT017382 ARL5B ADP-ribosylation factor-like 5B 1 1
MIRT017383 CNTNAP3B contactin associated protein-like 3B 1 1
MIRT017384 PTGES prostaglandin E synthase 1 1
MIRT017385 C2orf16 chromosome 2 open reading frame 16 1 1
MIRT017386 SCG3 secretogranin III 1 1
MIRT017387 NOTCH3 Notch homolog 3 (Drosophila) 1 1
MIRT017388 LY6G6E lymphocyte antigen 6 complex, locus G6E 1 1
MIRT017389 CRB3 crumbs homolog 3 (Drosophila) 1 1
MIRT017390 SRL sarcalumenin 1 1
MIRT017391 CDK17 cyclin-dependent kinase 17 1 1
MIRT017392 FOXI1 forkhead box I1 1 1
MIRT017393 PLSCR4 phospholipid scramblase 4 1 1
MIRT017394 SELPLG selectin P ligand 1 1
MIRT017395 CLDN4 claudin 4 1 1
MIRT017396 LINC00470 chromosome 18 open reading frame 2 1 1
MIRT017397 SPATA6 spermatogenesis associated 6 1 1
MIRT017398 R3HDML R3H domain containing-like 1 1
MIRT017399 ABCA8 ATP-binding cassette, sub-family A (ABC1), member 8 1 1
MIRT017400 SNX29 sorting nexin 29 1 1
MIRT017401 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 1 1
MIRT017402 FAM114A1 family with sequence similarity 114, member A1 1 1
MIRT017403 ABTB1 ankyrin repeat and BTB (POZ) domain containing 1 1 1
MIRT017404 MYCL1 v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) 1 1
MIRT017405 SULT2A1 sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 1 1
MIRT017406 AK7 adenylate kinase 7 1 1
MIRT017407 MIR30C2 microRNA 30c-2 1 1
MIRT017408 RHBDF2 rhomboid 5 homolog 2 (Drosophila) 1 1
MIRT017409 TRPM4 transient receptor potential cation channel, subfamily M, member 4 1 1
MIRT017410 TKTL1 transketolase-like 1 1 1
MIRT017411 IGFBP2 insulin-like growth factor binding protein 2, 36kDa 1 1
MIRT017412 PLEKHB1 pleckstrin homology domain containing, family B (evectins) member 1 1 1
MIRT017413 THAP3 THAP domain containing, apoptosis associated protein 3 1 1
MIRT017414 COL11A1 collagen, type XI, alpha 1 1 1
MIRT017415 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT017416 EHBP1L1 EH domain binding protein 1-like 1 1 1
MIRT017417 POMC proopiomelanocortin 1 1
MIRT017418 POLK polymerase (DNA directed) kappa 1 1
MIRT017419 MEPE matrix extracellular phosphoglycoprotein 1 1
MIRT017420 BPY2C basic charge, Y-linked, 2C 1 1
MIRT017421 THBS3 thrombospondin 3 1 1
MIRT017422 LOXL1 lysyl oxidase-like 1 1 1
MIRT017423 RNU4-8P RNA, U4 small nuclear 8 (pseudogene) 1 1
MIRT017424 DNAL4 dynein, axonemal, light chain 4 1 1
MIRT017425 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5 1 1
MIRT017426 CCL26 chemokine (C-C motif) ligand 26 1 1
MIRT017427 REPS2 RALBP1 associated Eps domain containing 2 1 1
MIRT017428 SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT017429 MBNL2 muscleblind-like 2 (Drosophila) 1 1
MIRT017430 CMTM1 CKLF-like MARVEL transmembrane domain containing 1 1 1
MIRT017431 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 1
MIRT017432 FLYWCH1 FLYWCH-type zinc finger 1 1 1
MIRT017433 TIGD3 tigger transposable element derived 3 1 1
MIRT017434 XKR4 XK, Kell blood group complex subunit-related family, member 4 1 1
MIRT017435 TMEM217 transmembrane protein 217 1 1
MIRT017436 KIAA1407 KIAA1407 1 1
MIRT017437 FAM149A family with sequence similarity 149, member A 1 1
MIRT017438 UBD ubiquitin D 1 1
MIRT017439 COPG1 coatomer protein complex, subunit gamma 1 1
MIRT017440 BPIFA1 palate, lung and nasal epithelium associated 1 1
MIRT017441 WFDC11 WAP four-disulfide core domain 11 1 1
MIRT017442 KRTAP3-3 keratin associated protein 3-3 1 1
MIRT017443 NRIP2 nuclear receptor interacting protein 2 1 1
MIRT017444 C17orf66 chromosome 17 open reading frame 66 1 1
MIRT017445 SNCG synuclein, gamma (breast cancer-specific protein 1) 1 1
MIRT017446 PRG3 proteoglycan 3 1 1
MIRT017447 CNIH3 cornichon homolog 3 (Drosophila) 1 1
MIRT017448 MUC3A mucin 3A, cell surface associated 1 1
MIRT017449 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT017450 DEFB123 defensin, beta 123 1 1
MIRT017451 CDH3 cadherin 3, type 1, P-cadherin (placental) 1 1
MIRT017452 GPIHBP1 glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 1 1
MIRT017453 HTRA4 HtrA serine peptidase 4 1 1
MIRT017454 CRHR2 corticotropin releasing hormone receptor 2 1 1
MIRT017455 GPRIN2 G protein regulated inducer of neurite outgrowth 2 1 1
MIRT017456 KRT4 keratin 4 1 1
MIRT017457 FUT9 fucosyltransferase 9 (alpha (1,3) fucosyltransferase) 1 1
MIRT017458 SERPINB1 serpin peptidase inhibitor, clade B (ovalbumin), member 1 1 1
MIRT017459 FZD1 frizzled homolog 1 (Drosophila) 1 1
MIRT017460 TCEA3 transcription elongation factor A (SII), 3 1 1
MIRT017461 AGBL2 ATP/GTP binding protein-like 2 1 1
MIRT017462 FLT3 fms-related tyrosine kinase 3 1 1
MIRT017463 SCGB1D1 secretoglobin, family 1D, member 1 1 1
MIRT017464 LY6H lymphocyte antigen 6 complex, locus H 1 1
MIRT017465 CHRDL2 chordin-like 2 1 1
MIRT017466 CYP4F22 cytochrome P450, family 4, subfamily F, polypeptide 22 1 1
MIRT017467 KLF8 Kruppel-like factor 8 1 1
MIRT017468 CLIC2 chloride intracellular channel 2 1 1
MIRT017469 ZSCAN23 zinc finger and SCAN domain containing 23 1 1
MIRT017470 SLCO4A1 solute carrier organic anion transporter family, member 4A1 1 1
MIRT017471 TTC23L tetratricopeptide repeat domain 23-like 1 1
MIRT017472 ABCC3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 1 1
MIRT017473 SLC16A6 solute carrier family 16, member 6 (monocarboxylic acid transporter 7) 1 1
MIRT017474 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 1 1
MIRT017475 OR10D1P olfactory receptor, family 10, subfamily D, member 1 pseudogene 1 1
MIRT017476 HFM1 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) 1 1
MIRT017477 DRD5 dopamine receptor D5 1 1
MIRT017478 OVGP1 oviductal glycoprotein 1, 120kDa 1 1
MIRT017479 PRR15L proline rich 15-like 1 1
MIRT017480 THEMIS2 chromosome 1 open reading frame 38 1 1
MIRT017481 LURAP1L chromosome 9 open reading frame 150 1 1
MIRT017482 DYDC1 DPY30 domain containing 1 1 1
MIRT017483 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT017484 SYNPR synaptoporin 1 1
MIRT017485 ARHGAP21 Rho GTPase activating protein 21 1 1
MIRT017486 SPPL2C intramembrane protease 5 1 1
MIRT017487 C1QA complement component 1, q subcomponent, A chain 1 1
MIRT017488 CXCR1 chemokine (C-X-C motif) receptor 1 1 1
MIRT017489 GAGE12D G antigen 12D 1 1
MIRT017490 SEMA4B sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B 1 1
MIRT017491 DNAAF3 chromosome 19 open reading frame 51 1 1
MIRT017492 BCL6 B-cell CLL/lymphoma 6 1 1
MIRT017493 APBB1 amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) 1 1
MIRT017494 ANKH ankylosis, progressive homolog (mouse) 1 1
MIRT017495 ATP6V0A1 ATPase, H+ transporting, lysosomal V0 subunit a1 1 1
MIRT017496 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 1
MIRT017497 C7orf33 chromosome 7 open reading frame 33 1 1
MIRT017498 PLXND1 plexin D1 1 1
MIRT017499 C19orf18 chromosome 19 open reading frame 18 1 1
MIRT017500 HRH4 histamine receptor H4 1 1
MIRT017501 ZNF451 zinc finger protein 451 1 1
MIRT017502 CCL25 chemokine (C-C motif) ligand 25 1 1
MIRT017503 DEFA4 defensin, alpha 4, corticostatin 1 1
MIRT017504 CFHR2 complement factor H-related 2 1 1
MIRT017505 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT017506 GDF5 growth differentiation factor 5 1 1
MIRT017507 ZFP3 zinc finger protein 3 homolog (mouse) 1 1
MIRT017508 SLC12A3 solute carrier family 12 (sodium/chloride transporters), member 3 1 1
MIRT017509 TFAP2B transcription factor AP-2 beta (activating enhancer binding protein 2 beta) 1 1
MIRT017510 CLDN1 claudin 1 1 1
MIRT017511 ENTPD3 ectonucleoside triphosphate diphosphohydrolase 3 1 1
MIRT017512 NPR3 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 1 1
MIRT017513 SP1 Sp1 transcription factor 2 1
MIRT017514 KRT38 keratin 38 1 1
MIRT017515 EHF ets homologous factor 1 1
MIRT017516 PSPN persephin 1 1
MIRT017517 NTSR1 neurotensin receptor 1 (high affinity) 1 1
MIRT017518 DNALI1 dynein, axonemal, light intermediate chain 1 1 1
MIRT017519 PLTP phospholipid transfer protein 1 1
MIRT017520 CRB2 crumbs homolog 2 (Drosophila) 1 1
MIRT017521 NDUFA4L2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 1 1
MIRT017522 PDE2A phosphodiesterase 2A, cGMP-stimulated 1 1
MIRT017523 PNLDC1 poly(A)-specific ribonuclease (PARN)-like domain containing 1 1 1
MIRT017524 LYST lysosomal trafficking regulator 1 1
MIRT017525 CAPS2 calcyphosine 2 1 1
MIRT017526 SMYD1 SET and MYND domain containing 1 1 1
MIRT017527 XRN1 5'-3' exoribonuclease 1 1 1
MIRT017528 PDE6H phosphodiesterase 6H, cGMP-specific, cone, gamma 1 1
MIRT017529 ADAM32 ADAM metallopeptidase domain 32 1 1
MIRT017530 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT017531 PRRG2 proline rich Gla (G-carboxyglutamic acid) 2 1 1
MIRT017532 RAB40A RAB40A, member RAS oncogene family 1 1
MIRT017533 DEPDC5 DEP domain containing 5 1 1
MIRT017534 SLC35E2 solute carrier family 35, member E2 1 1
MIRT017535 LZTS2 leucine zipper, putative tumor suppressor 2 1 1
MIRT017536 RGCC chromosome 13 open reading frame 15 1 1
MIRT017537 NRP2 neuropilin 2 1 1
MIRT017538 CD99L2 CD99 molecule-like 2 1 1
MIRT017539 PC pyruvate carboxylase 1 1
MIRT017540 SPRY4 sprouty homolog 4 (Drosophila) 1 1
MIRT017541 C20orf85 chromosome 20 open reading frame 85 1 1
MIRT017542 HBE1 hemoglobin, epsilon 1 1 1
MIRT017543 PODN podocan 1 1
MIRT017544 VSTM2L V-set and transmembrane domain containing 2 like 1 1
MIRT017545 OR8B3 olfactory receptor, family 8, subfamily B, member 3 1 1
MIRT017546 KLHL1 kelch-like 1 (Drosophila) 1 1
MIRT017547 ZNF157 zinc finger protein 157 1 1
MIRT017548 GPBAR1 G protein-coupled bile acid receptor 1 1 1
MIRT017549 TK2 thymidine kinase 2, mitochondrial 1 1
MIRT017550 ERCC6L2 chromosome 9 open reading frame 102 1 1
MIRT017551 RBMY1F RNA binding motif protein, Y-linked, family 1, member F 1 1
MIRT017552 MUC4 mucin 4, cell surface associated 1 1
MIRT017553 CORO2B coronin, actin binding protein, 2B 1 1
MIRT017554 RASA3 RAS p21 protein activator 3 1 1
MIRT017555 FAM49A family with sequence similarity 49, member A 1 1
MIRT017556 GNG8 guanine nucleotide binding protein (G protein), gamma 8 1 1
MIRT017557 RERG RAS-like, estrogen-regulated, growth inhibitor 1 1
MIRT017558 DEFB132 defensin, beta 132 1 1
MIRT017559 DNAJB14 DnaJ (Hsp40) homolog, subfamily B, member 14 1 1
MIRT017560 CHRM2 cholinergic receptor, muscarinic 2 1 1
MIRT017561 FAM179A family with sequence similarity 179, member A 1 1
MIRT017562 AMDHD1 amidohydrolase domain containing 1 1 1
MIRT017563 TAPT1 transmembrane anterior posterior transformation 1 1 1
MIRT017564 BBS9 Bardet-Biedl syndrome 9 1 1
MIRT017565 RSPO1 R-spondin homolog (Xenopus laevis) 1 1
MIRT017566 MAGED4B melanoma antigen family D, 4B 1 1
MIRT017567 TBXAS1 thromboxane A synthase 1 (platelet) 1 1
MIRT017568 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT017569 NKAIN2 Na+/K+ transporting ATPase interacting 2 1 1
MIRT017570 MANSC1 MANSC domain containing 1 1 1
MIRT017571 LTBP4 latent transforming growth factor beta binding protein 4 1 1
MIRT017572 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 1
MIRT017573 ANO3 anoctamin 3 1 1
MIRT017574 CACNA2D4 calcium channel, voltage-dependent, alpha 2/delta subunit 4 1 1
MIRT017575 HRC histidine rich calcium binding protein 1 1
MIRT017576 LECT1 leukocyte cell derived chemotaxin 1 1 1
MIRT017577 CST4 cystatin S 1 1
MIRT017578 KRTAP9-8 keratin associated protein 9-8 1 1
MIRT017579 TEX13B testis expressed 13B 1 1
MIRT017580 RHOQ ras homolog gene family, member Q 1 1
MIRT017581 SESN2 sestrin 2 1 1
MIRT017582 NAPSB napsin B aspartic peptidase pseudogene 1 1
MIRT017583 BMP2 bone morphogenetic protein 2 1 1
MIRT017584 HHATL hedgehog acyltransferase-like 1 1
MIRT017585 PTGDS prostaglandin D2 synthase 21kDa (brain) 1 1
MIRT017586 CITED2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 1 1
MIRT017587 NTN3 netrin 3 1 1
MIRT017588 PIK3C2A phosphoinositide-3-kinase, class 2, alpha polypeptide 1 1
MIRT017589 CCL24 chemokine (C-C motif) ligand 24 1 1
MIRT017590 FAM196A family with sequence similarity 196, member A 1 1
MIRT017591 CYSLTR1 cysteinyl leukotriene receptor 1 1 1
MIRT017592 FAM124B family with sequence similarity 124B 1 1
MIRT017593 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT017594 VN1R1 vomeronasal 1 receptor 1 1 1
MIRT017595 FAM26E family with sequence similarity 26, member E 1 1
MIRT017596 MXD1 MAX dimerization protein 1 1 1
MIRT017597 CRYGN crystallin, gamma N 1 1
MIRT017598 CACNG4 calcium channel, voltage-dependent, gamma subunit 4 1 1
MIRT017599 RPS6KA6 ribosomal protein S6 kinase, 90kDa, polypeptide 6 1 1
MIRT017600 TTLL1 tubulin tyrosine ligase-like family, member 1 1 1
MIRT017601 UGT2B4 UDP glucuronosyltransferase 2 family, polypeptide B4 1 1
MIRT017602 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT017603 FAAH2 fatty acid amide hydrolase 2 1 1
MIRT017604 ITPR1 inositol 1,4,5-triphosphate receptor, type 1 1 1
MIRT017605 ZCCHC6 zinc finger, CCHC domain containing 6 1 1
MIRT017606 LOXL4 lysyl oxidase-like 4 1 1
MIRT017607 RBM47 RNA binding motif protein 47 1 1
MIRT017608 HOOK1 hook homolog 1 (Drosophila) 1 1
MIRT017609 SPACA3 sperm acrosome associated 3 1 1
MIRT017610 DKK4 dickkopf homolog 4 (Xenopus laevis) 1 1
MIRT017611 REN renin 1 1
MIRT017612 MCPH1 microcephalin 1 1 1
MIRT017613 TERT telomerase reverse transcriptase 1 1
MIRT017614 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT017615 SLC17A7 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 1 1
MIRT017616 TBKBP1 TBK1 binding protein 1 1 1
MIRT017617 OTOR otoraplin 1 1
MIRT017618 OR3A2 olfactory receptor, family 3, subfamily A, member 2 1 1
MIRT017619 TRIM73 tripartite motif-containing 73 1 1
MIRT017620 MSS51 zinc finger, MYND-type containing 17 1 1
MIRT017621 PON3 paraoxonase 3 1 1
MIRT017622 FOXD3 forkhead box D3 1 1
MIRT017623 GEM GTP binding protein overexpressed in skeletal muscle 1 1
MIRT017624 C4orf17 chromosome 4 open reading frame 17 1 1
MIRT017625 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT017626 SATB1 SATB homeobox 1 1 1
MIRT017627 SLC38A4 solute carrier family 38, member 4 1 1
MIRT017628 LDLRAD4 chromosome 18 open reading frame 1 1 1
MIRT017629 FKBP8 FK506 binding protein 8, 38kDa 1 1
MIRT017630 ETV1 ets variant 1 1 1
MIRT017631 MARCKSL1 MARCKS-like 1 1 1
MIRT017632 NLRP13 NLR family, pyrin domain containing 13 1 1
MIRT017633 KCTD17 potassium channel tetramerisation domain containing 17 1 1
MIRT017634 KIAA1644 KIAA1644 1 1
MIRT017635 SLC22A2 solute carrier family 22 (organic cation transporter), member 2 1 1
MIRT017636 JAK3 Janus kinase 3 1 1
MIRT017637 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT017638 USO1 USO1 vesicle docking protein homolog (yeast) 1 1
MIRT017639 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT017640 UBR2 ubiquitin protein ligase E3 component n-recognin 2 1 1
MIRT017641 ATOH1 atonal homolog 1 (Drosophila) 1 1
MIRT017642 RORA RAR-related orphan receptor A 1 1
MIRT017643 MDGA2 MAM domain containing glycosylphosphatidylinositol anchor 2 1 1
MIRT017644 ZNF322P1 zinc finger protein 322B 1 1
MIRT017645 IDH1 isocitrate dehydrogenase 1 (NADP+), soluble 1 1
MIRT017646 RCVRN recoverin 1 1
MIRT017647 DIO1 deiodinase, iodothyronine, type I 1 1
MIRT017648 CDK18 cyclin-dependent kinase 18 1 1
MIRT017649 NXF3 nuclear RNA export factor 3 1 1
MIRT017650 COLGALT2 glycosyltransferase 25 domain containing 2 1 1
MIRT017651 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT017652 KIAA1328 KIAA1328 1 1
MIRT017653 POLN polymerase (DNA directed) nu 1 1
MIRT017654 RGS18 regulator of G-protein signaling 18 1 1
MIRT017655 ITGA10 integrin, alpha 10 1 1
MIRT017656 GLCCI1 glucocorticoid induced transcript 1 1 1
MIRT017657 EIF4ENIF1 eukaryotic translation initiation factor 4E nuclear import factor 1 1 1
MIRT017658 CELF4 CUGBP, Elav-like family member 4 1 1
MIRT017659 NRP1 neuropilin 1 1 1
MIRT017660 IPMK inositol polyphosphate multikinase 1 1
MIRT017661 VPREB3 pre-B lymphocyte 3 1 1
MIRT017662 CUL7 cullin 7 1 1
MIRT017663 RFX3 regulatory factor X, 3 (influences HLA class II expression) 1 1
MIRT017664 NXNL2 nucleoredoxin-like 2 1 1
MIRT017665 AMELY amelogenin, Y-linked 1 1
MIRT017666 PCDHB15 protocadherin beta 15 1 1
MIRT017667 P2RX1 purinergic receptor P2X, ligand-gated ion channel, 1 1 1
MIRT017668 MTA2 metastasis associated 1 family, member 2 1 1
MIRT017669 BHLHE22 basic helix-loop-helix family, member e22 1 1
MIRT017670 ZNF280D zinc finger protein 280D 1 1
MIRT017671 C15orf32 chromosome 15 open reading frame 32 1 1
MIRT017672 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT017673 LCK lymphocyte-specific protein tyrosine kinase 1 1
MIRT017674 EPHA1 EPH receptor A1 1 1
MIRT017675 OR8B2 olfactory receptor, family 8, subfamily B, member 2 1 1
MIRT017676 MATK megakaryocyte-associated tyrosine kinase 1 1
MIRT017677 TEX38 chromosome 1 open reading frame 223 1 1
MIRT017678 MYO3B myosin IIIB 1 1
MIRT017679 C10orf71 chromosome 10 open reading frame 71 1 1
MIRT017680 PIM1 pim-1 oncogene 1 1
MIRT017681 PCDHGA10 protocadherin gamma subfamily A, 10 1 1
MIRT017682 CABP5 calcium binding protein 5 1 1
MIRT017683 LRRC19 leucine rich repeat containing 19 1 1
MIRT017684 CCDC146 coiled-coil domain containing 146 1 1
MIRT017685 ANKRD44 ankyrin repeat domain 44 1 1
MIRT017686 CLCN6 chloride channel 6 1 1
MIRT017687 KCNT2 potassium channel, subfamily T, member 2 1 1
MIRT017688 CCL14 chemokine (C-C motif) ligand 14 1 1
MIRT017689 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 1
MIRT017690 C22orf43 chromosome 22 open reading frame 43 1 1
MIRT017691 IL5 interleukin 5 (colony-stimulating factor, eosinophil) 1 1
MIRT017692 NPEPL1 aminopeptidase-like 1 1 1
MIRT017693 TTC3 tetratricopeptide repeat domain 3 1 1
MIRT017694 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 1 1
MIRT017695 ZNF558 zinc finger protein 558 1 1
MIRT017696 SYT1 synaptotagmin I 1 1
MIRT017697 FNDC1 fibronectin type III domain containing 1 1 1
MIRT017698 ESRRB estrogen-related receptor beta 1 1
MIRT017699 GRHL3 grainyhead-like 3 (Drosophila) 1 1
MIRT017700 VANGL2 vang-like 2 (van gogh, Drosophila) 1 1
MIRT017701 SRRM3 serine/arginine repetitive matrix 3 1 1
MIRT017702 C6orf58 chromosome 6 open reading frame 58 1 1
MIRT017703 LRAT lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) 1 1
MIRT017704 FFAR1 free fatty acid receptor 1 1 1
MIRT017705 LAIR2 leukocyte-associated immunoglobulin-like receptor 2 1 1
MIRT017706 GUCA2B guanylate cyclase activator 2B (uroguanylin) 1 1
MIRT017707 CDC42EP4 CDC42 effector protein (Rho GTPase binding) 4 1 1
MIRT017708 PRKCG protein kinase C, gamma 1 1
MIRT017709 SLC46A2 solute carrier family 46, member 2 1 1
MIRT017710 POPDC2 popeye domain containing 2 1 1
MIRT017711 RSPH9 radial spoke head 9 homolog (Chlamydomonas) 1 1
MIRT017712 ZCCHC13 zinc finger, CCHC domain containing 13 1 1
MIRT017713 BPY2 basic charge, Y-linked, 2 1 1
MIRT017714 HMOX1 heme oxygenase (decycling) 1 1 1
MIRT017715 MIR769 microRNA 769 1 1
MIRT017716 SEPT4 septin 4 1 1
MIRT017717 SRPK3 SFRS protein kinase 3 1 1
MIRT017718 C8A complement component 8, alpha polypeptide 1 1
MIRT017719 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 1 1
MIRT017720 LRP1 low density lipoprotein receptor-related protein 1 1 1
MIRT017721 FIBCD1 fibrinogen C domain containing 1 1 1
MIRT017722 FOXA3 forkhead box A3 1 1
MIRT017723 ZNF598 zinc finger protein 598 1 1
MIRT017724 MUC5B mucin 5B, oligomeric mucus/gel-forming 1 1
MIRT017725 HIC1 hypermethylated in cancer 1 1 1
MIRT017726 C2 complement component 2 1 1
MIRT017727 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT017728 GLI1 GLI family zinc finger 1 1 1
MIRT017729 TMEM190 transmembrane protein 190 1 1
MIRT017730 GOLGA6C golgin A6 family, member C 1 1
MIRT017731 CLEC3B C-type lectin domain family 3, member B 1 1
MIRT017732 CD27 CD27 molecule 1 1
MIRT017733 TMEM87B transmembrane protein 87B 1 1
MIRT017734 BATF2 basic leucine zipper transcription factor, ATF-like 2 1 1
MIRT017735 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 1 1
MIRT017736 KCNK7 potassium channel, subfamily K, member 7 1 1
MIRT017737 VASH1 vasohibin 1 1 1
MIRT017738 LYL1 lymphoblastic leukemia derived sequence 1 1 1
MIRT017739 NLRP10 NLR family, pyrin domain containing 10 1 1
MIRT017740 ACSF2 acyl-CoA synthetase family member 2 1 1
MIRT017741 TEKT1 tektin 1 1 1
MIRT017742 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT017743 TBC1D28 TBC1 domain family, member 28 1 1
MIRT017744 BTN2A1 butyrophilin, subfamily 2, member A1 1 1
MIRT017745 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT017746 ZNF175 zinc finger protein 175 1 1
MIRT017747 DUOXA1 dual oxidase maturation factor 1 1 1
MIRT017748 GATS GATS, stromal antigen 3 opposite strand 1 1
MIRT017749 ARSI arylsulfatase family, member I 1 1
MIRT017750 IL33 interleukin 33 1 1
MIRT017751 BVES-AS1 chromosome 6 open reading frame 112 1 1
MIRT017752 TRIM74 tripartite motif-containing 74 1 1
MIRT017753 PLA2G2E phospholipase A2, group IIE 1 1
MIRT017754 KLRF1 killer cell lectin-like receptor subfamily F, member 1 1 1
MIRT017755 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT017756 MMD monocyte to macrophage differentiation-associated 1 1
MIRT017757 GOLGA6A golgin A6 family, member A 1 1
MIRT017758 CNIH2 cornichon homolog 2 (Drosophila) 1 1
MIRT017759 C14orf37 chromosome 14 open reading frame 37 1 1
MIRT017760 MUC1 mucin 1, cell surface associated 1 1
MIRT017761 CDC42BPA CDC42 binding protein kinase alpha (DMPK-like) 1 1
MIRT017762 BTBD9 BTB (POZ) domain containing 9 1 1
MIRT017763 GABARAPL1 GABA(A) receptor-associated protein like 1 1 1
MIRT017764 FAM216B chromosome 13 open reading frame 30 1 1
MIRT017765 LPIN2 lipin 2 1 1
MIRT017766 SLC38A2 solute carrier family 38, member 2 1 1
MIRT017767 SLC45A1 solute carrier family 45, member 1 1 1
MIRT017768 TRIM3 tripartite motif-containing 3 1 1
MIRT017769 TSLP thymic stromal lymphopoietin 1 1
MIRT017770 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT017771 MAGED2 melanoma antigen family D, 2 1 1
MIRT017772 KIAA0226L chromosome 13 open reading frame 18 1 1
MIRT017773 NOS3 nitric oxide synthase 3 (endothelial cell) 1 1
MIRT017774 SPATA18 spermatogenesis associated 18 homolog (rat) 1 1
MIRT017775 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT017776 LGR6 leucine-rich repeat-containing G protein-coupled receptor 6 1 1
MIRT017777 NPY4R pancreatic polypeptide receptor 1 1 1
MIRT017778 MS4A6E membrane-spanning 4-domains, subfamily A, member 6E 1 1
MIRT017779 TMEM163 transmembrane protein 163 1 1
MIRT017780 MARCH8 membrane-associated ring finger (C3HC4) 8 1 1
MIRT017781 B3GNT4 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4 1 1
MIRT017782 MISP chromosome 19 open reading frame 21 1 1
MIRT017783 MLYCD malonyl-CoA decarboxylase 1 1
MIRT017784 BTBD2 BTB (POZ) domain containing 2 1 1
MIRT017785 NR3C2 nuclear receptor subfamily 3, group C, member 2 1 1
MIRT017786 LRRC70 leucine rich repeat containing 70 1 1
MIRT017787 ZDHHC15 zinc finger, DHHC-type containing 15 1 1
MIRT017788 RASSF6 Ras association (RalGDS/AF-6) domain family member 6 1 1
MIRT017789 C16orf11 chromosome 16 open reading frame 11 1 1
MIRT017790 GDF9 growth differentiation factor 9 1 1
MIRT017791 SLCO4C1 solute carrier organic anion transporter family, member 4C1 1 1
MIRT017792 TBX19 T-box 19 1 1
MIRT017793 HEATR5B HEAT repeat containing 5B 1 1
MIRT017794 CNFN cornifelin 1 1
MIRT017795 INSIG2 insulin induced gene 2 1 1
MIRT017796 GLRA2 glycine receptor, alpha 2 1 1
MIRT017797 TMCC3 transmembrane and coiled-coil domain family 3 1 1
MIRT017798 GBP2 guanylate binding protein 2, interferon-inducible 1 1
MIRT017799 LILRB5 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 1 1
MIRT017800 TEX36 chromosome 10 open reading frame 122 1 1
MIRT017801 RAB37 RAB37, member RAS oncogene family 1 1
MIRT017802 FAM219B chromosome 15 open reading frame 17 1 1
MIRT017803 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT017804 LZTFL1 leucine zipper transcription factor-like 1 1 1
MIRT017805 OR6B1 olfactory receptor, family 6, subfamily B, member 1 1 1
MIRT017806 CHST6 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 1 1
MIRT017807 LMCD1 LIM and cysteine-rich domains 1 1 1
MIRT017808 GABBR1 gamma-aminobutyric acid (GABA) B receptor, 1 1 1
MIRT017809 FGD3 FYVE, RhoGEF and PH domain containing 3 1 1
MIRT017810 NLRP1 NLR family, pyrin domain containing 1 1 1
MIRT017811 NKG7 natural killer cell group 7 sequence 1 1
MIRT017812 SMTNL1 smoothelin-like 1 1 1
MIRT017813 WDR19 WD repeat domain 19 1 1
MIRT017814 TRIM9 tripartite motif-containing 9 1 1
MIRT017815 KLF3 Kruppel-like factor 3 (basic) 1 1
MIRT017816 ATXN1 ataxin 1 1 1
MIRT017817 CYP2E1 cytochrome P450, family 2, subfamily E, polypeptide 1 1 1
MIRT017818 LRRC32 leucine rich repeat containing 32 1 1
MIRT017819 MEIS3P2 Meis homeobox 3 pseudogene 2 1 1
MIRT017820 TMEM86B transmembrane protein 86B 1 1
MIRT017821 GJB2 gap junction protein, beta 2, 26kDa 1 1
MIRT017822 SLC52A1 G protein-coupled receptor 172B 1 1
MIRT017823 TULP3 tubby like protein 3 1 1
MIRT017824 ALG12 asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT017825 RBMY1HP RNA binding motif protein, Y-linked, family 1, member H 1 1
MIRT017826 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT017827 ATP10B ATPase, class V, type 10B 1 1
MIRT017828 C8orf31 chromosome 8 open reading frame 31 1 1
MIRT017829 PLAT plasminogen activator, tissue 1 1
MIRT017830 ZMIZ1 zinc finger, MIZ-type containing 1 1 1
MIRT017831 ZNF460 zinc finger protein 460 1 1
MIRT017832 ACSS3 acyl-CoA synthetase short-chain family member 3 1 1
MIRT017833 KLRC2 killer cell lectin-like receptor subfamily C, member 2 1 1
MIRT017834 CFTR cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) 1 1
MIRT017835 SLC25A23 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 1 1
MIRT017836 HAPLN2 hyaluronan and proteoglycan link protein 2 1 1
MIRT017837 CCL20 chemokine (C-C motif) ligand 20 1 1
MIRT017838 DLG3 discs, large homolog 3 (Drosophila) 1 1
MIRT017839 TTYH2 tweety homolog 2 (Drosophila) 1 1
MIRT017840 ABHD4 abhydrolase domain containing 4 1 1
MIRT017841 TACR2 tachykinin receptor 2 1 1
MIRT017842 SPAG9 sperm associated antigen 9 1 1
MIRT017843 KRT5 keratin 5 1 1
MIRT017844 DLL1 delta-like 1 (Drosophila) 1 1
MIRT017845 HIST1H3C histone cluster 1, H3c 1 1
MIRT017846 TREH trehalase (brush-border membrane glycoprotein) 1 1
MIRT017847 IFI16 interferon, gamma-inducible protein 16 1 1
MIRT017848 CEACAM8 carcinoembryonic antigen-related cell adhesion molecule 8 1 1
MIRT017849 P2RX4 purinergic receptor P2X, ligand-gated ion channel, 4 1 1
MIRT017850 SLC17A3 solute carrier family 17 (sodium phosphate), member 3 1 1
MIRT017851 GPR37L1 G protein-coupled receptor 37 like 1 1 1
MIRT017852 TRIM16 tripartite motif-containing 16 1 1
MIRT017853 LMO3 LIM domain only 3 (rhombotin-like 2) 1 1
MIRT017854 SNTN sentan, cilia apical structure protein 1 1
MIRT017855 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT017856 TSHR thyroid stimulating hormone receptor 1 1
MIRT017857 MXI1 MAX interactor 1 1 1
MIRT017858 SOX9 SRY (sex determining region Y)-box 9 1 1
MIRT017859 RFTN2 raftlin family member 2 1 1
MIRT017860 SH2D3C SH2 domain containing 3C 1 1
MIRT017861 RNU6-50P RNA, U6 small nuclear 50 (pseudogene) 1 1
MIRT017862 LIPG lipase, endothelial 1 1
MIRT017863 LILRB4 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 1 1
MIRT017864 C16orf71 chromosome 16 open reading frame 71 1 1
MIRT017865 FMO6P flavin containing monooxygenase 6 pseudogene 1 1
MIRT017866 ARHGEF37 Rho guanine nucleotide exchange factor (GEF) 37 1 1
MIRT017867 WBP1L chromosome 10 open reading frame 26 1 1
MIRT017868 POLD4 polymerase (DNA-directed), delta 4 1 1
MIRT017869 RAPGEF2 Rap guanine nucleotide exchange factor (GEF) 2 1 1
MIRT017870 TTC18 tetratricopeptide repeat domain 18 1 1
MIRT017871 IGFBP4 insulin-like growth factor binding protein 4 1 1
MIRT017872 ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 1 1
MIRT017873 ZNF804B zinc finger protein 804B 1 1
MIRT017874 DPYSL5 dihydropyrimidinase-like 5 1 1
MIRT017875 ZPBP2 zona pellucida binding protein 2 1 1
MIRT017876 TTLL5 tubulin tyrosine ligase-like family, member 5 1 1
MIRT017877 SLC27A1 solute carrier family 27 (fatty acid transporter), member 1 1 1
MIRT017878 CLDN7 claudin 7 1 1
MIRT017879 PPP1R10 protein phosphatase 1, regulatory (inhibitor) subunit 10 1 1
MIRT017880 TEKT4 tektin 4 1 1
MIRT017881 GAGE12H G antigen 12H 1 1
MIRT017882 NEURL2 neuralized homolog 2 (Drosophila) 1 1
MIRT017883 TESPA1 KIAA0748 1 1
MIRT017884 SEC16B SEC16 homolog B (S. cerevisiae) 1 1
MIRT017885 RASSF5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT017886 OPN1MW opsin 1 (cone pigments), medium-wave-sensitive 1 1
MIRT017887 MAST1 microtubule associated serine/threonine kinase 1 1 1
MIRT017888 MXD4 MAX dimerization protein 4 1 1
MIRT017889 RP1L1 retinitis pigmentosa 1-like 1 1 1
MIRT017890 TSPAN15 tetraspanin 15 1 1
MIRT017891 TBC1D22B TBC1 domain family, member 22B 1 1
MIRT017892 ZPBP zona pellucida binding protein 1 1
MIRT017893 C8orf4 chromosome 8 open reading frame 4 1 1
MIRT017894 LINC00305 chromosome 18 open reading frame 20 1 1
MIRT017895 RTP1 receptor (chemosensory) transporter protein 1 1 1
MIRT017896 TMOD4 tropomodulin 4 (muscle) 1 1
MIRT017897 BTN2A3P butyrophilin, subfamily 2, member A3 1 1
MIRT017898 DMXL1 Dmx-like 1 1 1
MIRT017899 S100A5 S100 calcium binding protein A5 1 1
MIRT017900 SPATA9 spermatogenesis associated 9 1 1
MIRT017901 BTLA B and T lymphocyte associated 1 1
MIRT017902 ENDOU endonuclease, polyU-specific 1 1
MIRT017903 POR P450 (cytochrome) oxidoreductase 1 1
MIRT017904 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT017905 C6orf195 chromosome 6 open reading frame 195 1 1
MIRT017906 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT017907 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 1
MIRT017908 WISP3 WNT1 inducible signaling pathway protein 3 1 1
MIRT017909 SLC7A9 solute carrier family 7 (cationic amino acid transporter, y+ system), member 9 1 1
MIRT017910 ADAM2 ADAM metallopeptidase domain 2 1 1
MIRT017911 GCNT3 glucosaminyl (N-acetyl) transferase 3, mucin type 1 1
MIRT017912 PADI4 peptidyl arginine deiminase, type IV 1 1
MIRT017913 DNAJC13 DnaJ (Hsp40) homolog, subfamily C, member 13 1 1
MIRT017914 C3orf36 chromosome 3 open reading frame 36 1